Pumpkin Plants Research Articles

Review on the Glutinous Physiological Quality and SS Genes Polymorphism of Indian Pumpkin Germplasm Resources

Indian pumpkin, as one of the major cultivars of annual trailing herbaceous plants of the genus Pumpkin in the family Cucurbitaceae, is native to South America and widely grown in China, especially in Zhejiang Province, which is an important garden crop and food crop in China. Starch is an important component of pumpkin pulp and an important basis for the glutinous quality of pumpkin germplasm resources, and its synthesis is mainly determined by the SS (Starch synthases) gene in pumpkin. This review takes Indian pumpkin as an example to summarize the current progress of research on starch and explore its biosynthesis and regulatory processes, including the analysis of the physicochemical properties of the SS gene and the construction and analysis of the evolutionary tree, etc. Meanwhile, with the development of molecular marker technology, it has become possible to utilize bioinformatics tools to analyze the sequence and predict the physicochemical properties of the SS gene family members in Indian pumpkin, and the use of related technologies will promote pumpkin related results into life use.

Therapeutic and Pharmacological Properties of Pumpkin Seeds: A Comprehensive Review

A well-known edible plant in the Cucurbitaceae family, the pumpkin has long been utilized as a functional meal or a herbal remedy. Pumpkin seeds are rich in phytoestrogens, vitamin E, and unsaturated fatty acids, which may have medicinal and nutraceutical uses. The use of pumpkins in traditional medicine to treat a wide range of conditions, including inflammation, dyslipidemia, bacterial or fungal infections, malignancies, intestinal parasites, hypertension, arthritis, and hyperglycemia, has drawn attention to the need for additional study on both the fruits and seeds of the pumpkin plant. Proteins, antioxidative phenolic compounds, tocopherols, triterpenes, saponins, phytosterols, lignans, and carotenoids are some of the micro- and macro-constituent compositions that improve pumpkin seeds. Pumpkin seeds have antidepressant properties and are mostly used in the management of benign prostatic hyperplasia (BHP). Regular pumpkin seed eating lowers the risk of Parkinson's and Alzheimer's disease. Since pumpkin seeds are high in tocopherols, they can be extracted for edible oil and then used to formulate other foods at a later time. The pharmacological effects of pumpkin seeds have made them quite popular. Additionally, pumpkin seed oil has numerous health advantages. Pumpkin seeds are mostly composed of unsaturated fatty acids, which have been shown to provide potential health benefits and to prevent disease. Although pumpkin seeds are clearly very useful, their full potential has not yet been discovered.

Effect of Mineral and Bio Nitrogen Fertilizer and Foliar Spray with Some Growth Stimulants on Growth, Yield and Quality of Pumpkin Plants

Effect of Mineral and Bio Nitrogen Fertilizer and Foliar Spray with Some Growth Stimulants on Growth, Yield and Quality of Pumpkin Plants

A Precise Segmentation Algorithm of Pumpkin Seedling Point Cloud Stem Based on CPHNet.

Accurate segmentation of the stem of pumpkin seedlings has a great influence on the modernization of pumpkin cultivation, and can provide detailed data support for the growth of pumpkin plants. We collected and constructed a pumpkin seedling point cloud dataset for the first time. Potting soil and wall background in point cloud data often interfere with the accuracy of partial cutting of pumpkin seedling stems. The stem shape of pumpkin seedlings varies due to other environmental factors during the growing stage. The stem of the pumpkin seedling is closely connected with the potting soil and leaves, and the boundary of the stem is easily blurred. These problems bring challenges to the accurate segmentation of pumpkin seedling point cloud stems. In this paper, an accurate segmentation algorithm for pumpkin seedling point cloud stems based on CPHNet is proposed. First, a channel residual attention multilayer perceptron (CRA-MLP) module is proposed, which suppresses background interference such as soil. Second, a position-enhanced self-attention (PESA) mechanism is proposed, enabling the model to adapt to diverse morphologies of pumpkin seedling point cloud data stems. Finally, a hybrid loss function of cross entropy loss and dice loss (HCE-Dice Loss) is proposed to address the issue of fuzzy stem boundaries. The experimental results show that CPHNet achieves a 90.4% average cross-to-merge ratio (mIoU), 93.1% average accuracy (mP), 95.6% average recall rate (mR), 94.4% F1 score (mF1) and 0.03 plants/second (speed) on the self-built dataset. Compared with other popular segmentation models, this model is more accurate and stable for cutting the stem part of the pumpkin seedling point cloud.

