Promoter-driven Chloramphenicol Acetyltransferase Research Articles

Transcriptional regulation of human alpha1(I) procollagen gene in dermal fibroblasts.

To clarify the fractional activity of promoters from human alpha1(I) procollagen gene, the interaction between cis-elements and consensus DNA-binding proteins responsible for high promoter activity, and the potential application of promoter competitors as well as cytokines for antifibrogenesis. Sequence between 2483 bp upstream of the start of transcription and 42 bp downstream of this site was investigated with serial 5'-deletion. The 5'-deleted promoters recombined with chloramphenicol acetyltransferase (CAT) as reporter gene were transiently transfected to human dermal fibroblasts. Electrophoretic mobility shift assay was performed to show the DNA-protein binding capacity of the promoter sequence. Cytokines including tumor necrosis factor alpha (TNFalpha) and interferons (INFs) were added to the culture medium of transiently transfected fibroblasts. Competitor DNA for the binding sites of Sp-1, Ap-1 and NF-1 was individually cotransfected transiently in order to block the promoter-driven CAT expression. Sequences of -2483 to +42 bp and -268 to +42 bp of human alpha1(I) procollagen gene had high activity as promoters. Binding sites for Ap-1 and Sp-1 were among the cis-regulatory elements recognizing consensus transcription factors responsible for basal promoter activity of sequence -268 to +42 bp. TNFalpha, IFNalpha, IFNbeta showed inhibitory effects on sequence -2 483 to +42 bp as promoter with activities 43%, 62% and 60% of control respectively. Transfection of the promoter competitors could reverse the promoter activity of -268 to +42 bp 40-60%. Sequences of -2 483 to +42 bp recombined with reporter gene provide an ideal construction for transcriptional study of alpha1(I) procollagen gene. The anti-collagen capacity of TNFalpha and IFNs is associated with their transcriptional regulation. Ap-1 and Sp-1 mediate the basal transcriptional activation of human alpha1(I) procollagen gene in dermal fibroblasts. Competitors for highly active promoters might be a novel potential candidate in fibrotic blockade.

Double-stranded RNA regulates IL-4 expression.

dsRNA, as genomic fragment, replicative intermediate, or stem and loop structure in cells infected by viruses, can act to signal the immune system of the presence of viral infections. Although most viral infections are associated with strong Th1 immune responses, Th2-type responses have also been observed. In this study, we characterize the effects of dsRNA on the induction of Th2 responses in human lymphocytes. We report that in addition to the well-known Th1-inducing capabilities of dsRNA, treatment of human lymphocytes with low concentrations of dsRNA (0.1-1 microg/ml) leads to the expression of the prototypic Th2 cytokine IL-4. This induction was accompanied with the concentration-dependent activation of NF-kappaB and NF-AT2 but not NF-AT1. In addition, dsRNA can directly activate an IL-4 promoter-driven chloramphenicol acetyltransferase reporter gene in transiently transfected Jurkat cells. These results are the first demonstration of a non-TCR-associated activator of NF-AT in human cells and suggest that dsRNA directly influences IL-4 gene expression through its effect on NF-AT activation. Our data provide support for the idea that dsRNA at low concentrations in vivo may induce a Th2-dominant response that is not optimal for protective immunity to the virus.

Selective inhibition of interleukin-4 gene expression in human T cells by aspirin

Previous studies indicated that aspirin (acetylsalicylic acid [ASA]) can have profound immunomodulatory effects by regulating cytokine gene expression in several types of cells. This study is the first in which concentrations of ASA in the therapeutic range were found to significantly reduce interleukin (IL)-4 secretion and RNA expression in freshly isolated and mitogen-primed human CD4+ T cells. In contrast, ASA did not affect IL-13, interferon-gamma, and IL-2 expression. ASA inhibited IL-4, but not IL-2, promoter-driven chloramphenicol acetyltransferase expression in transiently transfected Jurkat T cells. The structurally unrelated nonsteroidal anti-inflammatory drugs indomethacin and flurbiprofen did not affect cytokine gene expression in T cells, whereas the weak cyclo-oxygenase inhibitor salicylic acid was at least as effective as ASA in inhibiting IL-4 expression and promoter activity. The inhibitory effect of ASA on IL-4 transcription was not mediated by decreased nuclear expression of the known salicylate target nuclear factor (NF)-kappaB and was accompanied by reduced binding of an inducible factor to an IL-4 promoter region upstream of, but not overlapping, the NF of activated T cells- and NF-kappaB-binding P1 element. It is concluded that anti-inflammatory salicylates, by means of a previously unrecognized mechanism of action, can influence the nature of adaptive immune responses by selectively inhibiting the expression of IL-4, a critical effector of these responses, in CD4+ T cells.

