Polyacrylamide Gel Electrophoresis Of Proteins Research Articles

Real-time and quantitative protein detection via polyacrylamide gel electrophoresis and online intrinsic fluorescence imaging

The detection of intrinsic protein fluorescence is a powerful tool for studying proteins in their native state. Thanks to its label-free and stain-free feature, intrinsic fluorescence detection has been introduced to polyacrylamide gel electrophoresis (PAGE), a fundamental and ubiquitous protein analysis technique, to avoid the tedious detection process. However, the reported methods of intrinsic fluorescence detection were incompatible with online PAGE detection or standard slab gel. Here, we fulfilled online intrinsic fluorescence imaging (IFI) of the standard slab gel to develop a PAGE-IFI method for real-time and quantitative protein detection. To do so, we comprehensively investigated the arrangement of the deep-UV light source to obtain a large imaging area compatible with the standard slab gel, and then designed a semi-open gel electrophoresis apparatus (GEA) to scaffold the gel for the online UV irradiation and IFI with low background noise. Thus, we achieved real-time monitoring of the protein migration, which enabled us to determine the optimal endpoint of PAGE run to improve the sensitivity of IFI. Moreover, online IFI circumvented the broadening of protein bands to enhance the separation resolution. Because of the low background noise and the optimized endpoint, we showcased the quantitative detection of bovine serum albumin (BSA) with a limit of detection (LOD) of 20 ng. The standard slab gel provided a high sample loading volume that allowed us to attain a wide linear range of 0.03–10 μg. These results indicate that the PAGE-IFI method can be a promising alternative to conventional PAGE and can be widely used in molecular biology labs.

The Mobility of Eurasian Avian-like M2 Is Determined by Residue E79 Which Is Essential for Pathogenicity of 2009 Pandemic H1N1 Influenza Virus in Mice.

In 2009, a novel H1N1 influenza virus caused the first influenza pandemic of the 21st century. Studies have shown that the influenza M gene played important roles in the pathogenicity and transmissibility of the 2009 H1N1 pandemic ((H1N1)pdm09), whilst the underlying mechanism remains unclear. The influenza M gene encodes two proteins, matrix protein 1 and matrix protein 2, which play important roles in viral replication and assembly. In this study, it is found that the M2 protein of the (H1N1)pdm09 virus showed a lower mobility rate than the North America triple-reassortant influenza M2 protein in Polyacrylamide Gel Electrophoresis (PAGE). The site-directed mutations of the amino acids of (H1N1)pdm09 M2 revealed that E79 is responsible for the mobility rate change. Further animal studies showed that the (H1N1)pdm09 containing a single M2-E79K was significantly attenuated compared with the wild-type virus in mice and induced lower proinflammatory cytokines and IFNs in mouse lungs. Further in vitro studies indicated that this mutation also affected NLRP3 inflammasome activation. To reveal the reason why they have different mobility rates, a circular dichroism spectra assay was employed and showed that the two M2 proteins displayed different secondary structures. Overall, our findings suggest that M2 E79 is important for the virus replication and pathogenicity of (H1N1)pdm09 through NLRP3 inflammasome and proinflammatory response.

Ultrasound and enzyme‐pretreated extraction for the valorization of pea pod proteins

AbstractPea pod (PP) is an agricultural by‐product with 10%–13% protein content which has a potential to be converted to value‐added ingredients. In this study, different protein extraction strategies including three different solvents (water, salt, and alkaline) and two different pretreatments (ultrasound [US] and enzyme such as pectinase and Viscozyme®) before conventional alkaline extraction were employed to maximize the extraction yield. The US‐pretreated alkaline extraction achieved the highest yield (21.1%) in protein extracts under optimum conditions (30% amplitude for 5 min). PP protein concentrates showed significant differences in solubility, sodium dodecyl sulfate–polyacrylamide gel electrophoresis protein patterns, scanning electron microscopy images, and color depending on the applied extraction method. All PP residues after extraction still remained protein (5.2–8.0 g/100 g) regardless of the extraction techniques, representing the challenges in protein extraction from agricultural by‐products with a lignocellulosic matrix. The combined use of US and enzyme treatments should be further investigated for higher extraction yields.Practical ApplicationsAgricultural wastes and by‐products could be potential protein sources; however, their lignocellulosic structure could be challenging for protein extraction. In the current study, different extraction strategies including ultrasound (US) and enzyme pretreatments were performed for the extraction of proteins from pea pods which is an agro‐industrial by‐product. Results suggest that US pretreatment may have promising applications for the extraction of valuable compounds from agricultural and industrial by‐products, contributing to sustainable food processing strategies.

