Axillary Shoot Proliferation Research Articles

Establishment of a Highly Efficient In Vitro Regeneration System for Nandina domestica ‘Firepower’

Nandina domestica ‘Firepower’ is one of the most popular colorful foliage species in landscaping. However, it is currently propagated mainly by seeding and cuttings, with a low reproduction coefficient, hindering the cultivation of this species. Therefore, establishing an in vitro regeneration system would be beneficial for the industrialized production of Nandina domestica ‘Firepower’. In this study, an ex vivo regeneration system was established using the direct organogenesis pathway. In early April, the new shoots of Nandina domestica ‘Firepower’ were selected, and the stem segments of 1~2 cm were cut as the disinfection materials for the explants. The optimal formulation for inducing axillary shoots was 1/2 MS + 1.5 mg L−1 6-benzylaminopurine (BA) + 0.3 mg L−1 indole-3-butric acid (IBA). The optimal formulation for the differentiation and proliferation of axillary shoots was 1/2 MS + 1.5 mg L−1 BA + 0.01 mg L−1 IBA with a multiplicity of proliferation of 9.22. We determined that the rooting of axillary shoots required a combination of IBA, naphthalene acetic acid (NAA), and activated carbon (AC). The optimal formulation for rooting was 1/2 MS + 0.2 mg L−1 NAA + 0.3 mg L−1 IBA + 0.2 mg L−1 AC. After a two-day hardening period for tissue-cultured plantlets, a substrate consisting of peat soil, vermiculite, and perlite at a ratio of 2:2:1 was determined to be the optimal cultivation formulation. This system provides a framework for the industrialized production of Nandina domestica ‘Firepower’.

First detection of Aster Yellows Associated with Phytoplasma on Camelina sativa in Montana.

Camelina (Camelina sativa L.) is an oilseed crop in the Brassicaceae family that can be grown as a spring or summer annual or as a biennial winter crop in a variety of climates and soil conditions (Moser 2010). It has been grown on a commercial basis in Montana for more than a decade (Grady and Nleya 2010). During the 2020 and 2021 growing seasons, camelina plants grown in plots at Sidney, MT, exhibited symptoms typical of aster yellows phytoplasma (Candidatus Phytoplasma asteris) infection. Symptoms included stunted growth, purpling of leaves, phyllody, proliferation of shoots and axillary shoots, and a reduced number or absence of pods (Figure 1). We examined 1696 single plants in a field experiment, approximately 4% in the 0.5-acre plot was found with symptoms. Plants were collected from seven locations across the field, with three replicate plants per location. Two 2-cm pieces of branches were taken from each plant for DNA extraction, using the BioSprint DNA Plant Kit (Qiagen, Germany) following the manufacturer's instructions. DNA was amplified by nested PCR first using the primers P1 (AAGAGTTTGATCCTGGCTCAGGATT) and P6 (TGGTAGGGATACCTTGTTACGACTTA), then R16F2 (ACGACTGCTGCTAAGACTGG) and R16R2 (TGACGGGCGGTGTGTACAAACCCCG), according to the protocol described by Olivier et al. (2010). These primers are universal for phytoplasma detection, which amplify a specific 16S rDNA fragment. PCR products of 1200 bp were obtained from all symptomatic plants, while no amplicons were obtained from the asymptomatic plants, including the asymptomatic parts of the partially infected plant. The PCR products were sequenced with primers R16F2 and R16R2 from both 5' and 3' ends, and the resulting sequences were submitted to GenBank (accession no. PQ134480). BLASTN search showed that the sequences we obtained were 99.46% similar to Maryland aster yellows phytoplasma (accession no. KC283215) and Sesame phyllody phytoplasma (accession no. JX448399, JX448400, JX448401, HM449958). To further confirm the identity of the pathogen, a second set of primers fTuf1 (CACATTGACCACGGTAAAAC) and rTuf1 (CCACCTTCACGAATAGAGAAC) were used (Schneider et al. 1997). These primers universally amplify phytoplasma elongation factor TU (tuf) gene fragment. PCR products around 1100 bp were obtained, sequenced with the same primers, and submitted to GenBank (accession no. PQ256823). BLASTN result shows that the sequences were 99.80% identical to aster yellows witches'-broom phytoplasma (accession no. AY277404, CP000061). These sequencing results suggest that the pathogen infecting camelina is aster yellows phytoplasma. Aster yellows has been reported on camelina in South Dakota (Byamukama et al. 2016) and Canada (Séguin-Swartz et al. 2009). Our sequence was 100% similar to the one reported in South Dakota. To our knowledge, this is the first report of aster yellows on camelina in Montana. The phytoplasma has a wide host range, primarily Asteraceae, and is vectored by the aster leafhopper (Macrosteles quadrilineatus). Weeds in the Asteraceae can act as reservoirs for the carryover of the pathogen from year to year. The pathogen can also infect canola, barley, wheat, peas, and alfalfa, which are widely grown as rotation crops in the Sidney, MT area. The aster leafhopper is commonly found on wheat in SD (Varenhorst, 2024). The distribution and impact of aster yellows on camelina productivity in Montana remains to be determined, but this discovery alerts the researchers and growers to be aware of the disease.