The Influence of Biochar on Heavy Metals Phytoaccumulation by Okra and Fluted Pumpkin Plants in Soil Contaminated With Petroleum Hydrocarbons

ABSTRACTThe study is aimed at assessing the impact of biochar on the phytoaccumulation of heavy metals by okra and fluted pumpkin plants in soil polluted with petroleum hydrocarbons, and its corresponding environmental and health‐related risks. A field experiment was conducted at the automobile workshop (commonly called mechanic village) using a randomized complete block design (RCBD). The field was divided into plots and three replicates. Maize stalk biochar (MSB) and nipa palm biochar (NPB) were treated differently in each plot at a rate of 20 t ha−1. Plots containing no biochar were used as controls. The soil samples were analyzed for petroleum hydrocarbon content (PHCt), selected heavy metals as well as some other soil physicochemical properties. Plant samples were only analyzed for heavy metal contents. Analysis of variance was used to analyze the data generated. The PHCt and heavy metal content in the soil were compared with the target values set by the Department of Petroleum Resources of Nigeria whereas heavy metals in plants were compared with FAO/WHO guidelines. Okra and fluted pumpkin were evaluated for phytoaccumulating potential using bioaccumulation factor (BAF). Ecological risk assessment was done using a hazard quotient (HQ). The PHCt, cadmium (Cd), chromium (Cr), and nickel (Ni) were significantly decreased following the application of biochar. The NPB recorded the lowest values for PHCt (64.4 mg kg−1), lead (16.0 mg kg−1), and Ni (12.8 mg kg−1) contents while MSB had the lowest values for Cd (0.3 mg kg−1) and Cr (7.6 mg kg−1) contents. The HQ analysis showed that Cr (2.93 mg kg−1) and Pb (156.83 mg kg−1) posed a very high ecological risk to the local ecosystem. The phytoaccumulated heavy metals in plants were above the maximum allowable levels, except Ni where the content was below the maximum allowable levels. Fluted pumpkin had the highest BAF values for Cd, Cr, Pb, and Ni. Therefore, fluted pumpkin can be used as an efficient phytoremediator for soil contaminated with Cd, Cr, Pb, and Ni.

Improving of vitamins C and D3 content of medicinal pumpkin plant grown under organic farming programs

This study aimed to evaluate the application of different farming programs. Three organic farming (P2, P3, P3) were used and compared with traditional programs (P1, chemical). Their effect in improving medicinal pumpkin seeds quality was examined. As a quality addition of supplying chain, the quantitative and qualitative content of vitamins C and D3 were assayed. This plant seeds are considered of healthy and medical importance, and have their marketing placement. A big amount of the seeds have been consumed directly by human year round. Using the seeds in food production processes increased their nutritional value. The field experiment was conducted on two dates. The design used was the randomized complete block design. All data were collected and analyzed according to ANOVA table using Duncan’s multiple range test at P= 0.05. The results obtained showed significant distinguish of the organic farming program (P3) compared to the rest the programs used. This treatment had significant increase of vitamins C and D3 content in the seeds in the two dates (0.0883 mg l-1, 0.08671 mg l-1, 12.38 mg l-1 and 12.32 mg l-1 respectively). The other two organic programs (P2, P4) were significantly distinct compared to the traditional one (P1). The study concluded that these studied organic programs can be an effective choice to improve seed quality of this crop. The healthy and nutritional value are enhanced, and the side effects of traditional agriculture on the environment are reduced

First report of leaf blight on pumpkin caused by Nigrospora sphaerica in China.