Effect of thermal and chemical treatments used for SARS-COV-2 inactivation in the measurement of saliva analytes.

The present study aims to assess the effects of thermal and chemical inactivating procedures, that can be used for SARS-CoV-2 inactivation, on different salivary analytes. SDS–Polyacrylamide Gel Electrophoresis (SDS-PAGE) protein profile and a panel of 25 specific biomarkers of oxidative status, stress, metabolism and tissue damage were evaluated in samples subjected to different treatments: thermal (65 °C or 92 °C) and chemical with detergents [sodium dodecyl sulphate (SDS), Triton X-100 or NP-40]. Salivary SDS-PAGE profile was most affected by heating at 92 °C, with three and two protein bands decreasing and increasing their expression levels, respectively. This treatment also affected the results of several enzymes, with some of them being also affected by heating at 65 °C and incubation with SDS. The use of Triton X-100 or NP-40 resulted in increased values of cortisol, triglycerides and glucose, not affecting the other tested biomarkers. The present results will help researchers and clinicians to select the best protocols to work in safe conditions with saliva, taking into account the target analyte planned to be measured.

Inhibition of endogenous protease activity and protection of histomorphical integrity during refrigerated storage of grass carp fillets by treatment with natural edible di‐ and tri‐carboxylic acids

SummaryIn this study, by dipping grass carp fillets with 10 mM di‐ and tri‐carboxylic acid solutions individually before storage at 4 °C for 10 days, the application potential of these acids in mitigating softening of fish was investigated through analysing shear force, pH, endogenous cathepsin activities, myofibrillar proteolysis and histomorphological characteristics. The results suggested that maleic acid, fumaric acid and tartaric acid were significantly effective against softening of grass carp muscle, as shown by shear force 26%–31% higher than that of control after storage. Acid treatments led to a decline in the pH of muscle. Besides, the inhibitory effect of these acids on cathepsins was demonstrated by activity reduction by 20%–90%. Further, sodium dodecyl sulphate–polyacrylamide gel electrophoresis and heat shock protein (HSP) analysis supported the protection of these acids against degradation and dissociation of myosin and actin through suppressing HSP loss. Moreover, histomorphological images with higher intensity of acridine orange fluorescence in muscle revealed the improvement of tissue integrity by acid treatments. The inhibitory potential of these acids in suppressing softening of fish muscle is particularly relevant to their capacity of mitigating cathepsin‐induced proteolysis and improving lysosome stability. Therefore, di‐ and tri‐carboxylic acids could play pleiotropic functions in the quality control of fish fillets.

Seed Proteomic Profiles of Three Paeonia Varieties and Evaluation of Peony Seed Protein as a Food Product.