Identification and Characterization of a Critical CP2-binding Element in the Human Interleukin-4 Promoter

Expression of cytokine genes in T cells is thought to result from a complex network of antigen- and mitogen-activated transcriptional regulators. CP2, a factor homologous to Drosophila Elf-1 and previously found to be a critical regulator of several viral and cellular genes in response to developmental signals, is rapidly activated in T helper (Th) cells in response to mitogenic stimulation. Here we show that overexpression of CP2 enhances interleukin (IL)-4 promoter-driven chloramphenicol acetyltransferase expression, while repressing IL-2 promoter activity, in transiently transfected Jurkat cells. A CP2-protected element, partially overlapping the nuclear factor of activated T cell-binding P2 sequence, was required for IL-4 promoter activation in CP2-overexpressing Jurkat cells. This CP2-response element is the site of a cooperative interaction between CP2 and an inducible heteromeric co-factor(s). Mutation of conserved nucleotide contacts within the CP2-response element prevented CP2 binding and significantly reduced constitutive and induced IL-4 promoter activity. Expression of a CP2 mutant lacking the Elf-1-homology region of the DNA-binding domain inhibited IL-4 promoter activity in a dominant negative fashion in transiently transfected Jurkat cells. Moreover, overexpressed CP2 markedly enhanced, while its dominant negative mutant consistently suppressed, expression of the endogenous IL-4 gene in the murine Th2 cell line D10. Taken together, these findings point to CP2 as a critical IL-4 transactivator in Th cells.

An SP1-like cis-Element Is the Major DNA Motif for Differential Expression Regulation of the Adipocyte Amino Acid Transporter

Adipocyte amino acid transporter (AAAT) is induced during the 3T3-L1 preadipocyte differentiation process. In the −1819-bp 5′-upstream flanking region of the AAAT genomic gene, six DNase I protected sites were identified by using the 3T3-L1 adipocyte nuclear extract. Results of chloramphenicol acetyltransferase (CAT) expression from the chimeric AAAT promoter-driven CAT reporter gene indicated that one protein binding site, from −68 to −26, was essential for the promoter activity. However, this protein binding site does not contain recognition sites of the transcription factors important for adipocyte differentiation, i.e., the C/EBP or PPAR family. Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from −65 to −46, was the cis-element essential and partially sufficient for inducible activity of the AAAT gene promoter.

Tissue-specific p53 expression in the nervous system

P53 is a transcription factor that has been found to be expressed in association with cell proliferation and apoptosis. Previously, bacterial chloramphenicol acetyl transferase (CAT) enzymatic expression was predominantly found in the testes of p53 promoter driven-CAT transgenic mice. In the current study, we extended this study to survey p53 expression across both the central and peripheral nervous systems of the same strain of transgenic mice as well as their parental strain. High levels of p53 promoter driven-CAT activity was observed in the cerebellum, hippocampus, hypothalamus, pons, thalamus and upper cerebral spine. Furthermore, we consistently found unexpectedly high levels of p53 promoter-driven CAT expression in the eyes. These observations were reinforced by p53 protein analysis using a p53 pan ELISA assay. Immunohistochemical studies confirmed and further defined p53 expression in several regions of the nervous system. Significantly, p53 promoter-driven CAT expression was visualized in the Ammon horn of the hippocampus, in the Purkinje cells of the cerebellum and in the cornea as well as in the retina of the eye. Furthermore, strong p53 protein expression was found in the cornea of the parental mouse strain. p53 ELISA demonstrated a profile of p53 protein concentration, which correlate well with the high p53 promoter-driven CAT activities observed in the cerebellum, hindbrain, hypothalamus, thalamus, hippocampus, whole eyes as well as with the low CAT activities observed in the cortex and spinal cord. In both of these assays considerable p53 promoter activity and p53 protein levels were found in post-mitotic non-dividing cells.