Pumpkin (Cucurbita moschata), which belongs to the gourd family (Cucurbitaceae), is widely planted throughout the world. In June 2023, many pumpkin plants (cv. Miben) displayed leaf blight and chlorosis in fields located in Suizhou (31.99°N, 113.02°E), Hubei Province, China. The disease incidence ranged from 30 to 40% in nine fields, 6.3 ha in total. The symptoms were irregularly shaped lesions that expanded along the mid-vein until the leaf turned brown and wilted. Fungal isolations were performed as described previously (Liu et al. 2023). Twenty pumpkin leaf samples with typical symptoms were collected and cut into 1 cm×1 cm pieces. The diseased tissue was surface-sterilized in 75% ethanol for 30 sec, plated on potato dextrose agar (PDA) medium and incubated at 25℃ for 3 days. Then, the emerging single fungal hyphal tip was transferred onto PDA plates to obtain purified isolates. A total of eighteen isolates on PDA plates were initially white and then developed to dark gray. The 5-day-old cultures growing on mung bean medium produced conidia that were black, single-celled, smooth, spherical or oblate, and ranged in size from 14.5 to 20.8 μm×13.3 to 20.5 μm (n=50). Therefore, the isolates were morphologically identified as Nigrospora sphaerica. Moreover, the genomic DNA of the isolates (HB-P1,HB-P2, and HB-P3) was extracted for amplification and sequencing of the regions of internal transcribed spacer (ITS) (White et al. 1990), nuclear large subunit rRNA (nLSU) (O'Donnell 1992; Rehner and Samuels 1994), and β-tubulin (TUB2) (Glass and Donaldson 1995), with primers ITS1/ITS4, LROR/LR3, and Bt2a/Bt2b, respectively. Sequences were submitted to GenBank under accession numbers PP348112, PP348113, PP348114 (ITS), PP411414, PP411415, PP411416 (nLSU), and PP357438, PP357439, PP357440 (TUB2). BLASTn showed that the sequences ITS, nLSU, and TUB2 of HB-P1, HB-P2, and HB-P3 had >99% nucleotide identities ((ITS: 100%, 508/508 bp, MF996488.1; 99.8%, 506/507, ON326588.1; 100%, 500/500 ,MK748317.1), (nLSU: 99.83%, 573/574, KT462720.1; 99.83% , 574/575 bp, KT462720.1; 99.65%, 575/577, KT462720.1), and (TUB2: 100%, 388/388, MN719407.1; 99.74%, 387/388, MN719407.1; 100%, 387/387, MN719407.1)) with Nigrospora sphaerica, respectively. A multilocus (ITS, nLSU and TUB2) phylogenetic analysis indicated that the isolates were Nigrospora sphaerica. Pathogenicity of three isolates were tested on pumpkin plants (cv. Miben). Fifteen pumpkin plants were inoculated by spraying the leaves (1×106 spores/ml), respectively, and 10 pumpkin plants were treated with sterile water as a negative control. All plants were incubated in an artificial climate box (LongYue, ShangHai) at 25℃ for 12 days. The experiment was repeated three times. Twelve days later, the inoculated pumpkin plants developed symptoms of leaf blight, while the control plants remained healthy. Then, pathogens were re-isolated from the each leaf of inoculated pumpkin plants and not from the control plants. Nigrospora sphaerica has been previously reported to cause leaf spot on watermelon in Malaysia (Ismail and Abd Razak 2021). To our knowledge, this is the first report of N. sphaerica causing leaf blight on pumpkin in China. This new disease can cause leaf blight, which may affect pumpkin productivity.