Peony (Paeonia) has high ornamental, edible, and medicinal values. In order to distinguish seeds varieties, describe the proteomic profiles correlated with stress tolerance, and evaluate peony seed protein (PSP) as a functional food product, we characterized the seed protein profiles of these three species and their glucosidase inhibition activities. Results showed that the intensity of protein bands in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and specific protein ID (especially for specifically expressed proteins (SEPs)) was effective to distinguish these peony seed varieties. Proteomic analysis of the three species showed that P. ostii “Fengdan” has heat and pathogen tolerance-related proteins, while P. rockii has higher content of proteins related to cold resistance, which were all highly consistent with their adaptation of heat or cold habitat. Moreover, stress-related proteins were also accumulated in P. lactiflora Pall “Hangshao” seeds, showing its potential for stress resistance. Further protein analysis showed that the primary composition of PSP was albumin and globulin. And the solubility of PSP was good. Furthermore, PSP also showed high glucosidase inhibition activity, indicating that PSP might have some potential function for the remission of hyperglycemia. And P. ostii “Fengdan” seeds may be a better source for protein production than seeds of the other two species in terms of protein solubility and the content of total protein, albumin, and globulin. In addition, an optimal protocol of microwave-assisted alkali extraction was developed to produce PSP. In conclusion, the evaluated stress-related proteins in three peony seed species by proteomic analysis quite agreed with their adaptation of heat or cold stress; proteomics could also be a very useful tool for distinguishing species in the production; and peony seeds may be a good source for protein production.

Heat-Induced Interactions between Whey Protein and Inulin and Changes in Physicochemical and Antioxidative Properties of the Complexes.

Whey protein and inulin at various weight ratios were dry heated at 60 °C for 5 days under relative humidity of 63%. The heated mixtures were found to have significant changes in browning intensity and zeta-potential compared to untreated mixture. Heated samples showed significantly lower surface hydrophobicity than untreated mixtures. Compared with untreated samples, dry-heated samples showed significantly higher 2,2-Diphenyl-1-Picrylhydrazyl (DPPH) scavenging ability with whey protein to inulin mass ratios of 1:2 and 1:3 and significantly higher 2,2′-Azinobis(2-Ethylbenzothiazoline-6-Sulfonate) (ABTS) scavenging abilities and oxygen radical absorbance capacity (ORAC) at all weight ratios. Dry heat-induced interactions between whey protein and inulin was confirmed by changes in Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) protein profile, Fourier Transform Infrared Spectroscopy (FT-IR) and Far-ultraviolet Circular Dichroism (Far-UV CD) spectra. Dry heating caused physicochemical and structural changes of whey protein and therefore the complexes can be used to improve the antioxidative properties of the mixture under certain conditions.

Protein profile of FAdV-4 based on SDS-PAGE and Western blot isolated from chickens in India.

Fowl adenovirus-4 (FAdV-4) causes hydropericardium syndrome (HPS) in poultry worldwide. An understanding of viral structural protein composition is important for developing novel immunodiagnostics and immunoprophylactics. Here we report isolation, culture, molecular and protein profile of FAdV-4 isolates recovered from HPS outbreaks in chicken in the states of Himachal Pradesh and Tamil Nadu in India. We performed a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting-based protein profiling of FAdV-4 isolates against a reference FAdV-1 or Chicken Embryo Lethal Orphan (CELO) virus. SDS-PAGE analysis showed that seven protein bands in FAdV-4 isolates were similar to CELO expect an additional band of 110 kDa in CELO virus. On Western blotting, two protein fractions of 43 kDa and 78 kDa size were observed in FAdV-4 isolates. Overall, results show that FAdV-4 isolates recovered from different regions of the country had similar protein profile and possibly a common source of origin.

Studying Protein-Protein Interactions by Biotin AP-Tagged Pulldown and LTQ-Orbitrap Mass Spectrometry.

The study of protein-protein interactions represents a key aspect of biological research. Identifying unknown protein binding partners using mass spectrometry (MS)-based proteomics has evolved into an indispensable strategy in drug discovery. The classic approach of immunoprecipitation with specific antibodies against the proteins of interest has limitations, such as the need for immunoprecipitation-qualified antibody. The biotin AP-tag pull-down system has the advantage of high specificity, ease of use, and no requirement for antibody. It is based on the high specificity, high affinity interaction between biotin and streptavidin. After pulldown, in-gel tryptic digestion and tandem mass spectrometry (MS/MS) analysis of sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) protein bands can be performed. In this work, we provide protocols that can be used for the identification of proteins that interact with FOXM1, a protein that has recently emerged as a potential biomarker and drug target in oncotherapy, as an example. We focus on the pull-down procedure and assess the efficacy of the pulldown with known FOXM1 interactors such as β-catenin. We use a high performance LTQ Orbitrap MSn system that combines rapid LTQ ion trap data acquisition with high mass accuracy Orbitrap analysis to identify the interacting proteins.