Multiplication of apical and axillary shoots of coffee arabica using various types of cytokinins

Abstract In-vitro shoot multiplication presents a promising avenue for replicating the genetic characteristics of parent plants, commonly utilized in various plant biotechnological techniques such as mutation replication, protoplast fusion, anther culture, and genetic engineering. The primary aim of this research was to assess the impact of different cytokinins on the proliferation of apical and axillary shoots in Arabica coffee multiplication. A Completely Randomized Factorial Design was employed, considering two factors: explant source and cytokinin type. Explants were sourced from both apical and axillary branches of AS2K Arabica coffee plantlets. Three cytokinins, namely 6-Benzyl adenine purine (BAP), isopentenyl adenine (2-IP), and kinetin, were incorporated into the Murashige and Skoog (MS) 1962 basal medium at concentrations of 0, 1, 2, and 3 mg/l. The findings revealed significant effects of all three cytokinins on shoot number, plantlet height, and leaf growth, albeit without influencing root development. Notably, axillary shoot-derived explants demonstrated a more pronounced effect on shoot count compared to those from apical shoots. Among the cytokinin treatments assessed, BAP at a concentration of 2 mg/l in the MS medium yielded optimal results for propagating the AS2K variety of Arabica coffee, thus representing the recommended medium for this purpose.

Micropropagation and Genetic Fidelity of Fegra Fig (Ficus palmata Forssk.) and Grafting Compatibility of the Regenerated Plants with Ficus carica.

Ficus palmata is an important fig species that produces edible and nutritious fruit and possesses several therapeutic uses. This study reports an effective method for the micropropagation of F. palmata using nodal explants. In vitro shoots were cultured for 7 weeks onto MS medium fortified with different concentrations of cytokinins, light intensities, sucrose concentrations, and light/dark incubation treatments. Optimal axillary shoot proliferation (10.9 shoots per explant) was obtained on a medium containing 30 g/L sucrose and supplemented with 2 mg/L 6-benzylaminopurine (BAP) under 35 μmol/m2/s light intensity. Dark incubation limited the foliage growth but favored shoot elongation and rooting compared with light incubation. Elongated shoots, under dark conditions, were rooted (100%; 6.67 roots per explant) onto MS medium containing 1 mg/L indole-3-acetic acid (IAA) and 1.5 g/L activated charcoal. The micropropagated plantlets were acclimatized with a 95% survival rate. In this study, the genetic fidelity of micropropagated F. palmata clones along with their mother plant was tested using randomly amplified polymorphic DNA (RAPD), inter-simple sequence repeats (ISSR), and start codon targeted (SCoT) molecular markers. The genetic similarity between the micropropagated plantlets and the mother plant of F. palmata was nearly 95.9%, assuring high uniformity and true-to-type regenerated plants. Using micropropagated F. palmata plantlets as a rootstock proved appropriate for the grafting F. carica 'Brown Turkey'. These findings contribute to the commercial propagation and production of the fig crop.

