Cauliflower Production Research Articles

Treatment of cauliflower seeds with product based on bacillus subtilis aiming plant seedling production, development and productivity.

The relation between seed vigor and field performance is not yet fully understood, and it is questionable whether these effects extend to more advanced phenological stages and if they affect crop production. In front of that, the objective of this study was to evaluate the effects on the seedlings and plant production of cauliflower using doses of product based on Bacillus subtilis in seed treatment. The study was conducted in Ilha Solteira city, São Paulo State. The experimental design was a complete randomized design for laboratory analysis and complete randomized blocks for the field stage. Ten treatments were studied in a 2 x 5 factorial scheme with four replications. The treatments consisted of seed treatment of cultivars Sharon and Barcelona with Bacillus subtilis-based product (strain FMT001 containing 3x108 cells cm-3) in five doses (0, 100, 200, 300 and 400 mL per 10 kg of seeds). Seed vigor and crop yield (shoot, root and inflorescence weight, leaf number, inflorescence diameter and yield) characteristics were evaluated. Cultivars averages were compared by Tukey test (p <0.05) and regression for the doses. The results showed that doses of 200 and 400 mL per 10 kg of seeds increased the percentage of strong seedlings of cultivars Barcelona and Sharon, respectively.

Pengaruh Dosis Phospor Dan Pupuk Cair Pada Tanaman Bunga Kol (Brassica Oleracea Var. Botrytis L)

Cauliflower is a vegetable that has commercial value and excellent prospects for public consumption. According to the Central Statistics Agency of the Republic of Indonesia, cauliflower production has decreased from 2019 to 2021, therefore it is necessary to improve maintenance, one of which is by providing Phosphorus fertilizer to increase productivity. This will increase the rate of photosynthesis to produce high productivity and the correct dose of liquid organic fertilizer (POC) to maximize growth in the vegetative and generative phases thereby increasing the yield of cauliflower plants. This research aims to determine the effect of giving various doses of Phosphorus and POC fertilizers on the growth and yield of cauliflower plants. The research was carried out in the village, Girilayu, Matesih, Karanganyar from February to May 2024. Using the Complete Randomized Block Design (RAKL) method consisting of 2 treatment factors and 3 replications. The first factor is the dosage of Phosphorus (P) fertilizer P1: 100 kg/ha, P2: 150 kg/ha, P3: 200 kg/ha. The second factor is the dose of POC (C), C1: 4 cc/L, C2: 8 cc/L, C3: 12 cc/L. The results research showed (1) Giving various doses of Phospor fertilizer had a very real effect on fresh stover, dry stover, plant diameter, plant weight per plant, and crop weight per plot. However, it does not have a real effect on plant height and number of leaves. (2) Giving various doses of POC had a very real influence on fresh stover, dry stover, plant diameter, and plant weight per plant had a real influence on crop weight per plot and had no real influence on plant height and number of leaves. (3) The interaction between treatments had a very real influence on fresh stover, dry stover, and plant weight per plant, and had no real influence on plant height, number of leaves, plant diameter, and weight per plant plot. (4) The highest results were obtained in the branch pruning treatment 3 weeks after planting with an NPK fertilizer dose of 200 kg/ha, namely a plant weight of 11,997.4 grams per plot (26,644 kg/ha).

Effect of integrated nutrient management on the cauliflower yield and soil properties

Cauliflower is one of the most important and preferred vegetables and effective nutrient management is essential to improve production as well as soil properties. Thus, the study was conducted to examine the impact of integrated nutrient management on cauliflower and soil at Ghorahi, Dang district of Nepal. The single-factor experiment was organized employing a Randomized Complete Block Design with three replications. In this study, nitrogen (N) was applied through different sources viz 100% N via urea, 50% N via urea + 50% N via farmyard manure, 50% N via urea + 50% N via pig manure, 50% N via urea + 50% N via vermicompost, 50% N via urea + 25% N via farmyard manure + 25% N via pig manure, 50% N via urea + 25% N via pig manure + 25% N via vermicompost, 50% N via urea + 25% N via farm yard manure + 25% N via vermicompost and 50% N via urea + 50% N via (farmyard manure + pig manure + vermicmpost in 1:1:1). Among different treatments, 50% N via urea + 50% N via vermicompost recorded the highest curd diameter (17.72 cm), curd height (11.57 cm), curd weight (0.76 kg), curd yield per hectare (31.67 t ha-1), soil organic matter (3.31%), total nitrogen (0.157%), available phosphorus (76.78 kg ha-1) as well as available potassium (860.20 kg ha-1). Therefore, it is suggested to apply 50% N via urea and 50% N via vermicompost for better cauliflower production and soil properties.