Facile bio-inspired synthesis of zinc sulfide nanoparticles using Chlamydomonas reinhardtii cell free extract: optimization, characterization and optical properties

Abstract This study describes an eco-friendly, economical method to synthesize semiconductor zinc sulfide (ZnS) nanoparticles using the cell free extract of Chlamydomonas reinhardtii. Physicochemical parameters like pH, temperature and cell free extract concentration were optimized. Spherical particles measuring 8–12 nm were observed under high-resolution transmission electron microscopy (HRTEM). Elemental analysis proved that the nanoparticles were composed of zinc and sulfur, while powder X-ray diffraction (XRD) demonstrated the pure FCC crystal structure. Examination of the functional groups by Fourier transform infrared (FTIR) spectroscopy showed that algal proteins were involved in the synthesis of the nanoparticles. These nanoparticles demonstrated unique optical properties that were probed with UV-visible and photoluminescence (PL) spectroscopy. A peak at 310 nm was detected that was significantly blue-shifted from the bulk counterpart. Broad emission peaks at 410 nm and 430 nm were seen. The former was due to radiative recombination while the latter was attributed to defect states. In an effort to understand the molecular mechanism, the proteins bound to the nanoparticle surface were studied using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) and numerous proteins that are part of the cells’ oxidoreductive machinery were identified. These cellular proteins probably play a pivotal role in the synthesis and stabilization of ZnS nanoparticles.

Chemical composition of protein concentrate prepared from Yellowfin tuna Thunnus albacares roe by cook-dried process

Roe is the term used to describe fish eggs (oocytes) gathered in skeins and is one of the most valuable food products from fishery sources. Thus, means of processing are required to convert the underutilized yellowfin tuna roes (YTR) into more marketable and acceptable forms as protein concentrate. Roe protein concentrates (RPCs) were prepared by cooking condition (boil-dried concentrate, BDC and steam-dried concentrate, SDC, respectively) and un-cooking condition (freeze-dried concentrate, FDC) from yellowfin tuna roe. The yield of RPCs was in the range from 22.2 to 25.3 g/100 g of roe. RPCs contained protein (72.3–77.3 %), moisture (4.3–5.6 %), lipid (10.6–11.3 %) and ash (4.3–5.7 %) as the major constituents. The prominent amino acids of RPCs were aspartic acid, 8.7–9.2, glutamic acid, 13.1–13.2, and leucine, 8.5–8.6 g/100 g of protein. Major differences were not observed in each of the amino acid. K, S, Na, and P as minerals were the major elements in RPCs. No difference noted in sodium dodecyl sulfate polyacrylamide gel electrophoresis protein band (15–100 K) possibly representing partial hydrolysis of myosin. Therefore, RPCs from YTR could be use potential protein ingredient for human food and animal feeds.

