Saposin Research Articles

Pan-cancer analysis of PSAP identifies its expression and clinical relevance in gastric cancer

Prosaposin (PSAP) plays a critical role in sphingolipid and cancer metabolism. Reports have shown that PSAP was involved in proliferation, tumorigenesis, and metastasis. However, the expression pattern of PSAP and its prognostic roles in gastric cancer remain elusive. PSAP expression pattern and its prognostic roles in gastric cancer (GC) were explored using data from the TCGA and Kaplan-Meier Plotter. Immunohistochemical staining of GC tissues was performed to validate the prognostic role of PSAP. TISIDB was used to analyze its correlation with immunomodulators. PSAP-associated genes, PDCD1, TGFB1, and CSF1R were used to build a risk model to evaluate immunotherapy outcomes of patients with stomach adenocarcinoma (STAD). Results showed that PSAP was highly expressed in GC. High PSAP expression in GC patients also significantly indicated a poor prognosis. The results of immunohistochemical staining showed that PSAP was an independent prognostic factor in GC patients. Based on three PSAP-associated genes, a risk model that could predict the prognosis and immunotherapy outcome of STAD was bulit. PSAP was an independent prognostic factor in GC. Our results have identified three prognosis-related genes which were useful to evaluate immunotherapy outcomes of STAD patients.

Prosaposin, tumor‐secreted protein, promotes pancreatic cancer progression by decreasing tumor‐infiltrating lymphocytes

Glycoproteins produced by tumor cells are involved in cancer progression, metastasis, and the immune response, and serve as possible therapeutic targets. Considering the dismal outcomes of pancreatic ductal adenocarcinoma (PDAC) due to its unique tumor microenvironment, which is characterized by low antitumor T‐cell infiltration, we hypothesized that tumor‐derived glycoproteins may serve as regulating the tumor microenvironment. We used glycoproteomics with tandem mass tag labeling to investigate the culture media of three human PDAC cell lines, and attempted to identify the key secreted proteins from PDAC cells. Among the identified glycoproteins, prosaposin (PSAP) was investigated for its functional contribution to PDAC progression. PSAP is highly expressed in various PDAC cell lines; however, knockdown of intrinsic PSAP expression did not affect the proliferation and migration capacities. Based on the immunohistochemistry of resected human PDAC tissues, high PSAP expression was associated with poor prognosis in patients with PDAC. Notably, tumors with high PSAP expression showed significantly lower CD8+ T‐cell infiltration than those with low PSAP expression. Furthermore, PSAP stimulation decreased the proportion of CD8+ T cells in peripheral blood monocytes. Finally, in an orthotopic transplantation model, the number of CD8+ T cells in the PSAP shRNA groups was significantly increased, resulting in a decreased tumor volume compared with that in the control shRNA group. PSAP suppresses CD8+ T‐cell infiltration, leading to the promotion of PDAC progression. However, further studies are warranted to determine whether this study contributes to the development of a novel immunomodulating therapy for PDAC.

Progranulin improves neural development via the PI3K/Akt/GSK-3\u03b2 pathway in the cerebellum of a VPA-induced rat model of ASD

Autism spectrum disorder (ASD) is a neurodevelopmental disease featuring social interaction deficits and repetitive/stereotyped behaviours; the prevalence of this disorder has continuously increased. Progranulin (PGRN) is a neurotrophic factor that promotes neuronal survival and differentiation. However, there have not been sufficient studies investigating its effect in animal models of autism. This study investigated the effects of PGRN on autistic phenotypes in rats treated with valproic acid (VPA) and assessed the underlying molecular mechanisms. PGRN was significantly downregulated in the cerebellum at postnatal day 14 (PND14) and PND35 in VPA-exposed rats, which simultaneously showed defective social preference, increased repetitive behaviours, and uncoordinated movements. When human recombinant PGRN (r-PGRN) was injected into the cerebellum of newborn ASD model rats (PND10 and PND17), some of the behavioural defects were alleviated. r-PGRN supplementation also reduced cerebellar neuronal apoptosis and rescued synapse formation in ASD rats. Mechanistically, we confirmed that PGRN protects neurodevelopment via the PI3K/Akt/GSK-3β pathway in the cerebellum of a rat ASD model. Moreover, we found that prosaposin (PSAP) promoted the internalisation and neurotrophic activity of PGRN. These results experimentally demonstrate the therapeutic effects of PGRN on a rat model of ASD for the first time and provide a novel therapeutic strategy for autism.