C-Src Activation Plays a Role in Endothelin-dependent Hypertrophy of the Cardiac Myocyte

Activation of the atrial natriuretic peptide (ANP) gene is regarded as one of the earliest and most reliable markers of hypertrophy in the ventricular cardiac myocyte. We have examined the role of the nonreceptor tyrosine kinases in the signaling mechanism(s) leading to hypertrophy using human ANP gene promoter activity as a marker. Endothelin (ET), a well known hypertrophic agonist, increased activity of c-Src, c-Yes, and Fyn within minutes and promoted a selective redistribution of each of these kinases within the cell. Overexpression of c-Src effected a significant increase in activity of a cotransfected human ANP promoter-driven chloramphenicol acetyl transferase reporter, while expression of either c-Yes or Fyn was considerably less effective in this regard. ET-dependent stimulation of the human ANP gene promoter was partially inhibited by co-transfection with dominant negative Ras or dominant negative Src or Csk or by treatment with the potent Src family-selective tyrosine kinase inhibitor PP1, suggesting that the Src family kinases are involved in signaling ET-dependent activation of this promoter. Both ET- and Src-dependent activation of the ANP promoter required the presence of a CArG motif in a serum response element-like structure between -422 and -413 but did not appear to require assembly of a ternary complex for full activity. These findings support a role for Src in the activation of ANP gene expression and suggest that this kinase may contribute in an important way to the signaling mechanisms that activate hypertrophy in the cardiac myocyte.

Suppression of ANP Gene Transcription by Liganded Vitamin D Receptor

We showed previously that liganded vitamin D receptor (VDR) effects a suppression of human atrial natriuretic peptide (hANP) gene-promoter activity in cultured neonatal rat atrial myocytes. In the present study, we have attempted to identify the structural domains of the VDR that are involved in mediating this suppression. We examined the effects of a series of VDR mutants on a cotransfected hANP promoter-driven chloramphenicol acetyltransferase (CAT) reporter. Neither the native VDR nor any of the mutants tested displayed inhibitory activity in the absence of the 1,25-dihydroxyvitamin D3 (VD3) ligand. Delta134, a deletant harboring solely the DNA binding region of the VDR, and L254G, a mutant shown to be defective in retinoid X receptor (RXR) heterodimer formation in other systems, were as effective as the native VDR in reducing promoter activity. HBD, a deletant containing only the hormone-binding domain of the VDR, and K246G, a point mutant that is defective in the activation function of the receptor, did not attenuate reporter activity. A similar activity profile was displayed when a positively regulated promoter containing a direct-repeat vitamin D responsive element (DR3-CAT) was examined in these cells. Liganded VDR, the delta134 mutant, and liganded L254G effected increases in DR3-CAT activity of 2.5-, 2-, and 4-fold, respectively. Two nonhypercalcemic analogues of VD3 (RO 23-7553 and RO 25-6760) displayed the same inhibitory activity as VD3. These studies suggest that the inhibition of hANP promoter activity requires both the DNA binding and activation functions of the receptor but does not appear to require formation of a classic RXR alpha-VDR heterodimer.

Loss of AP-2 Results in Up-regulation ofMCAM/MUC18 and an Increase in Tumor Growth and Metastasis of Human Melanoma Cells

MCAM/MUC18 is a cell-surface glycoprotein of 113 kDa, originally identified as a melanoma antigen, whose expression is associated with tumor progression and the development of metastatic potential. We have previously shown that enforced expression of MCAM/MUC18 in primary cutaneous melanoma led to increased tumor growth and metastatic potential in nude mice. The mechanism for up-regulation of MCAM/MUC18 during melanoma progression is unknown. Here we show that up-regulation of MCAM/MUC18 expression in highly metastatic cells correlates with loss of expression of the transcription factor AP-2. The MCAM/MUC18 promoter contains four binding sites for AP-2, and electrophoretic mobility shift assay gels demonstrated that the AP-2 protein bound directly to the MCAM/MUC18 promoter. Transfection of AP-2 into highly metastatic A375SM melanoma cells (AP-2-negative and MCAM/MUC18-positive) inhibited MCAM/MUC18 promoter-driven chloramphenicol acetyltransferase reporter gene in a dose-dependent manner. MCAM/MUC18 mRNA and protein expression were down-regulated in AP-2-transfected but not in control cells. In addition, re-expression of AP-2 in A375SM cells inhibited their tumorigenicity and metastatic potential in nude mice. These results indicate that the expression of MCAM/MUC18 is regulated by AP-2 and that enforced AP-2 expression suppresses tumorigenicity and metastatic potential of human melanoma cells, possibly by down-regulating MCAM/MUC18 gene expression. Since AP-2 also regulates other genes that are involved in the progression of human melanoma such as c-KIT, E-cadherin, MMP-2, and p21(WAF-1), we propose that loss of AP-2 is a crucial event in the development of malignant melanoma.

