Progeny Lines Research Articles

Introduction of Floral Scent Traits into Asiatic Hybrid Lilies (Unscented) by Crossbreeding with <i>Lilium cernuum</i> (Scented)

Although a strong floral scent is typical of hybrid lilies, Asiatic hybrid lilies (Lilium spp.) have only a weak scent. Therefore, developing new cultivars with pleasant floral scents is an important objective in Asiatic hybrid lily breeding programs. Among the wild species contributing to Asiatic hybrid lily establishment, L. cernuum has a characteristic scent that the nose can perceive. We crossed Asiatic hybrid lily cultivars twice with L. cernuum to introduce floral scent traits into Asiatic hybrid lilies, and scent emission in the F1 plants and their progeny lines was evaluated instrumentally. Flowers of L. cernuum emitted benzenoids/phenylpropanoids (mainly 2-phenylethanol and benzaldehyde), monoterpenes (predominantly linalool and linalool oxides), and a fatty acid (iso-valeric acid). Lilium cernuum gave off unpleasant odors mainly because of iso-valeric acid emission. The F1 flowers also emitted these three chemical classes. Among the lines derived from the crosses between Asiatic hybrid lily cultivars and the F1 plant, lines that emitted all three chemical classes and lines that released one or two of the three chemical classes were segregated, and some lines emitted benzenoids/phenylpropanoids or terpenoids without emitting fatty acids. We successfully selected elite breeding lines that predominantly emitted pleasant scents. Therefore, this study demonstrated the introduction of pleasant scent production capability into Asiatic hybrid lilies using interspecific hybridization with L. cernuum.

Identification, characterization, and rescue of CRISPR/Cas9 generated wheat SPO11-1 mutants.

Increasing crop yields through plant breeding is time consuming and laborious, with the generation of novel combinations of alleles being limited by chromosomal linkage blocks and linkage-drag. Meiotic recombination is essential to create novel genetic variation via the reshuffling of parental alleles. The exchange of genetic information between homologous chromosomes occurs at crossover (CO) sites but CO frequency is often low and unevenly distributed. This bias creates the problem of linkage-drag in recombination 'cold' regions, where undesirable variation remains linked to useful traits. In plants, programmed meiosis-specific DNA double-strand breaks, catalysed by the SPO11 complex, initiate the recombination pathway, although only ~5% result in the formation of COs. To study the role of SPO11-1 in wheat meiosis, and as a prelude to manipulation, we used CRISPR/Cas9 to generate edits in all three SPO11-1 homoeologues of hexaploid wheat. Characterization of progeny lines shows plants deficient in all six SPO11-1 copies fail to undergo chromosome synapsis, lack COs and are sterile. In contrast, lines carrying a single copy of any one of the three wild-type homoeologues are phenotypically indistinguishable from unedited plants both in terms of vegetative growth and fertility. However, cytogenetic analysis of the edited plants suggests that homoeologues differ in their ability to generate COs and in the dynamics of synapsis. In addition, we show that the transformation of wheat mutants carrying six edited copies of SPO11-1 with the TaSPO11-1B gene, restores synapsis, CO formation, and fertility and hence opens a route to modifying recombination in this agronomically important crop.

Genomic prediction for the Germplasm Enhancement of Maize project.

The Germplasm Enhancement of Maize (GEM) project was initiated in 1993 as a cooperative effort of public- and private-sector maize (Zea mays L.) breeders to enhance the genetic diversity of the U.S. maize crop. The GEM project selects progeny lines with high topcross yield potential from crosses between elite temperate lines and exotic parents. The GEM project has released hundreds of useful breeding lines based on phenotypic selection within selfing generations and multienvironment yield evaluations of GEM line topcrosses to elite adapted testers. Developing genomic selection (GS) models for the GEM project may contribute to increases in the rate of genetic gain. Here we evaluated the prediction ability of GS models trained on 6 yr of topcross evaluations from the two GEM programs in Raleigh, NC, and Ames, IA, documenting prediction abilities ranging from 0.36 to 0.75 for grain yield and from 0.78 to 0.96 for grain moisture when models were cross-validated within program and heterotic group. Predicted genetic gain from GS ranged from 0.95 to 2.58 times the gain from phenotypic selection. Prediction ability across program and heterotic group was generally poorer than within groups. Based on observed genomic relationships between GEM breeding lines and their tropical ancestors, GS for either yield or moisture would reduce recovery of exotic germplasm only slightly. Using GS models trained within program, the GEM programs should be able to more effectively deliver on its mission to broaden the genetic base of U.S. germplasm.