First Report of Cucurbit Yellow Vine Disease Caused by Serratia marcescens on Cucurbit Crops in Iowa

Cucurbit yellow vine disease (CYVD) is caused by Serratia marcescens, vectored by squash bugs (Anasa tristis), and is an emerging disease in many parts of the U.S. CYVD can cause 100% yield losses in cucurbits (Bruton et al., 2003). In the summer of 2021, at the Iowa State University Horticultural Research Station (HRS) in Gilbert, Iowa, we observed leaf yellowing, vine decline, and honey-brown discoloration of the phloem of acorn squash (Cucurbita pepo cv. Table Ace) plants in research fields that were infested with squash bugs. In 2022, we observed similar symptoms on pumpkin (Cucurbita maxima cv. Howden) and muskmelon (Cucumis melo cv. Athena) in different fields at the HRS and on giant pumpkins (Cucurbita maxima cv. Prizewinner) in Jones and Ringgold counties. For up to 3 symptomatic plants of each cucurbit species per location, a 20-cm-long stem section immediately above the soil line was excised, surface sterilized by immersion in 10% sodium hypochlorite and 70% ethanol for 2 min each, then triple rinsed in sterile water. The interior of the cross-section tissue was blotted on Luria agar amended with cycloheximide (100 μg/ml) and tetracycline (20 μg/ml) (Stock et al. 2003). Whitish translucent colonies developed after incubation at 28°C for 48 h. The genomic DNA of three isolates from symptomatic plants of muskmelon (MK01), pumpkin (HFP01), and giant pumpkin (AP01), was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD). S. marcescens species-specific primers YV1 (5’-GGGACTTGCTCCCCGG-3’) and YV4 (5’-AACGTCAATTGATGAACGTATTAAGT-3’) (Bruton et al. 2003) were used to amplify part of the 16S rDNA gene, and the primers specific to S. marcescens CYVD strains A79F/A79R (Zhang et al., 2005) were used to amplify part of a major facilitatory superfamily (MFS) transporter gene strain. The sequences of the 16S rRNA PCR product for the three isolates were identical and were deposited in NCBI under Accession OR963533. They shared 100% (395/395 nt) identity with other CYVD strains (Rascoe et al. 2003) and those of other S. marcescens strains in NCBI. The sequences of the amplified region of the MFS transporter gene of the three isolates (NCBI Accession OR962261) were identical and showed a 98.8% (319/323 nt) identity to that of non-CYVD-causing S. marcescens strains, such as N10A28 (Accession CP033623.1). Koch’s postulates were fulfilled by inoculating C. pepo cv. Zephyr plants with either strain HFP01 or phosphate buffer saline (PBS) (10 plants per treatment) 1 wk after seeding by injecting 300 µl of bacteria (~108 CFU/ml) or PBS using a syringe needle. Plants were incubated at 28°C in a growth room for 4 wks. CYVD symptoms similar to those observed in the field developed on 7 out of 10 plants inoculated with strain HFP01 in one study, and 9 out 10 plants in a replicate study, with none of the PBS-inoculated plants showing CYVD symptoms. Bacteria were isolated from the symptomatic plants with selection on tetracycline. The PCR fragments amplified with YV1/YV4 and A79F/A79R were the same size as those of the pre-inoculation strain HFP01. To our knowledge this is the first report of CYVD in Iowa and in the Upper Midwest of the U.S. CYVD is a devastating disease that poses a significant threat to cucurbit production. This report can serve as an alert for the region’s growers and for the development of effective management practices.

Potencial bioestimulante de Azospirillum brasilense e nicotinamida para cultivo hidropônico de abóbora

ABSTRACT The application of biostimulants in agriculture has been studied to increase production while using smaller physical spaces and agricultural inputs to increase sustainability in production systems. Despite the promising results, there is a need to study the effects of joint applications of these products, identifying possible interactions during crop development. Thus, this study aimed to verify the biostimulant potential of the isolated and combined use of nicotinamide and Azospirillum brasilense during the initial growth of pumpkin plants in hydroponic cultivation. A completely randomized design with six treatments and four replicates was performed. The treatments were composed by the combination of the application of nicotinamide (foliar) and A. brasilense (foliar or applied in the hydroponic solution). Treatments increased the gas exchanges, particularly the assimilation rate and carboxylation efficiency, being superior to the control treatment. However, for growth characteristics, the isolated application of nicotinamide favored the development of the shoot and, when combined with A. brasilense via foliar, increased root growth. Thus, the application of nicotinamide and A. brasilense alone or together enhances the growth and gas exchanges of pumpkin plants grown in a hydroponic system, especially when using foliar application of A. brasilense. Whereby its action can be referred to as a biostimulant effect. Furthermore, the application method affects the efficiency and compatibility of the products applied. Therefore, foliar application is recommended.

