Protection Of Hydroxyl Groups Research Articles

Application of Ball Milling Technology to Carbohydrate Reactions: I. Regioselective Primary Hydroxyl Protection of Hexosides and Nucleoside by Planetary Ball Milling‡

Dry ball milling of hexosides with trityl chloride in the presence of DABCO or Na2CO3 has been found to result in their complete conversion to the respective 6‐O‐trityl ethers. Further wet grinding of the reaction mixture with Ac2O in the presence of DMAP led to the respective fully protected hexosides in good to excellent yields after isolation. It has been found to be an effective one‐pot two‐step synthesis under solvent‐free condition. The speed of homogenization has been shown to highly influence the rate and outcome of the reaction, and commercially available planetary ball mill has been proved to be very convenient for carrying out the reaction under standardized and reproducible conditions.

First total synthesis of (±)-abyssinoflavanone V

The total synthesis of (±)-abyssinoflavanone V was first achieved through C-prenylation, selective protection of phenolic hydroxyl group, aldol condensation, cyclization and deprotection starting from cheap 4-hydroxybenzaldehyde and 2,4,6-trihydroxyacetophenone, with total yield 24%. All structures of new compounds were confirmed by IR, 1H NMR and MS.

Synthesis and characterization of α‐butyl‐ω‐N,N‐dihydroxyethylaminopropylpolydimethylsiloxane

Abstractα‐Butyl‐ω‐N,N‐dihydroxyethylaminopropylpolydimethylsiloxane, a monotelechelic polydimethylsiloxane with a diol‐end group, which is used to prepare polyurethane–polysiloxane graft polymer, was successfully synthesized. The preparation included five steps, which are hydroxyl protection, alkylation, anionic ring‐opening polymerization, hydrosilylation, and deprotection. The products were characterized by FTIR, GC, LC‐MS, 1H NMR, and elemental analysis. The results showed that each step was successfully carried out and the targeted products were synthesized in all cases. © 2008 Wiley Periodicals, Inc. J Appl Polym Sci, 2008

Total Synthesis of ent-Lepadin F and G by a Tandem Ene−Yne−Ene Ring Closing Metathesis

The first total synthesis of the decahydroquinoline-alkaloids lepadin F and G is described. As key steps, the decahydroquinoline skeleton has been synthesized by utilizing a tandem ene-yne-ene ring closing metathesis of an acyclic precursor followed by a stereoselective hydrogenation of the resulting diene moiety. The selectivity of these two steps was achieved by a well-directed hydroxyl protection strategy. The synthesized compounds were found to be enantiomers of natural lepadin F and G, consequently the absolute configuration of the natural compounds could be assigned.

The 4-(N-Dichloroacetyl-N-methylamino)benzyloxymethyl Group for 2‘-Hydroxyl Protection of Ribonucleosides in the Solid-Phase Synthesis of Oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

Solid-phase synthesis of oligomers carrying several chromophore units linked by phosphodiester backbones

A method for the preparation of oligomers by linking chromophore units is described. Specifically, the synthesis of chromophore units having a protected-hydroxyl group and a phosphoramidite function is described, along with a method to link several units using solid-phase phosphite-triester protocols.

Synthesis of Porphyrin‐Anthraquinone Conjugates as Photosensitizing Agents

A series of 5,10,15,20‐tetraarylporphyrins covalently linked to anthraquinones belonging to the class of emodin were synthesized following two different pathways. The first method exploits the functionalization of the methyl group in position 6 of O‐protected emodins, which can be converted either into a carboxylic acid or into a bromo‐methyl derivative. The modified emodins were then bound through amido or ether bonds to one of the tetraarylporphyrins meso phenyl rings bearing an amino or hydroxyl group, respectively. An alternative synthesis exploits the mixed condensation of triacetoxy‐emodinaldehyde (or trimethoxy‐emodinaldehyde) with pyrrole in the presence of variable amounts of benzaldehyde, thus affording two similar 5‐emodin‐10,15,20‐triphenylporphyrins differing from one another in the emodin hydroxyl group protection. These compounds are characterized by direct conjugation of the emodin moiety to the tetrapyrrolic ring. Preliminary experiments were performed in vitro on the human colon adenocarcinoma cell line HCT116 to evaluate the photocytotoxicity of the new compounds.