Characteristics of Dry Matter Production and Yield Components of a High-Yielding Rice Cultivar ‘Hokuriku 193’ and Its Progeny Lines in Nagano, Japan

Characteristics of Dry Matter Production and Yield Components of a High-Yielding Rice Cultivar ‘Hokuriku 193’ and Its Progeny Lines in Nagano, Japan

Identification and characterization of pleiotropic and epistatic QDRL conferring partial resistance to Pythium irregulare and P. sylvaticum in soybean.

Pleiotropic and epistatic quantitative disease resistance loci (QDRL) were identified for soybean partial resistance to different isolates of Pythium irregulare and Pythium sylvaticum. Pythium root rot is an important seedling disease of soybean [Glycine max (L.) Merr.], a crop grown worldwide for protein and oil content. Pythium irregulare and P. sylvaticum are two of the most prevalent and aggressive Pythium species in soybean producing regions in the North Central U.S. Few studies have been conducted to identify soybean resistance for management against these two pathogens. In this study, a mapping population (derived from E13390 x E13901) with 228 F4:5 recombinant inbred lines were screened against P. irregulare isolate MISO 11-6 and P. sylvaticum isolate C-MISO2-2-30 for QDRL mapping. Correlation analysis indicated significant positive correlations between soybean responses to the two pathogens, and a pleiotropic QDRL (qPirr16.1) was identified. Further investigation found that the qPirr16.1 imparts dominant resistance against P. irregulare, but recessive resistance against P. sylvaticum. In addition, two QDRL, qPsyl15.1, and qPsyl18.1 were identified for partial resistance to P. sylvaticum. Further analysis revealed epistatic interactions between qPirr16.1 and qPsyl15.1 for RRW and DRX, whereas qPsyl18.1 contributed resistance to RSE. Marker-assisted resistance spectrum analysis using F6:7 progeny lines verified the resistance of qPirr16.1 against four additional P. irregulare isolates. Intriguingly, although the epistatic interaction of qPirr16.1 and qPsyl15.1 can be confirmed using two additional isolates of P. sylvaticum, the interaction appears to be suppressed for the other two P. sylvaticum isolates. An 'epistatic gene-for-gene' model was proposed to explain the isolate-specific epistatic interactions. The integration of the QDRL into elite soybean lines containing all the desirable alleles has been initiated.

Intraspecific versus interspecific crosses for superior progeny in Cicer species

AbstractBoth intraspecific and interspecific crosses are a well‐known breeding strategies to generate variations or assemble desirable traits in economically important plants. Interspecific crosses have been mined to improve resistance to (a)biotic stresses in chickpea (Cicer arietinum L.) in a limited number of research studies but have never been crosschecked for yield and yield criteria in intraspecific versus interspecific crosses. Comparison of superior progeny or superior recombinant inbred lines (RILs) and better progeny than their best parent for yield, yield criteria, and resistance to (a)biotic stresses in intraspecific versus interspecific crosses was the objectives of this study. Also, associations between superior progeny and genetic distance based on simple sequence repeat (SSR) markers were assessed among annual Cicer species including cultivated chickpea, C. reticulatum Ladiz. and C. echinospermum P.H. Davis. Each two genotypes of C. reticulatum and C. echinospermum were crossed with three genotypes of cultivated chickpea. Not only superior progeny for yield and yield criteria, but also superior RILs that were cold tolerant were detected higher in interspecific crosses than in intraspecific crosses. On the other hand, plant height, first pod height, and seed size were higher in intraspecific crosses than in interspecific crosses, indicating that seed size and traits suitable for combine harvest can be increased via intraspecific crosses. A significant association was found between superior progeny and genetic distance among Cicer species. It was concluded that interspecific crosses in Cicer species may increase yield and resistance to (a)biotic stresses, whereas intraspecific crosses may increase plant height and seed size.