AZP2006/EZEPROGIND neuroprotective effect in age-related cognitive decline and Alzheimer's disease progression.

AZP2006/EZEPROGIND is a disease-modifying small molecule that is currently in clinical development for the treatment of Progressive Supranuclear Palsy (PSP). Here we investigated its neuroprotective effect on in vitro and in vivo models of Alzheimer's disease (AD). We showed that AZP2006/EZEPROGIND neuroprotective action is mediated by Progranulin (PGRN) and correlated with a reduction of neuroinflammation. Primary rat cortical neurons cultured with microglia were injured with Aβ1-42 oligomers. We investigated the effect of AZP2006/EZEPROGIND on neuronal survival and neurite network (MAP2), synapses (PSD95/SYN), pTau (AT100), microglia activation (OX-41), neuroinflammation (IL-1β and IL-6) and PGRN levels. The PGRN mediated effect of AZP2006/EZEPROGIND was assessed by blocking Ab anti PGRN and siRNA for PGRN and/or Prosaposin (PSAP). AZP2006/EZEPROGIND (3 mg/kg/day) was also orally administered to the Senescence Accelerated Mouse-Prone 8 (SAMP8) mice, a spontaneous animal model of accelerated aging, from the age of 2, 4 or 6 months to 10 months. Learning and memory deficits were evaluated by Y-Maze Test and by Passive Avoidance Test. PGRN levels and of biochemical markers of oxidative stress (LPO), pTau (T181), Aβ1-42 , proinflammatory cytokines (IL-1β and IL-6), neuronal (NeuN) and microglial (Iba1) markers were studied by ELISA and IHC. In vitro, nM concentrations of AZP2006/EZEPROGIND significantly increased the neuron survival, the neurite network and the number of synapses. The incubation with blocking Ab anti PGRN and siRNA for PGRN and/or PSAP abolished these effects. Also, AZP2006/EZEPROGIND significantly decreased Tau hyperphosphorylation and reduced the neuroinflammation. The chronic treatment with AZP2006/EZEPROGIND significantly increased the Spontaneous Alternation in the Y-Maze Test and the Step-through Latency in the Passive Avoidance Test. We showed that AZP2006/EZEPROGIND was able to protect neurons, enhance synaptic function, decrease the hyperphosphorylation of Tau and reduce the neuroinflammation via PGRN. The chronic oral treatment was able to prevent, protect and restore the aged-related cognitive decline in the SAMP8 mice. We postulate that neuroprotective properties of AZP2006/EZEPROGIND not only could delay the progression of AD but also has the potential to reverse aged-related cognitive damages.

Striking While the Iron is Hot: The Role of Prosaposin (PSAP) in Parkinson's Disease.

Striking While the Iron is Hot: The Role of Prosaposin (PSAP) in Parkinson's Disease.

The expression of prosaposin and its receptors, GRP37 and GPR37L1, are increased in the developing dorsal root ganglion.

Prosaposin (PSAP), a highly conserved glycoprotein, is a precursor of saposins A–D. Accumulating evidence suggests that PSAP is a neurotrophic factor, as well as a regulator of lysosomal enzymes. Recently, the orphan G-protein-coupled receptors GPR37 and GPR37L1 were recognized as PSAP receptors, but their functions have not yet been clarified. In this study, we examined the distribution of PSAP and its receptors in the dorsal root ganglion (DRG) during development using specific antibodies, and showed that PSAP accumulates primarily in lysosomes and is dispersed throughout the cytoplasm of satellite cells. Later, PSAP colocalized with two receptors in satellite cells, and formed a characteristic ring shape approximately 8 weeks after birth, during a period of rapid DRG development. This ring shape, which was only observed around larger neurons, is evidence that several satellite cells are synchronously activated. We found that sortilin, a transporter of a wide variety of intracellular proteins containing PSAP, is strongly localized to the inner side of satellite cells, which contact the neuronal surface. These findings suggest that PSAP and GPR37/GPR37L1 play a role in activating both satellite and nerve cells.