Synthesis and Accumulation of Phytocompounds in Field-, Tissue-Culture Grown (Stress) Root Tissues and Simultaneous Defense Response Activity in Glycyrrhiza glabra L.

Harsh climates, i.e., drought, extreme temperatures, and toxic gases, pose issues to agriculture by altering plants’ growth and yield. Biotechnology with biochemical defense approaches is beneficial for generating new plants/varieties with extra resilience to adverse conditions. In response to stress, cultures show an enriched level of secondary metabolite synthesis. Here, an efficient in vitro propagation method using axillary shoot proliferation, along with callus formation, was established in Glycyrrhiza glabra L. The phytochemical composition of in vitro and in vivo grown tissues was analyzed using a gas chromatography–mass spectrometry (GC–MS) technique, and the biochemical attributes were measured and compared in different investigated tissues. Callus formation from root explants was achieved with a frequency of 88.89% on MS medium containing 2.0 mg/L BAP and 0.5 mg/L 2,4-D. Axillary shoot proliferation was obtained from dormant buds when cultured onto MS supplemented with BAP alone, or in combination with, IAA. The maximum shoot proliferation (94.44%) was recorded on MS with 1.0 mg/L BAP with an average shoot length of 10.5 cm. The regenerated shoots were subcultured and transferred to the root induction medium, supplemented with various concentrations of IAA/IBA, wherein 2.0 mg/L IBA resulted in the best rooting frequency (88.89%). The GC–MS-based phytocompounds analysis of the methanolic extracts of root-derived callus and in vivo- and in vitro- grown root tissues was conducted. These samples revealed the presence of more than 35 therapeutically important bioactive compounds, such as methylglabridin, sitosterol, lupeol, squalene, stearic acid, linoleic acid, etc. The biochemical parameters, like total phenolic content, flavonoid content, DPPH scavenging activity, superoxide dismutase, and peroxidase activity were also measured. All the biochemical attributes were found to be higher in in vitro derived roots than the callus and in vivo grown root (donor) samples. These findings demonstrated that callus (root derived) and in vitro roots are a stable and potent source of multiple phytocompounds, encompassing medical significance with wide applications. This study may serve as an alternative opportunity in the sustained and continuous synthesis of important compounds without harming natural vegetation and normal environment.

Proliferation of Axillary Shoots of Chestnut in Temporary Immersion Systems.

Shoots from European chestnut and hybrids of European and Asian chestnuts can be efficiently proliferated in liquid medium by temporary immersion (TIS) using RITA® and Plantform™ bioreactors. The main challenges of applying TIS to these species were the lack of growth and hyperhydricity; problem solutions included the manipulation of the hormone concentration, the explant type, immersion frequency, and a support for maintaining shoots in a vertical position. After protocol optimization, explants cultured by TIS produced more rootable shoots than explants growing in semisolid medium, enabling increased number of rooted and acclimatable shoots. In this chapter, we will describe the protocols for proliferating chestnut by TIS in RITA® and Plantform™ bioreactors, together with tips for avoiding the main pitfalls of the technique. The strategies applied to chestnut can be useful for culturing other woody plants in bioreactors.

Axillary shoot proliferation and regeneration of red rose [pisiformis (christ.) D. Sosn. An under thread extinction species endemic to Turkey