Synthesis of ABCD 4‐Miktoarm star‐shaped quarterpolymers by combination of the “click” chemistry with multiple polymerization mechanism

AbstractWell‐defined ABCD 4‐Miktoarm star‐shaped quarterpolymers of [poly(styrene)‐poly(tert‐butyl acrylate)‐poly(ethylene oxide)‐poly(isoprene)] [star(PS‐PtBA‐PEO‐PI)] were successfully synthesized by the combination of the “click” chemistry and multiple polymerization mechanism. First, the poly(styryl)lithium (PS−Li+) and the poly(isoprene)lithium (PI−Li+) were capped by ethoxyethyl glycidyl ether (EEGE) to form the PS and PI with both an active ω‐hydroxyl group and an ω′‐ethoxyethyl‐protected hydroxyl group, respectively. After these two hydroxyl groups were selectively modified to propargyl and 2‐bromoisobutyryl group for PS, the resulted PS was used as macroinitiator for ATRP of tBA monomer and the diblock copolymer PS‐b‐PtBA with a propargyl group at the junction point was achieved. Then, using the functionalized PI as macroinitiator for ROP of EO monomer and bromoethane as blocking agent, the diblock copolymer PI‐b‐PEO with a protected hydroxyl group at the conjunction point was synthesized. After the hydrolysis, the recovered hydroxyl group of PI‐b‐PEO was modified to bromoacetyl and then azide group successively. Finally, the “click” chemistry between them was proceeded smoothly. The obtained star‐shaped quarterpolymers and intermediates were characterized by 1H NMR, FT‐IR, and SEC in detail. © 2008 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 46: 2154–2166, 2008

Biodegradable Amphiphilic Block Copolymers Bearing Protected Hydroxyl Groups: Synthesis and Characterization

A new biodegradable amphiphilic block copolymer, poly(ethylene glycol)-b-poly(L-lactide-co-9-phenyl-2,4,8,10-tetraoxaspiro[5,5]undecan-3-one) [PEG-b-P(LA-co-PTO)], was successfully prepared by ring-opening polymerization (ROP) of L-lactide (LA) and functionalized carbonate monomer 9-phenyl-2,4,8,10-tetraozaspiro[5,5]undecan-3-one (PTO) in the presence of monohydroxyl poly(ethylene glycol) as macroinitiator using Sn(Oct)2 as catalyst. NMR, FT-IR, and GPC studies confirmed the copolymer structure. It could self-assemble into micelles in aqueous solution with critical micelle concentration (CMC) in the magnitude of mg/L, which changed with the composition of the copolymer. After catalytic hydrogenation, copolymers with active hydroxyl groups were obtained. Adhesion and proliferation of Vero cells on the copolymer films showed that the synthesized copolymers were good biocompatible materials. In vitro degradation of the copolymer before and after deprotection was investigated in the presence of proteinase K. The free hydroxyl groups on the copolymers were capable of further modification with biotin. This new amphiphilic block copolymer has great potential for both drug encapsulation and conjugate because of its low CMC and the presence of active hydroxyl groups.

Double-Hydrophilic Linear-Hyperbranched Block Copolymers Based on Poly(ethylene oxide) and Poly(glycerol)

A convenient 4-step (2-pot) approach for the synthesis of biocompatible, double hydrophilic linear-hyperbranched block copolymers based on poly(ethylene oxide) (PEO) and poly(glycerol) (PG) is described. The polymers consisting exclusively of an aliphatic polyether structure were prepared from linear PEO-b-(l-PG) precursor block copolymers, obtained via anionic polymerization of ethylene oxide and subsequently ethoxyethyl glycidyl ether (EEGE). In order to generate initiating functionalities for glycidol, the protected hydroxyl groups of the P(EEGE) block were recovered by hydrolysis with hydrochloric acid. Partial deprotonation of the linear poly(glycerol) block with cesium hydroxide permitted hypergrafting of glycidol onto the alkoxide initiating sites, using the slow monomer addition technique. Detailed studies showed that narrow polydispersity was only obtained with Cs counterions, while use of potassium resulted in larger polydispersities. The resulting linear-hyperbranched PEO-b-(hb-PG) block copolymers exhibited low polydispersities Mw/Mn in the range of 1.09−1.25, depending on the molecular weight of the hyperbranched block. Molecular weights of the block copolymers ranged from 3 700 to 15 700 g/mol, varying both the length of the linear PEO segments as well as the hyperbranched block.