Studies on the transmission of Squash Leaf Curl China Virus causing yellow mosaic and leaf curl disease in pumpkin

Viruses pose a significant threat to pumpkin cultivation, leading to substantial yield losses and reduced fruit quality. Understanding the transmission dynamics and disease progression of Squash Leaf Curl China Virus (SLCCV), a major virus affecting pumpkin, will contribute to developing effective management strategies for this crop. Our study aimed to develop an efficient mechanical inoculation method for SLCCV in pumpkin and investigate whitefly transmission. Mechanical inoculation was assessed using different buffers (I, II, and III) for preparing the viral inoculum. Buffer III, consisting of phosphate buffer, β-mercaptoethanol, and Na2SO3, showed the highest severity of symptoms and incidence of infection in the susceptible pumpkin variety Pusa Vishwas. The summer season was the most favourable for virus transmission, and plant parts such as expanded leaves, middle leaves, and stems exhibited higher infectivity than other parts. A minimum of two whiteflies per plant successfully transmitted the virus to pumpkin plants, resulting in yellow mosaic symptoms and stunted growth. The transmission efficiency increased with an increase in number of whiteflies per plant. A minimum acquisition access feeding period (AAP) of 10 min. and an inoculation access feeding period (IAP) of 24 h were optimal for whitefly-mediated transmission of SLCCV. These findings highlight the importance of vector control strategies, such as insecticides and physical barriers to prevent whitefly-mediated transmission of SLCCV in pumpkin. This is the first report of sap transmission of SLCCV in pumpkin, emphasizing the importance of developing and implementing comprehensive control strategies that address all possible routes of infection.

CmoPIP1-4 confers drought tolerance in pumpkin by altering hydrogen sulfide signaling

Drought is a major limiting factor for the growth and development of pumpkins. Plasma membrane intrinsic proteins (PIPs) are major water channels that play a crucial role in the regulation of cellular water status and solute trafficking during drought conditions. CmoPIP1-4 is a plasma membrane-localized protein that is significantly upregulated in roots and leaves under drought-stress conditions. In this study, the overexpression of CmoPIP1-4 enhances drought resistance in yeast. In contrast, CRISPR-mediated CmoPIP1-4 knockout in pumpkin roots increased drought sensitivity. This increased drought sensitivity of CmoPIP1-4 knockout plants is associated with a decline in the levels of hydrogen sulfide (H2S) and abscisic acid (ABA), accompanied by an increase in water loss caused by greater levels of transpiration and stomatal conductance. In addition, the sensitivity of CmoPIP1-4 CRISPR plants is further aggravated by reduced antioxidative enzyme activity, decreased proline and sugar contents, and extensive root damage. Furthermore, expression profiles of genes such as CmoHSP70s, CmoNCED3, CmoNCED4, and others involved in metabolic activities were markedly reduced in CmoPIP1-4 CRISPR plants. Moreover, we also discovered an interaction between the drought-responsive gene CmoDCD and CmoPIP1-4, indicating their potential role in activating H2S-mediated signaling in pumpkin, which could confer drought tolerance. The findings of our study collectively demonstrate CmoPIP1-4 plays a crucial role in the regulation of H2S-mediated signaling, influencing stomatal density and aperture in pumpkin plants, and thereby enhancing their drought tolerance.