Incorporation of Soil-Derived Covariates in Progeny Testing and Line Selection to Enhance Genomic Prediction Accuracy in Soybean Breeding.

The availability of high-dimensional molecular markers has allowed plant breeding programs to maximize their efficiency through the genomic prediction of a phenotype of interest. Yield is a complex quantitative trait whose expression is sensitive to environmental stimuli. In this research, we investigated the potential of incorporating soil texture information and its interaction with molecular markers via covariance structures for enhancing predictive ability across breeding scenarios. A total of 797 soybean lines derived from 367 unique bi-parental populations were genotyped using the Illumina BARCSoySNP6K and tested for yield during 5 years in Tiptonville silt loam, Sharkey clay, and Malden fine sand environments. Four statistical models were considered, including the GBLUP model (M1), the reaction norm model (M2) including the interaction between molecular markers and the environment (G×E), an extended version of M2 that also includes soil type (S), and the interaction between soil type and molecular markers (G×S) (M3), and a parsimonious version of M3 which discards the G×E term (M4). Four cross-validation scenarios simulating progeny testing and line selection of tested–untested genotypes (TG, UG) in observed–unobserved environments [OE, UE] were implemented (CV2 [TG, OE], CV1 [UG, OE], CV0 [TG, UE], and CV00 [UG, UE]). Across environments, the addition of G×S interaction in M3 decreased the amount of variability captured by the environment (−30.4%) and residual (−39.2%) terms as compared to M1. Within environments, the G×S term in M3 reduced the variability captured by the residual term by 60 and 30% when compared to M1 and M2, respectively. M3 outperformed all the other models in CV2 (0.577), CV1 (0.480), and CV0 (0.488). In addition to the Pearson correlation, other measures were considered to assess predictive ability and these showed that the addition of soil texture seems to structure/dissect the environmental term revealing its components that could enhance or hinder the predictability of a model, especially in the most complex prediction scenario (CV00). Hence, the availability of soil texture information before the growing season could be used to optimize the efficiency of a breeding program by allowing the reconsideration of field experimental design, allocation of resources, reduction of preliminary trials, and shortening of the breeding cycle.

Transfer of Durable Stripe Rust Resistance Gene Yr39 into Four Chinese Elite Wheat Cultivars Using Marker-Assisted Selection

Wheat gene Yr39 confers durable high-temperature adult-plant (HTAP) resistance to stripe rust caused by Puccinia striiformis f. sp. tritici, one of the most destructive diseases of wheat worldwide. The objective of this study was to transfer Yr39 into four Chinese elite wheat cultivars. Backcross inbred line populations were developed from four Chinese wheat cultivars Chuanmai 42 (CM42), Bainong Aikang 58 (AK58), Han 6172 (H6172) and Zhengmai 9023 (ZM9023) crossed with a Yr39 single-gene line. The F1, BC1F1 and BC1F6 lines were genotyped using resistance gene analogs polymorphism (RGAP) markers Xwgp36, Xwgp44 and Xwgp43, which are closely linked to Yr39. Progeny lines selected with the markers for Yr39 were evaluated in the field for stripe rust resistance and agronomic traits including plant height, tiller numbers, spike grain numbers and thousand-grain weight. Eleven lines were selected with stripe rust resistance and desirable agronomic traits. These lines with production potential can be used for further testing in various wheat production regions and as germplasm resources for breeding new wheat cultivars with durable stripe rust resistance, high yield, and adaptation to different production environments.

Interactions Between Lr67 or Lr34 and Other Leaf Rust Resistance Genes in Wheat (Triticum aestivum).