Polyisobutylene-based miktoarm star polymers via a combination of carbocationic and atom transfer radical polymerizations

Poly(isobutylene-b-styrene) (PIB–PS) copolymers and polyisobutylene (PIB) homopolymers were synthesized via quasiliving carbocationic polymerization from the initiator 3,3,5-trimethyl-5-chlorohexyl acetate, which contains a protected hydroxyl group. The PIB block was created at −70°C in a methylcyclohexane/methyl chloride (60:40) cosolvent system, using TiCl4 as co-initiator, followed optionally by sequential addition of styrene. Using a strong base, the acetate head group of the resulting block copolymer was cleaved to yield a hydroxyl group, which was subsequently esterified with the branching agent 2,2-bis((2-bromo-2-methyl)propionatomethyl)propionyl chloride (BPPC) to create dual initiating sites for atom transfer radical polymerization (ATRP). ATRP of tert-butyl acrylate was carried out using a Cu(I)Br/1,1,4,7,7-pentamethyldiethylenetriamine (PMDETA) catalyst system. In some cases, the ester side chains of the poly(tert-butyl acrylate) (PtBA) blocks were cleaved to create poly(acrylic acid) (PAA) blocks. The final miktoarm star polymers had compositions that were very close to theoretical.

Regioselective one-pot protection of glucose

Detailed protocols for the regioselective protection of individual hydroxyls in monosaccharide units are described here. This expedient methodology incorporates up to seven reaction sequences, obviating the necessity to carry out intermittent tedious work-ups and time-consuming purifications. Using this TMSOTf-catalyzed one-pot protocol, the 2,3,4,6-tetra-O-trimethylsilylated hexopyranosides bearing an anomeric group could be transformed into a whole set of differentially protected 2-alcohols, 3-alcohols, 4-alcohols, 6-alcohols and fully protected monosaccharides in high yields. These tailor-made glycosyl donors and acceptors can then be used for stereoselective one-pot glycosylation for oligosaccharide synthesis. The total time for the preparation of a purified protected sugar unit ranges between 1 and 2 d. This process would otherwise take 1-2 weeks.

Synthesis and characterization of α- N, N-dihydroxyethylaminopropyl-ω-butylpolydimethylsiloxanes

A series of α- N, N-dihydroxyethylaminopropyl-ω-butylpolydimethylsiloxanes with different molecular weight were synthesized. The preparation included five steps which were hydroxyl protection, alkylation, anionic ring-opening polymerization, hydrosilylation and deprotection. The structure of reaction products was characterized by FT-IR, GC, 1H NMR.

Self-Assembly of Amphiphilic Polymeric Dendrimers Synthesized with Selective Degradable Linkages

Enhancing the structural complexity and functionality of building blocks allows the design and synthesis of complex macromolecular architectures. In this work, we use a combination of atom transfer radical polymerization to produce polymers with well-defined chain length and telechelic end group functionality and “click” reactions to quantitatively couple these polymer chains together to form functional second- and third-generation dendrimers. Importantly, this methodology provides starting polymers in combination with linkers and end group protecting chemistries to design dendrimers with degradable linkages between the desired generations and incorporates functionality at the polymer chain ends of each generation. We have synthesized second- and third-generation homo- and amphiphilic diblock copolymer dendrimers and specifically designed third-generation dendrimers in pure form such that the peripheral generational layer could be selectively cleaved off from the second-generation. The degradation of the peripheral polymer layer is a useful feature in biomedical delivery devices for slow and controlled release of its payload. These dendrimers also have either “free” or protected hydroxyl groups on the peripheral ends, which are useful for further chemical modification or chemical coupling to important biomolecules. The amphiphilic dendrimers self-assemble in water to form well-defined micelles of near identical size (18.2 nm, PDI = 1.04), each consisting of approximately 19 individual dendrimers. The dense core of the spherical micelles found from sizing measurements supports the postulate that these amphiphilic dendrimers have no mutual interpenetration and thus pack uniformly to form the micelles.