Analysis of the promoter elements necessary for IL-4 and anti-CD40 antibody induction of murine Fc epsilon RII (CD23): comparison with the germline epsilon promoter.

IL-4 and CD40 ligand stimulate transcription of CD23 (Fc epsilonRII) in B cells and are necessary for the expression of germline epsilon mRNA and production of IgE. Because in vivo studies have shown that the Fc epsilonRII is involved in the regulation of IgE, a study was initiated to compare how IL-4 and engagement of CD40 up-regulate the Fc epsilonRII and epsilon genes. Herein, we describe the preparation of a series of linker-scanning mutants that cover the IL-4 response region in the murine Fc epsilonRII promoter, and their function when transfected into M12.4.5 and M12.4.1 B lymphoma cell lines. Several discrete elements were found to be necessary for IL-4 induction of the Fc epsilonRII gene, some of which have homology with the binding sites of known transcription factors, including NF-IL-4 and NF-kappaB. In contrast, the response element for anti-CD40 (plus IL-4) mapped to a single discrete sequence, a NF-kappaB-like site. Aligning the Fc epsilonRII and germline epsilon promoters in the region that is highly conserved between the human and mouse homologues of both genes reveals a high degree of identity, particularly within discrete clusters. Comparing the function of linker-scanning mutants of the Fc epsilonRII promoter with a similar report for germline epsilon shows that both genes require at least two homologous and similarly located DNA elements in their promoters for a full IL-4 induction. Moreover, the similar response of Fc epsilonRII and epsilon promoter-driven chloramphenicol acetyl transferase plasmids to several cytokines and other agents suggests that the two proximal promoter regions are activated by a similar cassette of factors.

Role of Hydroperoxyeicosatetraenoic Acids in Oxidative Stress-induced Activating Protein 1 (AP-1) Activity

We have previously reported that hydrogen peroxide, an active oxygen species and a cellular oxidant, induces c-Fos and c-Jun mRNA expression and DNA synthesis in vascular smooth muscle cells and that these events require arachidonic acid release and metabolism through the lipoxygenase pathway. Here we have identified the eicosanoids that mediate the hydrogen peroxide-induced growth-related events in these cells. Hydrogen peroxide stimulated the production of 12- and 15-hydroperoxyeicosatetraenoic acids in vascular smooth muscle cells. Both 12- and 15-hydroperoxyeicosatetraenoic acids induced the expression of c-Fos and c-Jun protein and increased activating protein 1 (AP-1) activity, as measured by AP-1-DNA binding and AP-1-dependent human collagenase promoter-driven chloramphenicol acetyltransferase reporter gene transcription. Hydrogen peroxide and arachidonic acid also induced the expression of c-Fos and c-Jun protein and AP-1 activity. Nordihydroguaiaretic acid, an inhibitor of the lipoxygenase pathway, significantly inhibited both hydrogen peroxide and arachidonic acid-stimulated c-Fos and c-Jun protein expression and AP-1 activity. Together, these findings suggest that hydrogen peroxide induces the production of eicosanoids and that the eicosanoids are potential mediators of the oxidative stress-stimulated growth-related events in vascular smooth muscle cells.

Downregulation of the Human Heme Oxygenase Gene by Glucocorticoids and Identification of 56b Regulatory Elements

Several human heme oxygenase-1 promoter-driven chloramphenicol acetyltransferase constructs were examined in order to analyze promoter activity of the heme oxygenase-1 gene in microvessel endothelial cells. Heme oxygenase promoter activity was up-regulated by interleukin-6. This induction was shown to be down-regulated by glucocorticoids. Chloramphenicol acetyltransferase assays revealed that the promoter region (56 base pair) between −180 and −120 was responsible for up-regulation by growth factors, as well as for glucocorticoid-directed down-regulation. The same DNA fragment was shown to bind nuclear factor(s) from endothelial cells treated with dexamethasone. Formation of DNA protein complexes peaked after a 6-hour treatment. The DNA fragment was found to contain a sequence recognized by the STAT 3/acute phase response factor.