The wheat multi-pest resistance genes Lr67 and Lr34 are similar in that they both condition resistance to many diseases, in a non-race-specific manner, and code for cellular transporters. Lr34 plays a critical role in breeding wheat for disease resistance in large part because it interacts with other resistance genes to result in effective and durable resistance. To determine if Lr67 interacts with other resistance genes in a similar manner as Lr34 six different doubled haploid populations were developed which segregated for either Lr67 or Lr34 along with a second resistance gene, either Lr13, Lr16, or Lr32. The presence or absence of each of these genes in the progeny lines was determined by molecular marker analysis. These six populations were tested for leaf rust field resistance in the same environments to compare the effects of Lr34 and Lr67 alone, and in combination with Lr13, Lr16 or Lr32. Lr67 and Lr34 significantly reduced the levels of rust severity, Lr34 showed a significant interaction with Lr13 but Lr67 did not. Both genes interacted with Lr16, and Lr67 had a significant interaction with Lr32. This analysis demonstrates the similar effect of Lr67, as seen with Lr34, on the interaction with other resistance genes to give a better level of resistance than with single resistance genes. While Lr67 is not widely deployed in agriculture, it could play an important role in disease resistance in future wheat cultivars.

Genomic Insights Into Sclerotinia Basal Stalk Rot Resistance Introgressed From Wild Helianthus praecox Into Cultivated Sunflower (Helianthus annuus L.).

Crop wild relatives of the cultivated sunflower (Helianthus annuus L.) are a valuable resource for its sustainable production. Helianthus praecox ssp. runyonii is a wild sunflower known for its resistance against diseases caused by the fungus, Sclerotinia sclerotiorum (Lib.) de Bary, which infects over 400 broadleaf hosts including many important food crops. The objective of this research was to dissect the Sclerotinia basal stalk rot (BSR) resistance introgressed from H. praecox ssp. runyonii into cultivated sunflower. An advanced backcross quantitative trait loci (AB-QTL) mapping population was developed from the cross of a H. praecox accession with cultivated sunflower lines. The AB-QTL population was evaluated for BSR resistance in the field during the summers of 2017–2018 and in the greenhouse in the spring of 2018. Highly significant genetic variations (p < 0.001) were observed for the BSR disease in the field and greenhouse with a moderately high broad-sense heritability (H2) ranging from 0.66 to 0.73. Genotyping-by-sequencing approach was used to genotype the parents and the progeny lines of the AB-QTL population. A genetic linkage map spanning 1,802.95 cM was constructed using 1,755 single nucleotide polymorphism (SNP) markers mapped on 17 sunflower chromosomes. A total of 19 BSR resistance QTL were detected on nine sunflower chromosomes, each explaining 2.21%–16.99% of the phenotypic variance for resistance in the AB-QTL population. Sixteen of the 19 QTL had alleles conferring increased BSR resistance derived from the H. praecox parent. SNP markers flanking the identified QTL will facilitate marker-assisted breeding to combat the disease in sunflower.

Molecular Characterization and Genetic Structure Evaluation of Breeding Populations of Fennel (Foeniculum vulgare Mill.)

Fennel, or Foeniculum vulgare Mill., is an important horticultural crop belonging to the Apiaceae family that is cultivated worldwide and used in the agri-food sector and for pharmaceutical preparations. Breeding strategies in this species usually involve three parental lines, including two maternal lines (one cytoplasmic male-sterile line and an ideotype representative maintainer line) that are crossed to obtain an ideotype representative of the cytoplasmic male-sterile line and one paternal line, used as a pollinator in crosses with the progeny of the derived maternal lines. From this cross, F1 hybrid progenies are obtained, which are characterized by high levels of heterozygosity and hybrid vigor. In this study, over 450 plants, representing 8 breeding populations and their respective 3 parental and 1 progeny line, were genotyped by means of codominant molecular markers. The 12 highly polymorphic microsatellites enabled the analyses of the genetic variability, distinctiveness and stability of each breeding line. Moreover, the genetic structure of the core collection was investigated, which, together with the homozygosity, gene flow and genetic similarity results, allowed the identification of unsuitable lines to be used in breeding plans due to their low homozygosity (10.4% in the pollinator line of population 7). Moreover, the Bayesian reconstruction of the core collection’s genetic structure, based on the codominant markers used, allowed us to confirm the distinctiveness results obtained from the genetic similarity investigation and the computed gene flow estimates. Among these, a trend in hybrid heterozygosity was also observed, that increased when the genetic similarity between the respective parental lines decreased. Thus, this research proposes a suitable method for genotyping fennel populations in pre- and post-breeding approaches, such as marker-assisted breeding or breeding line distinctiveness and stability verifications.