Decellularised extracellular matrix as a platform for cancer modelling

Event Abstract Back to Event Decellularised extracellular matrix as a platform for cancer modelling Naledi Shologu1, 2, Abhay Pandit2 and Dimitrios Zeugolis1, 2 1 National University of Ireland Galway (NUIG), Regenerative, Modular & Developmental Engineering Laboratory (REMODEL), Ireland 2 National University of Ireland Galway (NUIG), Centre for Research in Medical Devices (CÚRAM), Ireland Introduction: Existing approaches aim to mimic the in vivo microenvironment by establishing the cell–cell and cell–matrix contact through various cell culture systems namely, hydrogels, fibres, sponges, microfluidics, nano-texturing, surface-coating etc[1]. Conversely, there is an inefficiency of the cells to form their own microenvironment in vitro as a result of unsubstantial amounts of deposited extracellular matrix (ECM) within a useful time frame. To solve these problems, a biophysical approach, termed macromolecular crowding (MMC), that increases thermodynamic activities and biological processes by several orders of magnitude, is proposed as means to create ECM-based scaffold as a bases for an in vitro cancer models. The principle of MMC is derived from the notion that in vivo cells reside in a highly crowded/dense extracellular space, whilst in vitro they are cultured under very dilute conditions that prohibit normal cell function. Recent work demonstrates that under MMC conditions, scaffold-free equivalents can be produced within 2-6 days in culture, whilst in the absence of MMC tissue constructs of similar thickness would have taken several months to culture[2]. Using this phenomenon, a cell-derived ECM can be fabricated in vitro within a timely manner. After the cell-derived ECM has been facilitated, cell-synthesized matrices can be utilised as a new cell-formed substrate after a decellularization treatment[3]. Materials and Methods: Human adipose-derived stem cells (hADSC) and human adult mammary fibroblasts (hMF) were cultured for 2, 7, 10, 14 and 21 days with various carrageenan (MMC) concentrations in normoxia (21%) at 37ºC and 5% CO2 in a humidified atmosphere and after the ECM were decellularized and recellularized with breast cancer cell lines. Total collagen and protein quantification deposition was assessed using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE), hydroxyproline assay and BCA protein assay. Cellular function was assessed namely: cell metabolic activity (alamarBlue® assay), cell viability (LIVE/DEAD® assay), and cell proliferation (PicoGreen® Assay). Gelatine Zymography was used to assess matrix metalloproteinase (MMPs). Conclusions: MMC can be used effectively to accelerate ECM deposition by hADSCs and hMFs, to facilitate production of matrix-rich 3D tumour models compared to 2D monolayer model, for the in vitro assessment of anti-cancer drug response. This dynamic approach paves the ways for the development of a biologically relevant scaffold-free assay system feasible as a robust preclinical anti-cancer drug screening platform. The authors would like to acknowledge the College of Engineering and Informatics, NUIG for financial support

Interaction of functionalized PEG-PLA/PLGA nanoparticles with serum proteins and impact on nanoparticle stability and cell toxicity

Event Abstract Back to Event Interaction of functionalized PEG-PLA/PLGA nanoparticles with serum proteins and impact on nanoparticle stability and cell toxicity Kathrin Abstiens1 and Achim M. Goepferich1* 1 University of Regensburg, Department of Pharmaceutical Technology, Germany Introduction: Formation of a nanoparticle (NP) protein corona upon administration into the bloodstream plays a pivotal role concerning safety and efficacy of nanoparticle formulations. As a result of the complex interplay between chemical and physical factors, it is particularly challenging to forecast the extent and composition of protein adsorption onto different nanomaterials. Therefore, the aim of this study was to characterize the interaction of serum proteins with poly(lactic-co-glycolic acid) blended poly(ethylene glycol)-polylactid acid (PEG-PLA/PLGA) NPs depending on particle charge and net charge density. Moreover, impact on NP stability and cell toxicity in vitro was assessed. For this purpose methoxy- (m), carboxy- (C) and amino-functionalized (N) PEG-PLA copolymers were used to prepare NPs with a negative (NP510C), positive (NP510N) or uncharged (NP510m) surface as well as dual charged particles (NP510CN). Materials and Methods: PEG-PLA copolymers were synthesized by ring-opening polymerization and NPs were prepared by nanoprecipitation as previously described [1]. Size and zeta potential was measured on a Zetasizer Nano ZS. Serum protein adsorption was evaluated by incubation of functionalized nanoparticles with fetal calf serum (FCS) at 37 °C. Composition of the hard protein corona was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and total protein amount was determined using Micro BCA Assay. The involvement of bovine serum albumin (BSA) in the soft and hard protein corona was assessed by DLS upon incubation with NP at 37 °C. NP stability was evaluated with a fluorescence resonance energy transfer (FRET) experiment as previously described [2]. Influence on cell toxicity was investigated by MTT assay. Results and Discussion: NP surface charge has been shown to influence protein corona formation [3]. As depicted in Fig. 1 A, positively charged NP adsorbed significantly more serum proteins than negatively charged. Furthermore, interaction with serum proteins was even more decreased when particle surface was dual charged (NP510CN) compared to uncharged nanoparticles (NP510m). A FRET experiment revealed that NP stability in serum is directly correlated with the extent of protein adsorption. This may be due to the fact that formation of a protein corona has a strong impact on NP integrity. As a consequence thereof an escape of the lipophilic cargo was facilitated which led to a decrease of the FRET ratio over time [Fig. 1 B]. As interactions with serum proteins are likely to influence cell-NP interactions, cytotoxicity of NPs was assessed by MTT assay. It could be observed that cytotoxicity of NPs was significantly decreased when cell media was supplemented with FCS which indicates that unspecific cellular uptake was interfered by formation of a protein corona. Figure 1: A) Quantification of the hard protein corona of different NP formulations determined by BCA assay B) FRET stability of NP formulations in PBS pH 7.4 and FCS as a function of time Conclusion: The electrostatic interaction of polymeric NP with serum proteins can be regulated by combining differently functionalized PEG-PLA copolymers. Such tailored NPs can be used to control the extent of protein adsorption onto NP surface and thus NP stability and toxicity in vitro.