Induction of Nopaline Synthase Promoter Activity by H2O2 Has No Direct Correlation with Salicylic Acid

Transgenic tobacco (Nicotiana tabacum L.) plants carrying a fusion between the nopaline synthase (nos) promoter and chloramphenicol acetyltransferase (CAT) reporter gene (caf) were tested for their response to treatment with H2O2. The nos promoter-driven CAT activity increased significantly by addition of H2O2, reaching the maximum level at 15 mM. Kinetic analysis for CAT activity showed that induction by H2O2 was similar to that of methyl jasmonate (MJ), but was much slower than induction by salicylic acid (SA). Time-course experiments for mRNA level also revealed that the response to H2O2 treatment was similar to that of MJ. The nos promoter displayed a rapid and transient induction of mRNA with SA treatment, with the maximum levels occurring at 3 h, whereas the levels induced by H2O2 or MJ treatment increased continuously during the 11-h experimental period. The antioxidants N-acetyl-L-cysteine and catechol did not alter the SA effect. The responses of the nos promoter to H2O2, MJ, and wounding were significantly reduced by deletions of the CAAT box region and the sequence between -112 and -101. However, these deletions did not significantly alter the SA response. This suggests that H2O2 may have a different mechanism from that of SA for inducing nos promotor activity.

The regulation of uterine tissue factor by estrogen

Tissue factor (TF) is a transmembrane protein that initiates coagulation and indirectly catalyzes the conversion of prothrombin to thrombin. We previously showed that treatment of immature rats with estradiol (E(2)) stimulated a rapid increase in TF mRNA and protein in the uterus. Our current experiments usingin situ hybridization show that the increase in TF mRNA occurred primarily in the stromal cell layer. The effect of E(2) to increase TF mRNA occurred in uterine organ cultures but not in separated epithelial and stromal cellsin vitro. Thrombin and the phorbol ester, TPA, compounds which regulate TF expression in other cell types by activation of protein kinase C (PKC), increased TF mRNA in both uterine organ cultures and in separated uteriné cells. The 5' regulatory region of the TF gene was examined for the presence of an estrogen response element (ERE) using a plasmid, pTFCAT, containing -740 to + 15 bp of the mouse TF promoter upstream of the chloramphenicol acetyltransferase (CAT) reporter gene. There was no response to E(2) in HeLa cells cotransfected with pTFCAT and a human ER construct, pHEO. In contrast, E(2) increased CAT activity in cells cotransfected with a positive-control plasmid, containing the consensus ERE cloned upstream of the thymidine kinase promoter-driven CAT gene, and pHEO. CAT activity was also increased by TPA in cells transfected with pTFCAT. In summary, E(2) induces TF mRNA in uterine organ culture indicating that systemic factors are not absolutely required for the effect. However, E(2) injection induces transudation of plasma prothrombin into the uterus where it may be converted to thrombin. Thus thrombin may contribute to E(2)-induction of TF mRNAin vivo. An ERE was not identified in the 750 bp immediately 5' to the transcription start site of the TF gene although a TPA-responsive element was present. It is postulated that E(2) may induce TF mRNA by multiple indirect pathways including stimulation of PKC and Jun and Fos transcription factors, and by generation of thrombin in the uterus.

Characterization of the rat light neurofilament (NF-L) gene promoter and identification of NGF and cAMP responsive regions.