Loss of Lysosomal Proteins Progranulin and Prosaposin Associated with Increased Neurofibrillary Tangle Development in Alzheimer Disease.

Alzheimer disease (AD) is a progressive neurodegenerative disease causing cognitive decline in the aging population. To develop disease-modifying treatments, understanding the mechanisms behind the pathology is important, which should include observations using human brain samples. We reported previously on the association of lysosomal proteins progranulin (PGRN) and prosaposin (PSAP) with amyloid plaques in non-demented aged control and AD brains. In this study, we investigated the possible involvement of PGRN and PSAP in tangle formation using human brain tissue sections of non-demented aged control subjects and AD cases and compared with cases of frontotemporal dementia with granulin (GRN) mutations. The study revealed that decreased amounts of PGRN and PSAP proteins were detected even in immature neurofibrillary tangles, while colocalization was still evident in adjacent neurons in all cases. Results suggest that neuronal loss of PGRN preceded loss of PSAP as tangles developed and matured. The GRN mutation cases exhibited almost complete absence of PGRN in most neurons, while PSAP signal was preserved. Although based on correlative data, we suggest that reduced levels of PGRN and PSAP and their interaction in neurons might predispose to accumulation of p-Tau protein.

Accumulation of saposin in dystrophic neurites is linked to impaired lysosomal functions in Alzheimer\u2019s disease brains

Neuritic plaques in Alzheimer’s disease (AD) brains refer to β-amyloid (Aβ) plaques surrounded by dystrophic neurites (DNs), activated microglia and reactive astrocytes. Most recently, we showed that DNs form sequentially in three layers during plaque growth. Although lysosomal proteins such as LAMP1 are found in DNs, it is not clear how many and how early lysosomal proteins are involved in forming neuritic plaques. To answer this unmet question, we examined APP knock-in (APPNL-G-F), 5xFAD and APP/PS1ΔE9 mouse brains and found that the lysosomal activator proteins saposins (SAPs) and LAMP1 were accumulated to surround Aβ plaques at the earliest stage, namely the 1st layer of DNs. Noticeably, lysosomal hydrolases were not detectable in these early DNs, suggesting that DNs at this early stage likely enrich dysfunctional lysosomes. In old AD mouse brains and in the later stage of human AD brains, SAP-C+-DNs and LAMP1+-DNs were gradually reduced in concomitant with the growth of amyloid plaques. Remarkably, the observed LAMP1 immunoreactivity near plaques in aged AD mouse and human brains were actually associated with disease-associated microglia rather than neuronal sources, likely reflecting more severely impaired lysosomal functions in neurons. Western blot analyses showed increased levels of SAP-C in AD mouse brains, and Aβ oligomers induced elevated levels of SAP-C in cellular assays. The elevated protein levels of SAP-C in AD mouse brains during plaque growth potentially contributed lysosomal membrane leakage and loss of hydrolases. Together, our study indicates that lysosomal functions are impaired by being entrapped in DNs early during plaque growth, and this may viciously facilitate growth of amyloid plaques.

Castration causes an increase in lysosomal size and upregulation of cathepsin D expression in principal cells along with increased secretion of procathepsin D and prosaposin oligomers in adult rat epididymis