Production performance of major vegetables in Maharashtra

The present study was restricted to only six crops namely brinjal, tomato, potato, onion, cabbage, and cauliflower which had the highest production in the year 2020-2021 amongst the vegetable crops in Maharashtra. The study was based on secondary data pertaining to the period 2001-2002 to 2020-21.In onion, there was a significant increasing trend of growth in area and production, while in potato significant increasing trend of growth was observed in production and yield, likewise tomato showed a significant increasing trend of growth in area and brinjal showed a significant increasing trend of growth in yield. The area, production, and yield of cabbage and cauliflower were not significant at all.Highest variability in area and production was observed in onion and cabbage, respectively while highest inconsistency of yield was seen in potato. Lest variability in area, production and yield was observed in brinjal. The instability in area was high in cabbage and cauliflower, medium in tomato, potato and onion, and low in brinjal. While in production, it was high in cabbage and cauliflower, medium in potato, tomato, onion and brinjal. Also, in yield, it was medium in potato and onion and low in brinjal, tomato, cabbage and cauliflower.

Pengaruh Pupuk Kandang Ayam dan Pupuk P terhadap Pertumbuhan dan Hasil Kubis Bunga (Brassica oleracea L. var. botrytis)

The aims of this research was to determine the impact of chicken manure and P fertilizer on the development and production of cauliflower. This research was done from February to April 2023 in Pakis, Magelang This study used a completely randomized design (CRD) which includes 2 factors. Factor A uses chicken manure with a measurement of 3 types, such as 200 g, 400 g, 600 g. Factor B uses P fertilizer with a dose of 3 types, such as 20 g, 30 g, 40 g. Each treatment combination was repeated 3 times. The research data using a real level analysis of 5%. If there is a significant difference in the treatment, it will be held using the Duncan Multiple Range Test. The results of the study explained that there was an interaction in the dose of chicken manure with P fertilizer on the parameters of flower circle. The best treatment combination for flower circle parameters was 400g of chicken manure and 40g of P fertilizer. The application of chicken manure with doses of 200g, 400g, and 600g produced a similar effect on the development and production of cauliflower. The application of P fertilizer at a doses of 20g, 30g, 40g have produced the same a similar effect on the growth and yield of cauliflower.

Seedling Growth, Field Performance and Economics of Production of Early Cauliflower as Influenced by Different Sowing Media and Variety under Greenhouse Condition in Assam, India

An experiment was conducted at the greenhouse and in the field of the Experimental Farm, Department of Horticulture, College of Agriculture, Assam Agricultural University, Jorhat for two consecutive years (2018 and 2019) to assess the effect of sowing media and variety on growth of early cauliflower seedling and subsequent performance of seedling in the main field. The results revealed that seedlings raised in different sowing media surpassed the conventional sowing media (soil, sand and farm yard manure) for growth attributes and yield. The media M1 i.e., cocopeat (60): vermiculite (20): perlite (20) recorded the highest seedling emergence whereas minimum days to transplanting and maximum leaf area was recorded in M2 i.e., cocopeat (50): vermicompost (50). Minimum days to 2-true leaf emergence was recorded in both M2 and M3 [cocopeat (50): vermicompost (50): microbial consortium@ 1:100] and M3 recorded the highest seedling height in nursery. Minimum days for 2-true leaf emergence was recorded by variety V2 (CFL1522) while highest leaf area was found in V1(White Diamond). Among interactions, M1V1 recorded maximum emergence, M2V2 recorded minimum number of days for 2-true leaf stage and to transplanting respectively, maximum leaf area in M2V1 and M3V2 produced the tallest seedling. In field, the seedlings that were grown in M3 media in nursery recorded significantly higher value of growth parameters and yield. Variety white Diamond took minimum days for establishment and recorded maximum leaf area index at 30 Days After Transplanting (DAT) as well as at harvest. Though treatment combination, M3V2 recorded the highest curd yield the highest cost benefit ratio was obtained in M3V1 (3.95) and the lowest (2.42) in M1V1. Considering the cost benefit ratio, for producing good quality seedlings of early cauliflower under green house, which will further give best performance in field condition, cocopeat (50): vermicompost (50): microbial consortium (1:100) as sowing media and variety White Diamond can be used in Assam.