A method for in-gel fluorescent visualization of proteins after native and sodium dodecyl sulfate polyacrylamide gel electrophoresis

We have developed a simple one-step 30-min method for fluorescent visualization of proteins in native and sodium dodecyl sulfate polyacrylamide gel electrophoresis (PAGE) gels. The method is based on formation of strong fluorophores via potassium ferricyanide-provoked oxidation of tryptophan (Trp). Following PAGE, gels are soaked in water solution of potassium ferricyanide (100mM) and NaOH (1M) and are kept in the dark for 30min. Gels are then transferred to water and scanned. The sensitivity of the method was slightly lower compared with standard Coomassie Brilliant Blue (CBB) staining. The method can be useful when rapid acquisition of data is of the essence. After preview, gels can be post-stained using the CBB protocol for further analysis. The intensity of fluorescence is dependent on Trp number, so the protocol might find application in the quantification of Trp residues as illustrated here. Importantly, there is room for improvement of the method. Namely, according to excitation–emission matrix analysis of stained protein bands, maximal fluorescence intensity (at 345/460nm) was 3.5-fold higher compared with the settings that were available on a commercial imager (395/525nm). As a supplement, we present an upgrade of the previously described method for in-gel detection of non-heme iron-binding proteins that also employs potassium ferricyanide.

Single-Cell Western Blotting.

Little headway has been made in single cell protein analysis, aside from tools that rely solely on antibody-probe based detection (i.e., flow cytometry, immunocytochemistry), which are limited by low specificity and multiplexing capabilities. To address these protein analysis gaps, we have introduced a single-cell western blot (scWestern). The protein assay is capable of highly specific analysis by coupling antibody-based detection with a polyacrylamide gel electrophoresis (PAGE) protein separation. Cells are settled via gravity into polyacrylamide (PA) microwells, chemically lysed in the wells, and then subjected to PAGE through the walls of the microwells and into the surrounding PA gel. Over a thousand single-cell separations are performed simultaneously, and multiple protein targets of interest are investigated. After PAGE separation, photo-immobilization of all proteins to the gel allows for antibody probing and lends to the archival quality of the scWestern assay where new proteins targets can be investigated months after the initial separations are performed.

Replication of Hepatitis C Virus Genotype 3a in Cultured Cells

Hepatitis C virus (HCV) genotype 3a is widespread worldwide, but no replication system exists for its study. We describe a subgenomic replicon system for HCV genotype 3a. We determined the consensus sequence of an HCV genome isolated from a patient, and constructed a subgenomic replicon using this clone. The replicon was transfected into HuH-7 cells and RNA replication was confirmed. We identified cell culture-adaptive mutations that increased colony formation multiple-fold. We have therefore established a genotype 3a replicon system that can be used to study this HCV genotype.