In the epididymis, lysosomal proteins of the epithelial cells are normally targeted from the Golgi apparatus to lysosomes for degradation, although their secretion into the epididymal lumen has been documented and associated with sperm maturation. In this study, cathepsin D (CatD) and prosaposin (PSAP) were examined in adult epididymis of control, and 2-day castrated rats without (Ct) and with testosterone replacement (Ct+T) to evaluate their expression and regulation within epididymal epithelial cells. By light microscope-immunocytochemistry, a quantitative increase in size of lysosomes in principal cells of Ct animals was noted from the distal initial segment to the proximal cauda. Androgen replacement did not restore the size of lysosomes to control levels. Western blot analysis revealed a significant increase in CatD expression in the epididymis of Ct animals, which suggested an upregulation of its expression in principal cells; androgens restored levels of CatD to that of controls. In contrast, PSAP expression in Ct animals was not altered from controls. Additionally, an increase in procathepsin D levels was noted from samples of the epididymal fluid of Ct compared to control animals, accompanied by an increased complex formation with PSAP. Moreover, an increased oligomerization of prosaposin was observed in the epididymal lumen of Ct rats, with changes reverted to controls in Ct+T animals. Taken together these data suggest castration causes an increased uptake of substrates that are acted upon by CatD in lysosomes of principal cells and in the lumen by procathepsin D. These substrates may be derived from apoptotic cells noted in the lumen of proximal regions and possibly by degenerating sperm in distal regions of the epididymis of Ct animals. Exploring the mechanisms by which lysosomal enzymes are synthesized and secreted by the epididymis may help resolve some of the issues originating from epididymal dysfunctions with relevance to sperm maturation.

Prosaposin, a neurotrophic factor, protects neurons against kainic acid-induced neurotoxicity.

Prosaposin (PS) is the precursor of four sphingolipid activator proteins, saposin A-D. PS is both a precursor protein and a neuroprotective factor, and is up-regulated in response to excitotoxicity induced by kainic acid (KA), a glutamate analogue. Excess glutamate release induces neuropathological disorders such as ischemia and seizure. Our group's research revealed that PS immunoreactivity (IR) increased significantly in the hippocampal and cortical neurons on day 3 after KA injection, and high PS levels were maintained even after 3weeks. The increase in PS, but not saposins, as detected by immunoblotting, suggests that the increase in PS-IR after KA injection was not caused by an increase in saposins acting as lysosomal enzymes after neuronal damage but, rather, by an increase in PS as a neurotrophic factor to improve neuronal survival. An 18-mer peptide (PS18) derived from the PS neurotrophic region significantly protected hippocampal neurons against KA-induced destruction. Furthermore, parvalbumin-positive GABAergic inhibitory interneurons and their axons exhibited intense PS expression. These results suggest that axonally transported PS protects damaged hippocampal pyramidal neurons from KA-induced neurotoxicity. Further in vitro studies that include the transfection of the PS gene will help with clarifying the mechanisms underlying the transport and secretion of PS.

Functional Analysis of Haplotypes in Bovine PSAP Gene and Their Relationship with Beef Cattle Production Traits.

Simple SummaryWith the rapid development of information technology and molecular biotechnology, animal molecular breeding technology is playing an increasingly important role in beef cattle breeding. Prosaposin (PSAP) is involved in regulating the growth and development of animals, and it is reported that PSAP is an important marker-assisted selection (MAS) in cattle herd. The purpose of this study was to explore the novel variants in 3’ UTR of cattle PSAP and evaluate their effects on the morphological traits of four Chinese cattle breeds. In this study, 13 variants were identified in the PSAP 3’ UTR from 501 individuals belonging to four cattle breeds. In Nanyang cattle, the distribution of haplotypes was different from the other three breeds. Two groups of haplotypes had association with morphological traits by changing the secondary structures of PSAP 3’ UTR rather than the miR-184 target sites. This study not only expands the genetic variation spectrum of cattle PSAP but also contributes to MAS genetics and breeding of Chinese cattle breeds.The purpose of this study was to explore functional variants in the prosaposin (PSAP) three prime untranslated region (3’ UTR) and clarify the relationship between the variants and morphological traits. Through Sanger sequencing, 13 variations were identified in bovine PSAP in four Chinese cattle breeds, with six of them being loci in 3’ UTR. In particular, Nanyang (NY) cattle had a special genotype and haplotype distribution compared to the other three breeds. NY cattle with ACATG and GCGTG haplotypes had higher morphological traits than GTACA and GTACG haplotypes. The results of dual-luciferase reporter assay showed that ACATG and GCGTG haplotypes affected the morphological traits of NY cattle by altering the secondary structure of PSAP 3’ UTR rather than the miR-184 target sites. The findings of this study could be an evidence of a complex and varying mechanism between variants and animal morphological traits and could be used to complement candidate genes for molecular breeding.