Evaluation of yellow rust resistance in backcross populations of wheat

Aim: To screen wheat populations derived from cross DBW17 × WH1105 for loci imparting yellow rust resistance and selection of plants using polymorphic SSRs. Methodology: The study for yellow rust resistance was carried out on two populations, i.e., BC1F2 and BC2F2. Stress was provided by planting infector rows between the blocks and by artificial inoculation using a mixture of races 46S102, 47S103 and 78S84 of stripe rust pathogen. DNA isolated from young leaves was checked for the presence of yellow rust resistance genes using gene specific primers. Results: Fifteen primers were found to be polymorphic among parents DBW17 and WH1105. Fifteen polymorphic SSR markers were dispersed over the wheat genome (AABBDD), with allele range 2-5. These polymorphic SSR markers were used to produce molecular diversity among progeny lines. Cluster analysis of parents and both the populations, showed that two parents were diverse genetically and in both backcrosses progeny lines resembled their respective recurrent parent. Single marker analysis using data revealed that primers on nine chromosomes were associated with grain yield per plant, other yield attributes and yellow rust resistance in both populations. Interpretation: This study showed that a linked marker like Xgwm582 could be a promising tool for breeding wheat with enhanced tolerance to yellow rust resistance. However, growth rates and biomass production provide reliable criteria for assessing the degree of yellow rust resistance and the ability of a plant to withstand it.

Improvement of key agronomical traits in soybean through genomic prediction of superior crosses

AbstractMaximizing yield is very important when developing new cultivars. However, yield must usually be improved jointly with other key traits, which can prove challenging when they are unfavorably correlated. Genomic predictions can facilitate the selection of promising lines among the progeny of crosses, but it may also help in selecting crosses that are more likely to produce improved lines by predicting progeny performance for the various key traits considered jointly. To assess whether genomic predictions of cross performance could help breeders simultaneously improve multiple traits, yield and maturity were predicted for 60,000 soybean [Glycine max (L.) Merr.] crosses. These predictions were then compared with the persistence of 101 biparental crosses throughout the selection process measured as the success in advancing progeny lines through to registration and commercialization. All but 2 of the 22 superior crosses retained by breeders had been predicted to display above‐average mean yield within different maturity windows. At the opposite end of the spectrum, 96.2% of all crosses predicted to produce progeny with a below‐average mean yield within a specific maturity window were eliminated during selection. Our results therefore suggest that by making crosses predicted to produce progeny meeting target requirements for multiple key traits, breeders could either achieve the same genetic gains with fewer resources or invest the same resources on a more promising set of crosses and thereby achieve greater gains.

Leaf tip necrosis and seedling leaf rust resistance conditioned by Lr34 in wheat grown at low temperatures

Wheat leaf rust, caused by Puccinia triticina Eriks., is a common and destructive disease of wheat worldwide. The durable leaf rust-resistance gene Lr34 is typically described as an adult plant resistance gene, which is not expressed at the seedling stage at normal greenhouse temperatures. However, Lr34 is expressed at the seedling stage when plants with Lr34 are grown at low temperatures, i.e. approximately 8°C. Lines and cultivars with Lr34 demonstrate a range of responses from near immunity to intermediate reactions on the primary leaf. The Thatcher-Lr34 near isogenic lines ‘RL6058ʹ (Thatcher*6/PI58548) and ‘RL6091ʹ (Tc*6/Chinese Spring) were resistant to a number of P. triticina virulence phenotypes at the seedling stage when grown under these cool conditions, but were susceptible at typical greenhouse temperatures. A double haploid population from a cross between ‘Thatcher’ and ‘RL6058ʹ, previously genotyped for Lr34, was grown at 8°C and screened for leaf rust response at the seedling stage. The population is segregated by a seedling resistance gene that corresponds to the presence of a resistance allele of Lr34. After extended incubation at cold temperatures, the seedling progeny lines with Lr34 also developed distinct leaf tip necrosis; this phenotype was absent in susceptible plants, similar to their reaction as adult plants. When uninfected plants from this population were grown to the adult plant stage at 10°C, those with the Lr34 resistance allele had extensive leaf necrosis and shrunken, sometimes sterile, spikes.