In vitro propagation of red rose [Rosa pisiformis (Christ.) D. Sosn.] has great importance in rapid proliferation of species with medicinal features and in culture of healthy plants free from deseases. After a succesfully pre-sterilization procedure, experiments were maintained by two-phase: multiplication phase and rooting of microshoots phase. Micropropagation of Rose was improved, using its nodal segments under different combination of BAP (0, 1.0, 2.0, 0.6 mg/l), NAA (0, 0.1, 0.2, 0.01 mg/l) on Driver and Kuniyuki (DKW) and MS medium in multiplication phase and using distinct compositions of IBA (0, 1.0, 3.0, 5.0 mg/l) and DKW medium in rooting phase. The maximum number of shoots/per plant (22.6) with the highest number of leaves (222.6) were obtained in DKW medium supplemented with 0.6 mgl-1 BAP and 0.01 mg/l NAA. The leaf explants were also used to occur callus in MS with different combinations of BAP and NAA. Good callus formation was obtained with 1:2 ratio of BAP:NAA combination in MS medium. Furthermore, the highest root induction (100%) was achieved in DKW medium consisting of 1 mg/l IBA. The rooted plantlets were transferred to the field after acclimatized in greenfield conditions. The present investigation presents an in vitro protocol for R. pisiformis. Bangladesh J. Bot. 52(4): 949-958, 2023 (December)

Influence of Cytokinins, Dark Incubation and Air-Lift Bioreactor Culture on Axillary Shoot Proliferation of Al-Taif Rose (Rosa damascena trigintipetala (Diek) R. Keller)

Rose is a widely favored floriculture crop that is commercially propagated through the application of tissue culture techniques. Here, we report an effective method for axillary shoot proliferation in Al-Taif rose, an important cultivar for rose oil industry. Stem nodes were excised from an adult donor Al-Taif rose shrub and cultured for 4 weeks on Murashige and Skoog’s (MS) medium supplemented with 6-benzylaminopurine (BAP) or gibberellic acid (GA3) at 0 and 3 mg·L−1 to induce the sprouting of axillary shoots. Al-Taif rose shoots were cultured in vitro for 6 weeks on MS medium fortified with different concentrations of cytokinins, light/dark incubation and different culture types (gelled and liquid/bioreactor culture). The culture conditions that were applied had a noteworthy impact on the responses of Al-Taif rose shoot proliferation. The supplementation of the medium with 6-benzylaminopurine (BAP) resulted in an augmented rate of shoot proliferation in comparison to other cytokinins. Additionally, dark incubation limited foliage growth, leaf yellowing and abscission and favored shoot proliferation compared with light incubation. Liquid culture using bioreactors provided higher axillary shoot proliferation and growth as compared with gelled culture. A continuous immersion system with a net provided the highest axillary shoots (four shoots per explant) and shoot length (16.5 cm), whereas an immersion system without a net provided the highest fresh weight of axillary shoots (499 mg per explant). These findings will improve commercial propagation and contribute to the rose oil industry of Al-Taif rose.

Jujube witches' broom phytoplasmas inhibit ZjBRC1-mediated abscisic acid metabolism to induce shoot proliferation.

Jujube witches' broom (JWB) phytoplasmas parasitize the sieve tubes of diseased phloem and cause an excessive proliferation of axillary shoots from dormant lateral buds to favour their transmission. In previous research, two JWB effectors, SJP1 and SJP2, were identified to induce lateral bud outgrowth by disrupting ZjBRC1-mediated auxin flux. However, the pathogenesis of JWB disease remains largely unknown. Here, tissue-specific transcriptional reprogramming was examined to gain insight into the genetic mechanisms acting inside jujube lateral buds under JWB phytoplasma infection. JWB phytoplasmas modulated a series of plant signalling networks involved in lateral bud development and defence, including auxin, abscisic acid (ABA), ethylene, jasmonic acid, and salicylic acid. JWB-induced bud outgrowth was accompanied by downregulation of ABA synthesis within lateral buds. ABA application rescued the bushy appearances of transgenic Arabidopsis overexpressing SJP1 and SJP2 in Col-0 and ZjBRC1 in the brc1-2 mutant. Furthermore, the expression of ZjBRC1 and ABA-related genes ZjHB40 and ZjNCED3 was negatively correlated with lateral main bud outgrowth in decapitated healthy jujube. Molecular evidence showed that ZjBRC1 interacted with ZjBRC2 via its N-terminus to activate ZjHB40 and ZjNCED3 expression and ABA accumulation in transgenic jujube calli. In addition, ZjBRC1 widely regulated differentially expressed genes related to ABA homeostasis and ABA signalling, especially by binding to and suppressing ABA receptors. Therefore, these results suggest that JWB phytoplasmas hijack the ZjBRC1-mediated ABA pathways to stimulate lateral bud outgrowth and expansion, providing a strategy to engineer plants resistant to JWB phytoplasma disease and regulate woody plant architecture to promote crop yield and quality.