The effects of high temperature and low humidity on crop water stress index of seed pumpkin plants (Cucurbita pepo L.) in semi-arid climate conditions

This study aimed to evaluate the effects of high temperature and low humidity on the crop water stress index (CWSI) of seed pumpkin plants grown under semi-arid climate conditions to determine the optimum irrigation time. This research unveils the critical impact of high temperature and low humidity on seed pumpkin growth, emphasizing the vital role of the CWSI in optimizing irrigation strategies and seed yield. Moreover, the relationship between CWSI, physiological parameters, and seed yield of the pumpkin was investigated. The mean CWSI values in the I70 (0.40) and I35 (0.56) treatments were 42% and 100% higher, respectively than those in the full irrigation (I100) treatment (0.28). While the I70 treatment showed manageable water stress with minimal impact, the I35 treatment experienced severe stress, significantly reducing crop growth and yield. The mean seed yield (SY) in the I70 treatment increased to 1245.2 kg ha–1 compared to I35 (903.3 kg ha–1) but remained lower than I100 (1339.3 kg ha–1). The CWSI had negative correlations (p ≤ 0.01) with seed yield, chlorophyll content, and leaf area index, while it had positive correlations with water use efficiency and irrigation water use efficiency (p ≤ 0.01). This study showed that pumpkins could be grown successfully at 30% water deficit conditions, and a water deficit higher than 30% may cause a significant seed yield loss in semi-arid climate conditions. In addition, the results highlight the importance of optimal irrigation and CWSI monitoring for informed irrigation decisions and sustainable agricultural practices. Therefore, moderate water deficit (I70) can be adopted in pumpkin cultivation as an alternative to full irrigation.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

Perendaman Benih Melon Dengan PGPR Pseudomonas sp. dan Bacillus sp. di Dusun Ngadilegi Utara, Kecamatan Pandaan, Kabupaten Pasuruan

Ngadilegi Utara Hamlet is one of the hamlets in Plinlahan Village, Pandaan District, Pasuruan Regency which has large potential land for cultivating plants. Farmers in Ngadilegi Hamlet grow many crop commodities, one of which is melons. Melon (Cucumis melo L) is an annual fruit plant originating from the Persian Hot Valley or the Mediterranean region which is the border between West Asia, Europe and Africa. Melon plants are a type of pumpkin plant which is in the same family as watermelon, cantaloupe and cucumber. One effort to increase melon production in North Ngadilegi Hamlet can be done by good development and correct cultivation technology and supported by the use of new technology, namely the use of bacteria contained in PGPR. Soaking seeds with PGPR aims to ensure that the bacteria contained in PGPR are able to colonize the seeds as early as possible. Proper long soaking treatment of seeds can increase plant yields because bacteria will bind to the seed coat and imbibition into the seeds.

Comprehensive evaluation of the water-fertilizer coupling effects on pumpkin under different irrigation volumes.

Compared to conventional irrigation and fertilization, the Water-fertilizer coupling can significantly enhance the efficiency of water and fertilizer utilization, thereby promoting crop growth and increasing yield. Targeting the challenges of poor crop growth, low yield, and inefficient water and fertilizer utilization in the arid region of northwest China under conventional irrigation and fertilization practices. Therefore, a two-year on-farm experiment in 2022 and 2023 was conducted to study the effects of water-fertilizer coupling regulation on pumpkin growth, yield, water consumption (ET), and water and fertilizer use efficiency. Simultaneously the comprehensive evaluation of multiple objectives was carried out using principal component analysis (PCA) methods, so as to propose an suitable water-fertilizer coupling regulation scheme for the region. The experiment was set up as a two-factor trial using water-fertilizer integration technology under three irrigation volume (W1=37.5mm, W2=45.5mm, W3=52.5mm) and three organic fertilizer application amounts (F1=3900-300kg ha-1, F2=4800-450 kg·ha-1, F3=5700-600 kg·ha-1), with the traditional irrigation and fertilization scheme from local farmers as control treatments (CK). The results indicated that irrigation volume and organic fertilizer application significantly affected pumpkin growth, yield, and water and fertilizer use efficiency (P<0.05). Pumpkin yield increased with increasing irrigation volume. Increasing organic fertilizer levels within a certain range benefited pumpkin plant growth, dry matter accumulation, and yield, however, excessive application beyond a certain level had inhibited effects on those. The increased fertilizer application under the same irrigation volume enhanced the efficiency of water and fertilizer utilization. However excessive irrigation only resulted in inefficient water consumption, reducing the water and fertilizer use efficiency. The Comprehensive evaluation by PCA revealed that the F2W3 treatment outperformed all the others, effectively addressing the triple objectives of increasing production, improving efficiency, and promoting green production. Therefore, F2W3 (Irrigation volume: 52.5mm; Fertilizer application amounts: 4800-450 kg/ha-1) as a water and fertilizer management scheme for efficient pumpkin production in the arid region of northwest China.