Identification and characterization of xanthone biosynthetic genes contributing to the vivid red coloration of red‐flowered gentian

Cultivated Japanese gentians traditionally produce vivid blue flowers because of the accumulation of delphinidin-based polyacylated anthocyanins. However, recent breeding programs developed several red-flowered cultivars, but the underlying mechanism for this red coloration was unknown. Thus, we characterized the pigments responsible for the red coloration in these cultivars. A high-performance liquid chromatography with photodiode array analysis revealed the presence of phenolic compounds, including flavones and xanthones, as well as the accumulation of colored cyanidin-based anthocyanins. The chemical structures of two xanthone compounds contributing to the coloration of red-flowered gentian petals were determined by mass spectrometry and nuclear magnetic resonance spectroscopy. The compounds were identified as norathyriol 6-O-glucoside (i.e., tripteroside designated as Xt1) and a previously unreported norathyriol-6-O-(6'-O-malonyl)-glucoside (designated Xt2). The copigmentation effects of these compounds on cyanidin 3-O-glucoside were detected invitro. Additionally, an RNA sequencing analysis was performed to identify the cDNAs encoding the enzymes involved in the biosynthesis of these xanthones. Recombinant proteins encoded by the candidate genes were produced in a wheat germ cell-free protein expression system and assayed. We determined that a UDP-glucose-dependent glucosyltransferase (StrGT9) catalyzes the transfer of a glucose moiety to norathyriol, a xanthone aglycone, to produce Xt1, which is converted to Xt2 by a malonyltransferase (StrAT2). An analysis of the progeny lines suggested that the accumulation of Xt2 contributes to the vivid red coloration of gentian flowers. Our data indicate that StrGT9 and StrAT2 help mediate xanthone biosynthesis and contribute to the coloration of red-flowered gentians via copigmentation effects.

Development and molecular analysis of a novel acetohydroxyacid synthase rapeseed mutant with high resistance to sulfonylurea herbicides

With the increasing promotion of simplified rapeseed cultivation in recent years, the development of cultivars with high resistance to herbicides is urgently needed. We previously developed M342, which shows sulfonylurea herbicide resistance, by targeting acetohydroxyacid synthase (AHAS), a key enzyme in branched-chain amino acid synthesis. In the present study, we used a progeny line derived from M342 for an additional round of ethyl methane sulfonate mutagenesis, yielding the novel mutant DS3, which harbored two mutations in AHAS genes and showed high sulfonylurea resistance. One mutation was the substitution Trp574Leu, as in M342, according to Arabidopsis protein sequencing. The other site was a newly recognized substitution, Pro197Leu. A KASP marker targeting Pro197Leu was developed and reliably predicted the response to sulfonylurea herbicides in the F2 population. The combination of Trp574Leu and Pro197Leu in DS3 produced a synergistic effect that greatly increased herbicide resistance. Analysis of the protein structures of AHAS1 and AHAS3 in wild-type and single-gene mutant plants revealed three-dimensional protein conformational changes that could account for differences in herbicide resistance characteristics including toxicity tolerance, AHAS enzyme activity, and AHAS gene expression.