English

Xanthomonas citri subsp. malvacearum (Xcm), the bacterial blight of cotton is the most important bacterial disease on cotton which infects all aerial parts of the host. Loss due to this disease was estimated for about 10 to 30% on Iranian native cultivars. During summer season, cotton leaves samples with typical bacterial blight symptoms were collected from cotton fields of Golestan province in 2004. Among different bacterial isolates, five distinct Xcm isolates were collected for further studies. Besides, 20 partially characterized Xcm strains were obtained from Iranian Plant Protection Organization for comparison purpose. Totally 25 strains were subcultured for further characterization based on morphological, biochemical, pathogenicity traits as well as genetic analyses. Among these, nine strains with distinct phenotypic characteristics were selected for complementary genetic studies. Sodium dodecyl sulphate - polyacrylamide gel electrophoresis (SDS-PAGE) protein analysis did not show any differences among strains in number and size of protein bands. In plasmid analysis, using alkaline lysis method, a single plasmid was detected for all examined isolates with molecular weight of 23 kb. Repetitive sequence based PCR (rep-PCR) fingerprinting assay using primer BOX AIR (5' CTACGGCAAGGCGACGCTGAC 3') also failed to differentiate the Iranian isolates. It was therefore concluded the strains might have the same origin. Key words: Cotton bacterial blight, protein analysis, plasmid and repetitive sequence based PCR (rep-PCR).

69 DIFFERENTIAL AND QUANTITATIVE ANALYSIS OF DOG OVIDUCTAL FLUID

The major reproductive peculiarity of the bitch is that ovulation releases prophase I (germinal vesicle, GV, immature) oocytes. Resumption of meiotic maturation, as well as fertilisation and embryonic development to the morula stage occur in the oviduct. Because the dog is a biomedical model for human diseases and also a model for endangered canid species, the development of assisted reproduction techniques would be of great interest. To date, in vitro-produced canine embryos remain exceptional and no puppy has been born. The main limiting factors of in vitro embryo production are the low oocyte maturation rates, the poor oocyte quality and the high polyspermy. A better knowledge of the composition of oviductal fluid during the periovulatory period may help to mimic the in vivo conditions for in vitro oocyte culture and, thereafter, their fertilisation and embryonic development. The objective of this study was to analyse the oviductal fluid by a label-free quantitative proteomic workflow based on sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) protein separation, nano-scale liquid chromatography-tandem mass spectrometry (nano-LC-MS/MS) analysis and quantitative method using spectral counting. Ovarian cycles were followed by vaginal smears, ultrasonography and progesterone blood assays. Oviductal fluids were collected from 3 beagle bitches, after ovariectomies performed 3.5 days after ovulation. After dissection, the ampulla and isthmus were separated and flushed with 50 μL of PBS. Oviductal fluids were submitted to 1D SDS-PAGE and all bands were digested with trypsin. Peptide extracts were analysed on an Ettan multidimensional LC (MDLC) system coupled to a linear ion trap quadrupole (LTQ) mass spectrometer. After protein identification using Mascot server and with Swiss-Prot and National Center for Biotechnology Information (NCBI) databases, bioinformatic processing of data and statistic analysis (t-test with P < 0.05) were performed using the spectral counting quantitative module of the Scaffold software. Using this strategy, 427 proteins were qualitatively identified in canine oviductal fluid. Three proteins were specific of the ampulla, 10 specific of the isthmus and 414 were found in both oviductal parts. Among these common proteins, some were differentially expressed, from 1.25 to 9 times higher (HV303_Human, RLA2_Horse, SPRL1_Human, SODC_CANFA, PROF1_Human, ARF4_Bovin and TRXR1_Bovin). The gene ontology analysis displayed biological pathways specific to the biology of reproduction (6 proteins; RUVB1_Human, OVGP1_Pig, STAT3_Human, PLAK_Human, GPX3_Rat and DYL1_Human). These candidate proteins and especially oviduct-specific glycoprotein and glutathione peroxidase, will now be validated by immunodetection methods.