Screening of Cork Oak for Resistance to Phytophthora cinnamomi and Micropropagation of Tolerant Seedlings

Massive propagation of cork oak (Quercus suber) individuals tolerant to Phytophthora cinnamomi (Pc) is probably the most important challenge for cork production. Screening for resistance to Pc of ca. 200 seedlings obtained from a single cork oak tree that has survived the epidemic was performed by soil infestation. Twenty months after Pc inoculation, 33 seedlings survived from Pc infection and the four most vigorous seedlings were selected. The plants were forced to produce new shoots under controlled climatic conditions, and the new shoots were used to establish the plants in vitro by axillary budding. High axillary shoot proliferation rates were achieved by culturing the new shoots on Lloyd and McCown (WPM) medium, followed by subculturing for 2 weeks on 0.22 µM benzyladenine (BA) and for 2 weeks further on 0.04 µM BA. Addition of 20 µM silver thiosulphate (STS) increased the proliferation rates and improved the appearance and development of shoots. Rooting rates of 80–100% were obtained by culturing the shoots for 24 or 48 h on Gresshoff and Doy medium with ⅓ macronutrients plus 122.5 µM indole-3-butyric acid and subsequent transfer to root expression medium containing 20 µM STS. The results of this study optimize the micropropagation of a relevant and recalcitrant tree species in forestry.

Morpho-Physiological Evaluation of Solanum betaceum Cav. In Vitro Cloned Plants: A Comparison of Different Micropropagation Methods.

Tamarillo (Solanum betaceum Cav.) is a subtropical solanaceous tree with increasing agronomic interest due to its nutritious edible fruits. Growing demand for tamarillo plants and fruits requires optimization of existing propagation methods and scaled-up systems for large-scale cloning of selected germplasm. Three in vitro protocols have been used to micropropagate tamarillo: (1) axillary shoot proliferation in a semisolid medium, (2) organogenesis, and (3) somatic embryogenesis procedures. Variables such as the age of the established shoot cultures and rooting treatments were also analyzed. The morphological and physiological quality of acclimatized plants derived from all the methodologies were compared, with seed-derived plants used as a control group. Overall, the results show that in vitro-derived plants have a similar development to seed-derived plants. Micropropagation by axillary shoot proliferation was highly efficient, with rooting rates above 80% in most treatments. Organogenesis induction was more effective from lamina explants using MS media with 2.0 mg·L-1 6-benzylaminopurine. Both organogenesis and somatic embryogenesis-derived plants were also morphologically and physiologically equivalent to seed and axillary shoot-derived plants. The specificities of each micropropagation method are discussed.

Ex Situ Conservation of Atriplex taltalensis I.M. Johnst. via In Vitro Culturing of Its Axillary Shoots

Atriplex taltalensis is an endangered shrub endemic to northern Chile. Sparse populations of this species can be found in areas with extreme edaphoclimatic conditions in the Atacama desert, and its seeds have a poor germination rate. Consequently, mass-cultivating it can be challenging. In this study, the vegetative propagation mechanisms of A. taltalensis were evaluated using an in vitro culture to aid in their conservation. A. taltalensis shoot explants were treated with two phytoregulators, indole-3-butyric acid (IBA) and 6-benzylaminopurine (BAP), to assess the morphogenic responses and their effects on the propagation of the species, based on shoot multiplication, elongation, and rooting, through subculturing. During multiplication, the treatment with IBA alone efficiently promoted explant elongation, lateral root formation, and axillary shoot proliferation, allowing for the rapid development of shoots into whole plants. Alternatively, treatment with IBA and BAP in combination stimulated the proliferation of basal shoots with little elongation and rooting and promoted shoot hyperhydricity at 0.25–1 mg L−1 BAP concentrations. Thus, we conclude that A. taltalensis propagation is viable through in vitro plant tissue culture using a rapid axillary shoot multiplication system, and this method could aid in the conservation of this species through in vitro propagation and rescue programs.