Anionic lipids activate group IVA cytosolic phospholipase A2 via distinct and separate mechanisms

Previously, ceramide-1-phosphate (C1P) and phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] were demonstrated to be potent and specific activators of group IVA cytosolic phospholipase A2 (cPLA2alpha). In this study, we hypothesized that these anionic lipids functionally activated the enzyme by distinctly different mechanisms. Indeed, surface plasmon resonance and surface dilution kinetics demonstrated that C1P was a more potent effector than PI(4,5)P2 in decreasing the dissociation constant of the cPLA2alpha-phosphatidylcholine (PC) interaction and increasing the residence time of the enzyme on the vesicles/micelles. PI(4,5)P2, in contrast to C1P, decreased the Michaelis-Menten constant, increasing the catalytic efficiency of the enzyme. Furthermore, PI(4,5)P2 activated cPLA2alpha with a stoichiometry of 1:1 versus C1P at 2.4:1. Lastly, PI(4,5)P2, but not C1P, increased the penetration ability of cPLA2alpha into PC-rich membranes. Therefore, this study demonstrates two distinct mechanisms for the activation of cPLA2alpha by anionic lipids. First, C1P activates cPLA2alpha by increasing the residence time of the enzyme on membranes. Second, PI(4,5)P2 activates the enzyme by increasing catalytic efficiency through increased membrane penetration.

2-Deoxyribose as a Rich Source of Chiral 5-Carbon Building Blocks

We have developed concise routes to a number of useful chiral 5-carbon synthetic building blocks using readily available O-1-methyl-2-deoxyribose as starting material. Novel transformations include the use of indium triflate to catalyze the oxidation of a methyl furanoside to the corresponding lactone with MCPBA and the Vasella-type fragmentation of a 5-iodo furanoside using chromium(II) chloride when zinc proved ineffective. In addition, 3,4-disubstituted piperidine derivatives were prepared without hydroxyl group protection via a simple reductive amination reaction.

Synthesis of Deoxy Sugar Esters: A Chemoenzymatic Stereoselective Approach Affording Deoxy Sugar Derivatives Also in the Form of Aldehyde

A chemoenzymatic synthesis of deoxy sugar esters is described. The synthesis is based on the O-alkylation of carboxylic acid with 2-bromo-5-acetoxypentanal. The method allows treatment of hydroxy carboxylic acids without protection of alcoholic hydroxyl groups. Several stereoisomeric deoxy sugar esters were resolved (up to ee or de > 98%) using a lipase-catalyzed acetylation of hemiacetals that in certain cases afforded deoxy sugar derivatives in the form of aldehydes. The stereochemistry of the reactions was determined by the NMR spectra of mandelic acid derivatives.

Effects of oxygen–sulfur substitution on glycosaminoglycan-priming naphthoxylosides

Three series of sulfur-containing analogs to the selectively antiproliferative 2-(6-hydroxynaphthyl) β- d-xylopyranoside were synthesized and their biological properties investigated. A short, general route to hydroxynaphthyl disulfides from dihydroxynaphthalenes was developed to utilize the disulfide bond as a sulfur-selective protecting group to enable the orthogonal protection of hydroxyls and thiols. The results indicate that hydrophobic, uncharged oxygen–sulfur substituted naphthoxylosides are taken up by cells and initiate priming of GAG chains to a greater extent compared to the oxygen analogs. No correlation between priming ability and antiproliferative activity was observed.

Antioxidant Activities of Hops (Humulus Lupulus) and Their Products

This study aims to evaluate the total antioxidant activity and hydroxyl free radical scavenging activities of hops and their products. Dried hop cones of five varieties (SA-1, Chinook, Nugget, Marco Polo, and Tsingdao) were used in the study. The hop extracts were prepared with hot water, ethanol, and CO2 as a solvent. The antioxidant activities of hop bitter acids, isomerized hop bitter acids, hop oil, and hexahydro-β-acids also were evaluated, and di-tert-butylated hydroxytoluene and rutin were used for comparison. Antioxidant activities of samples were evaluated using two complementary in vitro assays: inhibition of hydroxyl radicals and protection of a β-carotene–linoleic acid model system. All hop samples showed varying degrees of antioxidant capacity and hydroxyl radical scavenging at the tested level; hop α-acids exhibited significant hydroxyl radical scavenging, as well as antioxidant activity, in vitro. In ethanol and CO2 extracts, Marco Polo showed the highest antioxidant capacity and hydroxyl radical scavenging activity.

Silica supported perchloric acid (HClO 4–SiO 2): A highly efficient and reusable catalyst for the protection of hydroxyl groups using HMDS under mild and ambient conditions

Various alcohols, phenols, naphthols, and oximes were effectively converted into their corresponding trimethylsilyl ethers with hexamethyldisilazane in the presence of solid silica supported perchloric acid under very mild conditions at room temperature with short reaction time in good to excellent yields. The notable advantages of this protocol are: work up procedure is easy and the catalyst can be recovered by simple filtration and reused.