Systematic Studies on TiO2-Based Phosphopeptide Enrichment Procedures upon in-Solution and in-Gel Digestions of Proteins. Are There Readily Applicable Protocols Suitable for Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry-Based Phosphopeptide Stability Estimations?

There have been many successful efforts to enrich phosphopeptides in complex protein mixtures by the use of immobilized metal affinity chromatography (IMAC) and/or metal oxide affinity chromatography (MOAC) with which mass spectrometric analysis of phosphopeptides has become state of the art in specialized laboratories, mostly applying nanoLC electrospray ionization mass spectrometry-based investigations. However, widespread use of these powerful techniques is still not achieved. In this study, we present a ready-to-use phosphopeptide enrichment procedure using commercially available TiO(2)-loaded pipette tips in combination with matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) analyses. Using α-casein as a model protein and citric acid as additive during sample loading, a similar enrichment success can be achieved as compared to applying 2,5- dihydroxy benzoic acid (DHB) for this task. But the DHB-inherited drawbacks are eliminated. In addition, we show that combining DHB and 2,4,6-trihydroxy acetophenone (THAP) as matrix for MALDI-MS measurements retains the sensitivity of DHB for phosphopeptide analysis but adds the homogenous crystallization properties of THAP, enabling preparation of evenly distributed matrix surfaces on MALDI-MS anchor targets, a prerequisite for automated MALDI- MS analyses. Tripartite motif-containing protein 28 and stathmin are two examples for which successful phosphopeptide enrichment of either sodium dodecyl sulfate polyacrylamide gel electrophoresis or two-dimensional gel electrophoresis-separated proteins is shown. Finally, high resolution MALDI Fourier transform ion cyclotron resonance mass spectrometry after phosphopeptide enrichment suggests that chemical dephosphorylation may occur as a side reaction during basic elution of phosphopeptides bound to MOAC surfaces, suggesting that proteome-wide phosphopeptide analyses ought to be interpreted with caution. In contrast, in-depth analysis of phosphopeptide/non-phosphorylated peptide siblings may be used to estimate stability differences of phosphorylation sites in individual proteins, possibly adding valuable information on biological regulation processes.

Influence of pH Shift on Functional Properties of Protein Isolated of Tilapia (Oreochromis niloticus) Muscles and of Soy Protein Isolate

The physicofunctional and chemical properties of acid-aided protein isolate (AcPi), alkaline-aided protein isolate (AlPi) and soy protein isolate (SPI) prepared from tilapia muscle and defatted soy flour as a function of pH and/or NaCl concentration were investigated. Both acid- and alkali-aided processes lead to significant recoveries (P < 0.05) of proteins with substantial reduction of lipids in AlPi (0.81%) and AcPi (0.96%), the lowest for SPI (0.336%) facilitated by the processing method and sample used. There is greater lipid reduction at alkali pH, effective removal of impurities such as bones and scales, indicated by percentage ash (AcPi, 4.53%; AlPi, 3.75% and SPI, 3.51%). No major difference noted in sodium dodecyl sulphate polyacrylamide gel electrophoresis protein bands (14.4–97.4 kDa) possibly representing partial hydrolysis of myosin. Solubility was the highest at pH 3.0 and 11.0 and the lowest at isoelectric point with foam capacity showing similarity at varying pH. The addition of NaCl improved foam stability, possibly due to the increased solubility and surface activity of the soluble protein. On the whole, AcPi, AlPi and SPI manifested lower solubility and foamability at pH 4.0 and 5.0. AlPi exhibited appreciable levels of solubility, emulsion capacity, oil-holding capacity, viscosity and whiteness, whereas SPI had appreciable water-holding capacity. AcPi, AlPi and SPI have excellent relevance for product development based on their functionality.