Does loss of interaction of progranulin and prosaposin promote neurofibrillary tangle development?

AbstractBackgroundProgranulin (PGRN) and prosaposin (PSAP) have lysosomal and neurotrophic properties. Reduced amounts of PGRN in mutant tau‐expressing Alzheimer’s disease (AD) model mice exacerbated phosphorylated tau pathology. The implication of PGRN in tangle formation in AD is not understood nor the association of PSAP with AD. Both features need further research.MethodFixed human brain tissue sections of middle temporal gyrus (MTG) from low plaque (LP)(n=4), high plaque (HP)(n=4) non‐demented (ND), and AD (n=4) cases, and superior frontal gyrus from a presenilin‐1 mutated case and frontal temporal lobar degeneration (FTLD) cases (n=3) with heterozygous granulin mutations were employed in this study. The interaction of PGRN and PSAP was identified with proximity ligation assay (PLA). The colocalization of PGRN and PSAP with tangle was identified by fluorescent immunohistochemistry and triple‐color confocal microscopy with antibodies to phosphorylated tau (p‐tau). PGRN and PSAP fluorescence intensity was measured in p‐tau positive neurons and compared to adjacent p‐tau negative neurons.ResultDifferent p‐tau positive structures were measured and related to the levels of PGRN and PSAP. Extracellular neuropil threads appeared to have no association with these proteins. Reduced levels of PGRN and PSAP were detected in p‐tau positive neurons compared to control neurons in all groups. Average levels of PGRN in control neurons were decreased as disease developed. In the AD group, reduced signals of these proteins were observed overall in neurons without p‐tau, and absent in fully matured neurofibrillary tangles. The levels of PGRN and PSAP negatively correlated with p‐tau immunoreactivity. The presenilin‐1 mutated case with numerous tangles in frontal cortex had absence of PGRN and PSAP in tangles, but colocalization of PGRN and PSAP was evident in adjacent neurons. FTLD cases showed absence of PGRN in most neurons, but continued expression of PSAP. The interaction of PGRN and PSAP in neurons was verified with a PLA assay.ConclusionP‐tau positive neurons had significantly less PGRN and PSAP even in the non‐demented groups, which suggests this could be an early event of tangle formation. The insufficiency of both PGRN and PSAP in neurons might lead to accumulation of p‐tau protein due to deficits in lysosomal activity.

Prosaposin and its receptors GRP37 and GPR37L1 show increased immunoreactivity in the facial nucleus following facial nerve transection.

Neurotrophic factor prosaposin (PS) is a precursor for saposins A, B, C, and D, which are activators for specific sphingolipid hydrolases in lysosomes. Both saposins and PS are widely contained in various tissues. The brain, skeletal muscle, and heart cells predominantly contain unprocessed PS rather than saposins. PS and PS-derived peptides stimulate neuritogenesis and increase choline acetyltransferase activity in neuroblastoma cells and prevent programmed cell death in neurons. We previously detected increases in PS immunoactivity and its mRNA in the rat facial nucleus following facial nerve transection. PS mRNA expression increased not only in facial motoneurons, but also in microglia during facial nerve regeneration. In the present study, we examined the changes in immunoreactivity of the PS receptors GPR37 and GPR37L1 in the rat facial nucleus following facial nerve transection. Following facial nerve transection, many small Iba1- and glial fibrillary acidic protein (GFAP)-positive cells with strong GPR37L1 immunoreactivity, including microglia and astrocytes, were observed predominately on the operated side. These results indicate that GPR37 mainly works in neurons, whereas GPR37L1 is predominant in microglia or astrocytes, and suggest that increased PS in damaged neurons stimulates microglia or astrocytes via PS receptor GPR37L1 to produce neurotrophic factors for neuronal recovery.

Prosaposin in the rat oviductal epithelial cells.