Effect of pH and gelling agents in nutrient medium on in vitro shoot multiplication of Swertia chirata Buch.-Ham ex Wall: An endangered medicinal herb

Swertia chirata is a medicinal plant indigenous to the Himalaya, and widely known for its curative properties against chronic fever, blood, lung, skin, liver and many other disorders. The plant is very popular in medicinal preparations in domestic and international markets. However, unscientific collection practices, poor seed germination, loss of habitat, etc. have caused the plant to become critically endangered. Biotechnological applications like tissue culture technology hold potential for mass propagation and germplasm conservation. While propagating the species through tissue culture, several factors need to be standardized to enable optimal plantlet production under laboratory conditions. The present study was conducted to examine the role of pH in the nutrient medium and media type on in vitro propagation of S. chirata . MS medium with BAP, IAA and Ads were used to test the efficiency of pH in a range of 2.8–7.8 and of media type (liquid or semisolid; and varying concentrations of gelling agents). pH 5.8 and agarified media were most favourable for in vitro axillary shoot proliferation. The shoot number, shoot length and health of in vitro -grown shoots were found to vary significantly with alterations in these factors. The standardized conditions encourage the growth of robust shoots, which will aid in the development of roots and survival of tissue-culture-grown plantlets following transplanting in the field.

Micropropagation of Opuntia and Other Cacti Species Through Axillary Shoot Proliferation: A Comprehensive Review.

Cacti are one of the most significant and diversified groups of angiosperms, distributed and cultivated globally, mostly in semi-arid, arid, and the Mediterranean climate regions. Conventionally, they are propagated by seeds or through vegetative propagation via rooted offshoots or grafting. However, these multiplication procedures remain insufficient for mass propagation. In vitro culture techniques are utilized to mass propagate endangered and commercial cacti species. These include somatic embryogenesis and plant regeneration through indirect or direct organogenesis. The latter is a promising tool for commercial clonal propagation of high-value species and has been successfully implemented for several species, such as Mammillaria, Hylocereus, Cereus, Echinocereus, and Ariocarpus. However, its success depends on explant type, basal nutrient formulation of culture medium, and types and concentrations of plant growth regulators. This study aimed to assess the potential of in vitro propagation methods applied to cacti species and discuss the different factors affecting the success of these methods. This study has also highlighted the insufficient work on Opuntia species for mass propagation through axillary buds' proliferation. The development of an efficient micropropagation protocol is thus needed to meet the supply of increasing demand of Opuntia species for human consumption as fruit, animal feed, and ecological restoration in semi-arid and arid zones.

Propagation of Coccinia cordifolia (L.) Cogn. from shoot tip and nodal segment through micropropagation techniques