Analysis of the properties of a novel natural fibre extracted from pumpkin plant stalks: A sustainable alternative for lightweight applications

This study explores the characterization and potential applications of cellulose fibre extracted from pumpkin stems by the water retting process. X-ray diffraction (XRD) analysis revealed distinct diffraction peaks at 13.2° and 16.8° (2θ), indicating a well-ordered crystalline structure with a crystallinity index of 24.3 %. Fourier-transform infrared (FTIR) spectroscopy identified characteristic peaks at 1430 cm−1 (O-H stretching), 1510 cm−1 (C-H stretching), 1630 cm−1 (C = O stretching), and 1055 cm−1 (C-O-C glycosidic linkage vibrations) confirming the presence of cellulose with vital functional groups. Scanning Electron Microscopy (SEM), analysis revealed a fibrous and porous structure with smooth, cylindrical fibres. The study also assessed the antibacterial properties of pumpkin cellulose fibre against Staphylococcus aureus and Enterococcus faecalis, demonstrating significant inhibitory effects. These findings suggest its potential in healthcare applications, including wound dressings and lightweight structural and medical textiles.

Developing an Empowerment Model for University Students' Skills in the Cultivation of Pumpkin Plants

This study aimed to develop an empowerment model for students’ skills in cultivating pumpkin plants, especially for community education at the Faculty of Teacher Training and Education at University in Palembang. The type of research used was modified with four stages based on the ADDIE process: analyze, design, develop, and implement. The research subjects were Community Education Faculty of Teacher Training and Education students and two validators. The researchers conducted a group test with 26 students. Through this test, researchers can discover the weaknesses and shortcomings of the empowerment model based on how students assess the design, scope of material and techniques used. The data were collected using questionnaires. The results showed that at the stage of needs analysis through the distribution of online questionnaires, it was found that students needed this empowerment model to support various activities in the Education Park. Furthermore, the planning stage, which produces a storyboard as the initial design of the product, and the results from the validation test stage for development by validator experts make a total score of 111 with an average percentage of 92.45% and excellent feasibility. These results indicate that the product can be applied at the Education Park Faculty of Teacher Training and Education Students at Sriwijaya University. The next stage is implementation, with the results of product trials in small groups resulting in a total score of 1196 with a percentage of 92%, which indicates that the product is feasible to be applied.

PHYTOCHEMICALS AND PHARMACOLOGICAL POTENTIALS OF CUCURBITA MAXIMA: A REVIEW

In ancient literature, we find references to the therapeutic use of about 500 plants; indigenous medical practices make use of about 800 plants. The pumpkin plant (Cucurbita maxima) is a creeper that is commonly seen growing on the rooftops of homes in India. Seeds, pulp, and fruit stalks are all put to good use. In addition to its potent antioxidant properties, pumpkin seed oil has been lauded for its ability to treat a variety of medical conditions, including but not limited to the prevention and reduction of prostate growth and size; the reduction of bladder and urethral pressure, the improvement of bladder compliance; the alleviation of diabetes by promoting hypoglycemic activity; and the reduction of gastric, breast, lung, and colorectal cancer. Chemical compounds can be extracted from seeds, including 24-ethyl-5-cholesta-7,22-trien-3-ol, 24-ethyl-5-cholesta-7,25-dien-3-ol, avenasterol, spinasterol, 24-dihydrospinasterol, 24-methyl lathosterol, and 25(27)-dehydrofungisterol. From the seeds, I extracted 25-(27) dehydroporiferasterol, clerosterol, isofucosterol, stigmasterol, sitosterol, campesterol, and codisterol. Traditionally, it has been utilized in headaches, nerve pain, inflammation, abscesses, and boils etc. Different parts of C. maxima have been evaluated for numerous pharmacological activities i.e., anticancer, anti-obesity, antidiabetic, hepatoprotective, diuretic, antioxidant, immunogenic, cardiotonic, antidepressant, hypolipidemic, antiarthritic and antifungal. Seed extract from the Saw Palmetto plant is used to treat benign prostatic hyperplasia, sometimes in combination with other botanicals in order to cure prostate cancer. In conclusion, the pumpkin plant is highly promising in the coming era with diverse nutritional and pharmacological properties.