Prosaposin (PSAP) has two forms: a precursor and a secreted form. The secreted form has neurotrophic, myelinotrophic, and myotrophic properties. The precursor form is a precursor protein of saposins A-D. Although the distribution of PSAP in male reproductive organs is well known, its distribution in female reproductive organs, especially in the oviduct, is unclear. Immunoblots and immunohistochemistry of oviducts showed that oviductal tissues contain PSAP proteins, and a significant increase in PSAP was observed in the estrus-metestrus phase compared to the diestrus-proestrus phase in the ampulla. To identify PSAP trafficking in cells, double-immunostaining was performed with antibodies against PSAP in combination with sortilin, mannose 6 phosphate receptor (M6PR), or low-density lipoprotein receptor-related protein 1 (LRP1). PSAP and sortilin double-positive reactions were observed near the nuclei, as well as in the apical portion of microvillous epithelial cells, whereas these reactions were only observed near the nuclei of ciliated epithelial cells. PSAP and M6PR double-positive reactions were observed near the nuclei of microvillous and ciliated epithelial cells. PSAP and M6PR double-positive reactions were also observed in the apical portion of microvillous epithelial cells. PSAP and LRP1 double-positive reactions were observed in the plasma membrane and apical portion of both microvillous and ciliated epithelial cells. Immunoelectron staining revealed PSAP immunoreactive small vesicles with exocytotic features at the apical portion of microvillous epithelial cells. These findings suggest that PSAP is present in the oviductal epithelium and has a pivotal role during pregnancy in providing an optimal environment for gametes and/or sperm in the ampulla.

Metachromatic Leukodystrophy: Diagnosis, Modeling, and Treatment Approaches.

Metachromatic leukodystrophy is a lysosomal storage disease, which is characterized by damage of the myelin sheath that covers most of nerve fibers of the central and peripheral nervous systems. The disease occurs due to a deficiency of the lysosomal enzyme arylsulfatase A (ARSA) or its sphingolipid activator protein B (SapB) and it clinically manifests as progressive motor and cognitive deficiency. ARSA and SapB protein deficiency are caused by mutations in the ARSA and PSAP genes, respectively. The severity of clinical course in metachromatic leukodystrophy is determined by the residual ARSA activity, depending on the type of mutation. Currently, there is no effective treatment for this disease. Clinical cases of bone marrow or cord blood transplantation have been reported, however the therapeutic effectiveness of these methods remains insufficient to prevent aggravation of neurological disorders. Encouraging results have been obtained using gene therapy for delivering the wild-type ARSA gene using vectors based on various serotypes of adeno-associated viruses, as well as using mesenchymal stem cells and combined gene-cell therapy. This review discusses therapeutic strategies for the treatment of metachromatic leukodystrophy, as well as diagnostic methods and modeling of this pathology in animals to evaluate the effectiveness of new therapies.

Two short antimicrobial peptides derived from prosaposin-like proteins in the starry flounder (Platichthys stellatus)

Prosaposin (PSAP) is a precursor of saposin (SAP), which is present in lysosomal and secreted proteins. PSAP is a member of the SAP-like protein families, which comprise multifunctional proteins. In particular, their antimicrobial activity has been reported. We identified PSAP-like (PsPSAPL) sequences from starry flounder and analysed their expression and antimicrobial activity based on cDNA and amino acid sequences. PsPSAPL showed conservation of three saposin B type domains at high levels, and PsPSAPL mRNA was relatively abundantly distributed in the brain and gills of healthy starry founders. PsPSAPL mRNA showed significant expression changes in response to viral haemorrhagic septicaemia virus and Streptococcus parauberis. Synthetic peptides (PsPSAPL-1 and -2), prepared based on amino acid sequences, were used to confirm as well as analyse the antimicrobial activity against bacteria and parasites. Consequently, PsPSAPL-1 and -2 were found to significantly inhibit the growth of various bacteria and kill the Miamiensis avidus. In addition, bacterial biofilm formation was significantly inhibited. Safety was also confirmed by analysing cell haemolysis. These results indicate the immunological function of PsPSAP and the potential antimicrobial activity of the AMPs PsPSAPL-1 and -2.