We have isolated a genomic DNA clone covering the coding and 14 kb upstream region of the rat light neurofilament (NF-L) gene and sequenced 2.3 kb of its promoter. DNase I hypersensitive sites have been mapped in PC12 cells. For functional analysis of the NF-L promoter, constructs carrying 38, 97, 407, 564, 650, 1,099, 1,660, 2,003 base pairs (bp) upstream region in front of the chloramphenicol acetyltransferase (CAT) reporter gene were tested for their capability to direct CAT expression after transient transfection into various cell lines. Similar CAT activities were recorded both in rat pheochromocytoma (PC12) and mouse neuroblastoma N115 cells and also in several nonneural cell lines (HeLa, C127, NIH 3T3). Regions responsible for the basic promoter activity were located between -407 and +75 bp from the transcription initiation site. The NGF-responsive element was located between -38 and +75 bp, and sequence -97 to -38 was found to contain a functional cAMP-responsive element. In PC12 cells in which nerve growth factor (NGF) induces neurite outgrowth and NF-L transcription, NF-L promoter-driven CAT expression was stimulated up to 12-fold within three days of NGF treatment, whereas epidermal growth factor (EGF) had no effect. Rat NF-L promoter contained Sp1, AP-2 and CGCCCCCGC elements. In PC12 cells, NGF transiently induced the binding of transcription factors to the deoxyoligonucleotide probes containing the binding sites of these elements. The role of these factors in NF-L gene transcriptional induction by NGF in PC12 cells is discussed.

Evidence of Increased Glyceraldehyde-3-phosphate Dehydrogenase and Fatty Acid Synthetase Promoter Activities in Transiently Transfected Adipocytes from Genetically Obese Rats

Previous studies have shown that the adipose tissue of young genetically obese Zucker rats was characterized by a coordinate overtranscription of lipogenic genes, suggesting that the fa mutation triggers transcription factor(s) acting in common on the promoters of these genes. To test this hypothesis, we developed a system of transient transfection of rat adipocytes with constructs containing glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and fatty acid synthetase (FAS) promoters fused to gene reporter CAT. Those transfected cells expressed high levels of promoter-driven chloramphenicol acetyltransferase (CAT) activity through correctly initiated transcription as shown by primer extension analysis. Using this system we found a direct effect of insulin on GAPDH and FAS gene expression in rat adipocytes. In transfected adipocytes from obese compared to lean rats, activity of GAPDH and FAS promoters fused to CAT, was 2.6- and 8-fold increased, respectively. In contrast when reporter gene activity was driven by either phosphoenolpyruvate carboxykinase or beta-actin promoter, no difference could be observed between lean and obese, pointing out the promoter specificity of genotype effect. 5' deletion analysis of GAPDH promoter allowed us to narrow down the fa responsive region to nucleotide -488-329. As assessed by gel retardation and DNase I footprinting analysis, adipocyte nuclear protein interactions to this 159-bp fragment were found to be identical and to footprint the same 20-bp sequence. This study pointed out that overexpression of GAPDH and FAS genes in adipose tissue of genetically obese rats relies on promoter activation, through a 159-bp cis-acting region within the GAPDH promoter. The effects of the fa mutation on trans-acting factors binding to this region remain to be identified.

Dopaminergic Regulation of a Transfected Preproenkephalin Promoter in Primary Rat Astrocytes in Vitro and in Vivo

The clinical benefit of transplantation therapies utilizing genetically modified cells could be enhanced if expression of engineered genes was regulated by clinically useful pharmacological agents. Toward this end, we examined pharmacologic effects on the expression of hybrid gene constructs transfected into primary rat striatal astrocytes. These astrocytes are known to express receptors for the neurotransmitter dopamine (DA). In vitro, we found that expression of a transiently transfected human ppEnk promoter-driven chloramphenicol acetyltransferase (CAT) reporter construct was induced by DAergic agonists, as much as 20-fold. This induction was blocked by a DA receptor antagonist. The same concentration of DA also increased the endogenous rat ppEnk mRNA, by >2-fold. In vivo, regulation of CAT expression by DA was tested by implanting the genetically modified astrocytes into the normal striatum and the contralateral striatum which had >95% DA depletion induced by a previous 6-hydroxy-DA lesion of the substantia nigra. As hypothesized on the basis of the in vitro data, CAT activity on the lesioned side, where the stimulating effect of endogenous DA was lacking, was 30% lower than on the control side where the normal DA content was present. The data suggest that control of the enkephalin gene in astrocytes may involve second messenger pathways activated by DA receptors. Moreover, the evidence that clinically applicable drugs can regulate inducible genes introduced into the brain by astrocyte implantation is of potential importance in development of therapeutic strategies.