Evaluasi efektivitas tanaman repelen dalam pengendalian penggerek batang Apomecyna saltator F. (Coleoptera: Cerambycidae) pada tanaman labu madu dengan pola tanam tumpang sari

Apomecyna saltator Fabricius (Coleoptera: Cerambycidae) merupakan hama tanaman labu madu yang keberadaannya perlu dikendalikan. Namun, informasi mengenai hama ini masih sangat terbatas. Pengendalian dengan penerapan pola tumpang sari memiliki prospek dan perlu dikembangkan untuk pengendalian hama ini sebagai bagian integral dari pengembangan pengendalian hama terpadu A. saltator. Penelitian ini dilakukan untuk mengetahui pengaruh pola tanam tumpang sari tanaman labu madu dengan beberapa tanaman repelan terhadap persentase infestasi, populasi larva/pupa A. saltator, dan produksi labu madu. Penelitian ini dirancang dengan rancangan acak kelompok (RAK) yang terdiri atas 4 perlakuan, yaitu monokultur tanaman labu madu (A); tumpang sari tanaman labu madu dan serai (B); tumpang sari tanaman labu madu dan kunyit (C); tumpang sari tanaman labu madu dan bawang daun (D). Setiap perlakuan diulang sebanyak 6 kali. Hasil menunjukkan bahwa rata-rata persentase infestasi A. saltator sampai 56 hari setelah tanam (HST) untuk semua perlakuan berkisar 72–79,6%. Populasi larva/pupa A. saltator berkisar 107–128 individu/9 tanaman. Produksi labu madu berkisar 21,97–26,75 kg/9 tanaman. Dari hasil penelitian ini disimpulkan bahwa tanaman kunyit, serai, dan bawang daun tidak berpengaruh terhadap persentase infestasi, populasi A. saltator, dan produksi labu madu.

Identification of a Cucumber Mosaic Virus from Cucurbita pepo on New Reclamation Land in Egypt and the Changes Induced in Pumpkin Plants

In 2020, the leaves and fruit of 50 pumpkin plants with suspected cucumber mosaic virus (CMV) symptoms of leaf mosaic, vein yellowing, and mild leaf curling were collected from Sharq El-Owainat (Al Wadi El-Gaded governorate), a new reclamation land in Egypt. This study was aimed at deciphering and characterizing the causal agent of the leaf yellowing disease associated with pumpkin plants in Egypt. The causal agent was identified by serological, cytological, and molecular means. The serological identification by DAS–ELISA confirmed the presence of CMV in 20% of the plants. The cytological identification by electron microscopy revealed typical cucumovirus isometric particles of 28–30 nm diameter in the cytoplasm of the leaf parenchyma, epidermal cells, the integument, and the nucleus. Molecular characterization by one-step reverse transcriptase-PCR yielded the required size of amplicon (678 bp) for CMV. Additionally, mechanical sap inoculation was used to determine the host range and symptomatology of the isolated CMV in seventeen different plant species belonging to six different plant families. CMV replicated, moved systemically, and induced a range of symptoms in sixteen plant species. The isolated CMV was transmitted to pumpkin plants at a 16.4% rate by seeds. CMV-infected pumpkin plant leaves were characterized by a substantially low concentration of photosynthetic pigments, a high level of reducing sugars, relatively low protein levels, and a significant increase in total phenol contents, implying their potential role as antiviral agents. Ultrathin sections of infected cells revealed histological changes and cytological abnormalities in comparison to healthy plants. This is the first identification of CMV on new reclamation land in Egypt, pinpointing its swift spread, which could pose a major constraint to pumpkin production in Egypt.