Vigorous growth and high yielding of rice (Oryza sativa) introgression lines and transformants carrying a PRR37 allele from wild rice O. longistaminata

AbstractWild rice species are expected to possess genes that are potentially useful for rice breeding. Backcross inbred lines (BILs) derived from a cross of a japonica rice ‘Shiokari’ and a progeny line from a cross of a japonica ‘Taichung 65’ and Oryza longistaminata MwM were examined for agronomic traits. Some BILs showed vigorous growth and increased yield relative to ‘Shiokari’. One of such BILs was further analysed using QTL mapping followed by map‐based cloning to identify the causal gene. An allele of OsPRR37, which encodes a pseudo response regulator protein, in O. longistaminata was found responsible for the traits and named OlPRR37. OlPRR37 was expressed more than an OsPRR37 allele from a japonica ‘Nipponbare’ in the heterozygotes of the two alleles. The genomic clone of OlPRR37 and the coding sequences of both OlPRR37 and the ‘Nipponbare’ allele driven by the promoter of OlPRR37 similarly functioned as high‐yielding genes in transgenic rice. Thus, higher expression of PRR37 by the OlPRR37 promoter likely conferred the increased yield. Accordingly, OlPRR37 may be used to improve rice productivity.

Genetic Mapping of Grain Shape Associated QTL Utilizing Recombinant Inbred Sister Lines in High Yielding Rice (Oryza sativa L.)

Grain shape is a key factor for yield and quality in rice. To investigate the genetic basis of grain shape in the high-yielding hybrid rice variety Nei2You No.6, a set of recombinant inbred sister lines (RISLs) were used to map quantitative trait loci (QTLs) determining grain length (GL), grain width (GW), and length-width ratio (LWR) in four environments. A total of 91 medium/minor-effect QTL were detected using a high-density genetic map consisting of 3203 Bin markers composed of single nucleotide polymorphisms, among which 64 QTL formed 15 clusters. Twelve of 15 clusters co-localized with QTL previously reported for grain shape/weight. Three new QTL were detected: qGL-7a, qGL-8, and qGL-11a. A QTL cluster, qLWR-12c/qGW-12, was detected across all four environments with phenotypic variation explained (PVE) ranging from 3.67% to 11.93%, which was subsequently validated in paired lines of F17 progeny and tightly linked marker assay in F10 generation. Subsequently, 17 candidate genes for qLWR-12c/qGW-12 were detected in the 431 Kb interval utilizing bulk segregant analysis (BSA). Among these, OsR498G1222170400, OsR498G1222171900, OsR498G1222185100, OsR498G1222173400, and OsR498G1222170500 were the best candidates, which lays the foundation for further cloning and will facilitate high-yield breeding in rice.

多収水稲品種「きたげんき」後代４系統の収量及び生育特性

多収水稲品種「きたげんき」後代４系統の収量及び生育特性

Identification of Drought Tolerant and Molecular Analysis of DREB2A and BADH2 Genes and Yield Potensial of Lines from Single Crossing Bengkulu Local Rice Varieties

Screening in the seedling stage of 39 progeny of F6 lines to drought stress was carried out in the greenhouse. Drought tolerant and sensitive varieties of IR 20 and Salumpikit, respectively, were used as control plants. The methods for traits identification of leaf curled, dried, and recovery ability after exposure to severe drought for two weeks was following the Standard Evaluation System (SES) developed by IRRI. Molecular analysis to detect the presence of the DREB2A gene was carried out by PCR amplification of genomic DNA using forward- and reverse- oligonucleotide primers of CCTCATTGGGTCAGGAAGAA and GGATCTCAGCCACCCACTTA, respectively, while for BADH2 gene using forward- and reverse- oligonucleotide primers of GGCCAAGTACCTCAAGGCGA and TGTCCCCAGCTGCTTCATCC, respectively. Molecular markers of DREB2A and BADH2 genes were also identified in 39 tested lines with approximately 250 and 2300 bp length, respectively. This study concluded that the progeny of F6 lines generating from the crossing of local varieties of IR7858 and IR148 is the potential to become a drought-tolerant variety of upland rice. Line numbers BKL2 B-2-264-6 and BKL4 B-1-268-10 have a potential yield of more than 12 tonnes/ha. These line has the potential to be developed on rainfed lowland rice or dry land because it has drought resistance.