The present work was undertaken to develop a reproducible protocol for the micropropagation of an important medicinal plant of the Cucurbitaceae family, Coccinia cordifolia (L.) Cogn., by using shoot tips and nodal segments to overcome the impediment in seed settings and seed germination of conventional reproduction. To develop an efficient protocol, 0.1% HgCl2 treatment for 6 minutes was found effective for surface sterilization of field-grown explants to eliminate microbes and fungus and to get healthy tissues. Throughout the study, different concentrations of auxin, cytokine, and gibberellin were used either alone or in combination as supplemented in MS medium to find suitable conditions and suitable explant (nodal segment). BAP was the best cytokine source as 2.0 mg/l BAP produced 4.0±0.20 and 4.8±0.09 shoots per culture and gained 5.8±0.11 cm and 6.7±0.32 cm length with regeneration rate of 90 and 100 percent in shoot tips and node, respectively. The highest percentage (90%) of regeneration for axillary shoot proliferation was obtained in node explants at MS medium containing 2.0 mg/l BAP + 0.1 mg/l NAA. The highest number of shoots regenerated per culture was 3.0±0.41, with a length of 6.0±0.16 cm. GA3 was also found effective in producing longer shoots with the combination of BAP, but the average shoot number was reduced drastically. Although full-strength MS medium was found to be ideal for shoot regeneration and used in shoots proliferated experiments, half and full-strength of MS medium with auxins supplements of 0.5, 1.0, and 2.0 mg/l either of IBA, NAA, and IAA) were used for roots growth and half strength nutrients supplemented with 0.5 mg/l IBA was found most compelling. The highest number of roots regenerated per shoot was 3.1±0.30, and the average root length was 1.8±0.30 cm. Rooted plantlets were finally transplanted into small plastic pots containing sun sterilized sand, soil and humus (1: 2: 1) to adapt the plantlet in ex vitro environment, and acclimatized plantlets showed 95% survival rate in outdoor condition which proved the effectiveness of using biotechnology to improve plant’s growth rate and mass production.

Molecular identification of 16SrII-C and 16SrII-D phytoplasma strains associated with phyllody and axillary shoot proliferation in papaya

Molecular identification of 16SrII-C and 16SrII-D phytoplasma strains associated with phyllody and axillary shoot proliferation in papaya

Analysis of simple sequence repeats in Period genes in mammals

In vitro propagation by axillary shoot proliferation, assessment of antioxidant activity, and genetic fidelity of micropropagated Paederia foetida L.Biswaranjan Behera, Priyajeet Sinha, Sushanto Gouda, Sakti K. Rath, Durga P. Barik, Padan K. Jena, Pratap C. Panda, Soumendra K. Naik

First report of a Jujube witches’‐broom phytoplasma (16SrV) strain associated with witches’‐broom and little leaf disease of Solanum melongena in India

Solanum melongena (aubergine or brinjal; family Solanaceae) is a popular vegetable grown extensively in India, Bangladesh, Pakistan, China, Japan, Philippines, Egypt, France, Italy, and the United States (Chadha et al., 1993). Brinjal's cultivation is hampered by the Brinjal little leaf (BLL) phytoplasma. A phytoplasma survey was conducted in various brinjal production areas of Hoshangabad in Central India (Figure 1) during May 2019. Phytoplasma-like symptoms such as proliferation of axillary shoots, witches’- broom, excessive branching, little leaf and the absence of flowers and fruits when compared to symptomless brinjal plants were observed (Figure 2). For molecular detection of phytoplasma, total DNA was isolated from diseased and symptomless leaf samples (100 mg). The phytoplasma 16S rRNA gene was amplified by direct PCR using P1/P6 primers (Deng & Hiruki, 1991) and nested PCR with universal primers R16F2n/R16R2 (Gundersen & Lee, 1996), producing amplicons of the expected size (c. 1.2 kb) for the diseased (4/4) samples but not from the symptomless plant tested. Two nested PCR amplicons were purified (Wizard SV gel extraction kit; Promega, USA) and sequenced bidirectionally (Bioinovations Pvt. Ltd., India). The consensus partial 16S rRNA gene sequences were identical and the sequence data was submitted to GenBank, Accession Nos. MW025971 (BR01) and MW025257 (BR02). BLASTn analysis showed that the sequence shared 99% sequence identity with the 16S rRNA gene sequence of Jujube witches'-broom phytoplasma (MH972556, MH972553, MH972548) and ‘Candidatus Phytoplama balanitae’ (HG937644, LT558785, MH819290), Periwinkle yellows phytoplasma (EU375835) and the Elm yellows group (16SrV). Phylogenetic analysis (MEGA v 7.1) showed the closest relationships with strains of Jujube witches'-broom phytoplasma (MH972556, H744152 and MH972548) and ‘Ca. P. balanitae’ (LT558785), a member the group 16SrV, ‘Ca. P. ulmi’ (Figure 3). Six phytoplasma ribosomal groups (16SrI, 16SrII, 16SrIII, 16SrVI, 16SrIX, 16SrXII) have been associated with S. melongena globally. BLL phytoplasmas were first reported in India in 1995 (Schneider et al., 1995). In India and Japan, a BLL phytoplasma was identified as a member of the group 16SrI, ‘Ca. P. asteris’ (Kumar et al., 2012). The group 16SrVI, ‘Ca. Phytoplasma trifolii’ was also associated with BLL symptoms in India (Yadav et al., 2015). However, this is the first report of a ‘Ca. P. ulmi’ strain (group 16SrV), associated with a witches'-broom disease of brinjal in India. This finding has a significant impact for future epidemiological studies since brinjal could be an alternative host for 16SrV phytoplasma strain which affect several other important vegetable crops cultivated in Hoshangabad, Central India. The authors would like to thank to the Head of the Department of Microbiology and Vice Chancellor, Barkatullah University, Bhopal for support and encouragement.