The Epstein-Barr Virus Determined Nuclear Antigens EBNA-3A, -3B, and -3C Repress EBNA-2-Mediated Transactivation of the Viral Terminal Protein 1 Gene Promoter

The Epstein-Barr virus (EBV) nuclear antigen 2 (EBNA-2) has been shown to transactivate both cellular and viral gene promoters including the promoter for the viral terminal protein 1 gene (TP-1). We investigated whether three other EBV nuclear antigens EBNA-3A, -3B, and -3C (which themselves share a degree of primary sequence homology) could also play a role in TP-1 gene regulation. The TP-1 promoter sequence was linked to the chloramphenicol acetyltransferase (CAT) gene and used in cotransfection experiments in an EBV negative cell line with various combinations of vectors expressing individual EBNA-3s. In the absence of other EBV proteins, the EBNA-3s did not stimulate TP-1 promoter activity. In the presence of EBNA-2, the EBNA-3s were shown to be capable of reducing the level of TP-1 promoter-driven CAT activity. The EBNA-3s had no effect on a panel of heterologous promoters, indicating that EBNA-2 and/or transcription elements specific to the TP-1 promoter are essential for the observed activity of the EBNA-3S. The functional antagonism between the EBNA-2 and EBNA-3 proteins may be important in the overall viral strategy.

Interferon-beta induces metalloproteinase mRNA expression in human fibroblasts. Role of activator protein-1.

Matrix metalloproteinases are secreted enzymes important in inflammation and tumor invasion. Earlier, we demonstrated that in normal human FS-4 fibroblasts, collagenase and stromelysin mRNA levels are increased not only after treatment with known matrix metalloproteinase inducers such as tumor necrosis factor (TNF), interleukin-1, and 12-O-tetradecanoylphorbol-13-acetate, but also with interferon-beta (IFN-beta). In this study, we compared the regulation of these matrix metalloproteinase genes by TNF and IFN-beta. We show that both TNF and IFN-beta increase steady-state levels of collagenase and stromelysin mRNAs with similar slow kinetics. The glucocorticoid dexamethasone blocked matrix metalloproteinase induction by both cytokines. The protein synthesis inhibitor cycloheximide inhibited collagenase mRNA induction by TNF or IFN-beta, suggesting that induction by both agents is indirect. Consistent with these observations, both TNF and IFN-beta increased c-fos and c-jun mRNA levels. Furthermore, treatment with TNF or IFN-beta increased the transcriptional activity of activator protein-1-responsive chloramphenicol acetyltransferase reporter gene constructs, including a native collagenase promoter-driven chloramphenicol acetyltransferase construct. These findings show that regulation of matrix metalloproteinase gene expression by both TNF and IFN-beta involves the transcription factor activator protein-1 and demonstrate a novel indirect mechanism of type I IFN-induced gene expression.

Novel mechanism of glucocorticoid-mediated gene repression. Nuclear factor-kappa B is target for glucocorticoid-mediated interleukin 8 gene repression.

A glucocorticoid, dexamethasone, inhibited the production of a leukocyte chemotactic cytokine, interleukin 8 (IL-8), as well as mRNA expression by a glioblastoma cell line, T98G, stimulated with interleukin 1 (IL-1). Dexamethasone also inhibited IL-8 promoter-driven chloramphenicol acetyltransferase (CAT) activities induced by IL-1, suggesting that dexamethasone inhibited IL-8 production mainly at the transcriptional level. Moreover, CAT assay revealed that the nuclear factor-kappa B (NF-kappa B) binding site was the crucial cis-element required for conferring IL-1 responsiveness in conjunction with the CCAAT enhancer binding protein/nuclear factor-IL-6 (NF-IL6) and/or the AP-1 binding site(s). Mutation of either the AP-1 or NF-IL6 binding site did not abolish IL-8 gene repression by dexamethasone, suggesting that these sites were not targets for dexamethasone. Trimerized kappa B sequence in the IL-8 gene was enough for conferring the induction by IL-1 and inhibition by dexamethasone of CAT activity. Finally, dexamethasone diminished the IL-1-induced formation of NF-kappa B complexes, which were identified immunochemically to consist of p50 and p65, without reducing the amount of translocated factors. Collectively, dexamethasone interfered with the binding of the most essential transcription factor, NF-kappa B, to its cognate cis-element, thereby suppressing the transcription of IL-8 gene.