New therapeutic strategies for the treatment of metachromatic leukodystrophy

Metachromatic leukodystrophy is an autosomal recessive hereditary neurodegenerative disease belonging to the group of lysosomal storage diseases, which is characterized by the damage of the myelin sheath that covers most of the nerve fibers of the central and peripheral nervous systems. Metachromatic leukodystrophy caused by the deficiency of arylsulfatase A (ARSA) lysosomal enzyme (OMIM 250100) or sphingolipid activator protein B (SapB or saposin B) (OMIM 249900). Clinical manifestations of metachromatic leukodystrophy are progressive motor and cognitive impairment in patients. ARSA and SapB protein deficiency are caused by the mutations in the ARSA and PSAP genes, respectively. The severity of clinical signs in metachromatic leukodystrophy is determined by the residual ARSA activity, depending on the type of mutation. There is currently no effective treatment for this disease. Clinical cases of bone marrow or cord blood transplantation have been described, however, the therapeutic effectiveness of these methods remains insufficient to prevent aggravation of neurological disorders in patients. Encouraging results were obtained using gene therapy for delivering the wild-type ARSA gene using vectors based on various serotypes of adeno-associated viruses, as well as using mesenchymal stem cells and combined gene-cell therapy. This review discusses therapeutic strategies for the treatment of metachromatic leukodystrophy, as well as diagnostic methods for this disease.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Mechanism of Secondary Ganglioside and Lipid Accumulation in Lysosomal Disease.

Gangliosidoses are caused by monogenic defects of a specific hydrolase or an ancillary sphingolipid activator protein essential for a specific step in the catabolism of gangliosides. Such defects in lysosomal function cause a primary accumulation of multiple undegradable gangliosides and glycosphingolipids. In reality, however, predominantly small gangliosides also accumulate in many lysosomal diseases as secondary storage material without any known defect in their catabolic pathway. In recent reconstitution experiments, we identified primary storage materials like sphingomyelin, cholesterol, lysosphingolipids, and chondroitin sulfate as strong inhibitors of sphingolipid activator proteins (like GM2 activator protein, saposin A and B), essential for the catabolism of many gangliosides and glycosphingolipids, as well as inhibitors of specific catabolic steps in lysosomal ganglioside catabolism and cholesterol turnover. In particular, they trigger a secondary accumulation of ganglioside GM2, glucosylceramide and cholesterol in Niemann–Pick disease type A and B, and of GM2 and glucosylceramide in Niemann–Pick disease type C. Chondroitin sulfate effectively inhibits GM2 catabolism in mucopolysaccharidoses like Hurler, Hunter, Sanfilippo, and Sly syndrome and causes a secondary neuronal ganglioside GM2 accumulation, triggering neurodegeneration. Secondary ganglioside and lipid accumulation is furthermore known in many more lysosomal storage diseases, so far without known molecular basis.

Variants in saposin D domain of prosaposin gene linked to Parkinson's disease.

Recently, the genetic variability in lysosomal storage disorders has been implicated in the pathogenesis of Parkinson's disease. Here, we found that variants in prosaposin (PSAP), a rare causative gene of various types of lysosomal storage disorders, are linked to Parkinson's disease. Genetic mutation screening revealed three pathogenic mutations in the saposin D domain of PSAP from three families with autosomal dominant Parkinson's disease. Whole-exome sequencing revealed no other variants in previously identified Parkinson's disease-causing or lysosomal storage disorder-causing genes. A case-control association study found two variants in the intronic regions of the PSAP saposin D domain (rs4747203 and rs885828) in sporadic Parkinson's disease had significantly higher allele frequencies in a combined cohort of Japan and Taiwan. We found the abnormal accumulation of autophagic vacuoles, impaired autophagic flux, altered intracellular localization of prosaposin, and an aggregation of α-synuclein in patient-derived skin fibroblasts or induced pluripotent stem cell-derived dopaminergic neurons. In mice, a Psap saposin D mutation caused progressive motor decline and dopaminergic neurodegeneration. Our data provide novel genetic evidence for the involvement of the PSAP saposin D domain in Parkinson's disease.