Micropropagation of the potential blueberry rootstock—Vaccinium arboreum through axillary shoot proliferation

• Vaccinium arboreum adapts to soil with high pH and low organic matter. It has great potential as blueberry rootstock. • Micropropagation is an efficient way to produce true-to-type superior clones. • Long and Preece medium (LP) with 2.28 μM Zeatin (ZT) and 0.05 μM indole-3-butyric acid (IBA) is efficient to proliferate axillary shoots. • In vitro shoots were efficiently rooted ex vitro after dipping with 1 g L −1 indole-3-butyric acid (IBA) or α-Naphthaleneacetic acid (NAA). Vaccinium arboreum is adapted to soils with low organic matter and high pH. It is considered as a potential blueberry rootstock. The objective of this research was to establish a rapid mass propagation protocol of V. arboreum through axillary shoots proliferation with minimum somaclonal variation. Nodal segments from cuttings were cultured on Driver and Kuniyaki walnut medium (DKW) with different cytokinins for initial culture establishment. DKW, woody plant medium (WPM), and Long and Preece medium (LP) were compared for best shoot proliferation. Zeatin (ZT) concentrations from 0 to 4.56 μM were evaluated for optimizing the concentration. Both in vitro and ex vitro rooting were evaluated. The pH tolerance of in vitro shoots was investigated by adjusting the media pH from 5 to 8.5. Best shoot proliferation was achieved by LP medium supplemented with 2.28 μM ZT and 0.05 μM indole-3-butyric acid (IBA). In vitro shoots proliferated best on medium pH 5, though the shoots could survive on pH 8. All the micropropagated shoots successfully rooted by ex vitro rooting after dipping with auxin. All rooted plantlets acclimatized and grew well in greenhouse. Micropropagation through axillary shoots proliferation is an efficient method to propagate true-to-type V. arboreum in large number for future use as rootstock.

In vitro large scale clonal propagation of Achyranthes aspera L.: A high value medicinal plant

Achyranthes aspera is an important medicinal plant widely used in indigenous systems of medicine for the treatment of a variety of diseases and disorders. Efficient and reproducible protocols were established for in vitro clonal propagation of A. aspera through axillary shoot proliferation from nodal segments and de novo adventitious shoot formation directly from the leaf and stem explants. Multiple shoot proliferation from nodal segments was achieved on Murashige and Skoog’s (MS) medium supplemented with different concentrations of cytokinins like benzyl aminopurine and kinetin and the best results were achieved on MS medium supplemented with 8.88 μM benzyl aminopurine where 15-16 shoots were initiated after 5-6 weeks. The present material exhibited a high propensity of de novo adventitious root and shoot formation directly from the leaf and stem segments without the intervening callus phase. Direct regeneration of shoots was observed on MS medium supplemented with naphthlene acetic acid (10.74-21.48 μM) alone or in conjunction with benzyl aminopurine or kinetin producing 18-20 shoots. The regenerated shoots were rooted on basal MS medium and the plantlets were successfully acclimatized and established in the field with 80% survival.