Growth, yield, and yield-related response of mid-season cauliflower varieties due to different B levels in Chitwan, Nepal

Boron (B) is a vital micronutrient that many crops, including vegetables, require in small amounts. However, brassica vegetables need B in higher doses. Although Chitwan has the highest area under cauliflower production, the productivity is low as a result of inadequate B fertilization. Cauliflower is a B-sensitive crop, and low B in soil results in poor growth, yield, and yield-related parameters. So, to study the growth, yield, and yield-related response of cauliflower varieties due to different B levels, a field experiment was conducted at the horticulture farm of Agriculture and Forestry University of Chitwan, Nepal. The experiment was laid out in a two-factor factorial randomized complete block design (RCBD) having (B levels: 0.55 kg ha−1, 1.1 kg ha−1, 1.65 kg ha−1, and 2.2 kg ha−1) and (cauliflower varieties; Kathmandu Local, White Top, and Snow Crown), which were replicated thrice. The maximum values of growth parameters like the plant height, leaf length, leaf breadth, plant canopy diameter, and the number of leaves were obtained from B 2.2 kg ha−1. Similarly, the White Top variety produced the tallest plant, the longest leaf, and the highest number of leaves, while the broadest leaf and canopy cover were observed in Snow Crown. The shortest days required for first, 50 % and 100 % curd initiation were observed in B 2.2 kg ha−1, and in the case of varieties, White Top took the least time for first, 50 %, and 100 % curd initiation. Similarly, the highest curd weight, curd diameter, and curd yield were obtained when B was applied at 2.2 kg ha−1. White Top produced the curd with the highest weight, diameter, and yield. A strong positive correlation was observed between curd diameter and leaf length (r = 0.89, p < 0.01) and curd diameter and leaf breadth (r = 0.84, p < 0.01). Curd yield and diameter were also positively correlated with r = 0.78 at p < 0.01. Thus, according to the current findings, it can be recommended that in the mid-season condition at Chitwan, Nepal, application of B at the rate of 2.2 kg ha−1 and the use of the White Top variety should be made for better growth and yield of cauliflower.

Constraints Faced by the Farmers in Production and Marketing of Cauliflower in Haryana, India

Cauliflower (Brassica oleracea var. Botrytis) is one of the most important remunerative vegetable crops grown on commercial scale in India. It is widely grown across India and is a popular vegetable among the people. It is known for its white, tender head or curd, which is used in curries, soups, and for pickling. Cauliflower is a crucial winter vegetable grown in India. A survey was conducted among a group of cauliflower growers to understand the challenges they encounter during cauliflower production and marketing. The objective of the study was to identify the production and marketing constraints faced by the cauliflower growers. Panipat and Sonipat districts were purposively selected due to their significant cauliflower cultivation areas in the state. A total of 200 cauliflower growers were conveniently chosen to gather the necessary data. In Panipat and Sonipat district, the study revealed that the major constraints in cauliflower production included the high cost of cauliflower seeds, expensive fertilizers, labour scarcity during peak periods, and other similar challenges. In terms of cauliflower marketing, respondents reported multiple constraints such as high transportation costs, numerous intermediaries in the marketing process, price fluctuations, lack of awareness about the Bhavantar Bharpayee Yojana (BBY) and its complex procedures, and the higher margins of middlemen. To address these constraints, it is recommended to establish sufficient storage facilities that enable producers to distribute their sales throughout the year. Efforts should be made to ensure the availability of quality seeds and protect producers from experiencing low prices during peak seasons.

Risk assessment of broflanilide for human and non-target terrestrial organisms in cauliflower production

Broflanilide is a newly-developed meta-diamide insecticide, proposed for the control of a wide variety of chewing pests on many crops. In view of the proposed use of broflanilide and its environmental fate, it may be exposed to consumers and non-target organisms, which adversely affect human and the environment. In this paper, a rapid, sensitive and valid UPLC-MS/MS method was established for simultaneous analysis of broflanilide and its two major metabolites, DM-8007 and S (PFP-OH)-8007, in cauliflower. Then, the dissipation behaviors and final residues of broflanilide and its two major metabolites in cauliflower from eight sites with different climatic conditions in China were studied via the described analytical method. In addition, the acute toxicity test of 9.5 % suspension concentrate of broflanilide, broflanilide standard, DM-8007 and S (PFP-OH)-8007 were conducted to non-target terrestrial organisms. Risk assessment for human and non-target terrestrial organisms in cauliflower production was evaluated based on the maximum annual application rates and intervals. The results showed that the highest residue of broflanilide detected in cauliflower samples was all lower than the corresponding MRLs (2 mg/kg) in Japan. Chronic food dietary risk estimates for broflanilide do not exceed 50 % for all the Chinese population groups. Moreover, broflanilide is of low acute toxicity to birds and earthworm, while broflanilide and its metabolites is classified as highly toxic to adult honeybees. Acute risks of broflanilide to birds and earthworms were deemed to be acceptable in a realistic worst-case scenario, while its risk to adult honeybees and ladybug was unacceptable. A protection statement for honeybees and ladybug is required to recognize the high toxicity of broflanilide on related product labels. The study will be conducive to provide guidance for the rational application of broflanilide in cauliflower production.

EFFICIENCY OF CAULIFLOWER CULTIVATION IN A SELECTED AREA OF BANGLADESH

Cauliflower, a pivotal winter crop, is cultivated widely in Bangladesh. This study was conducted to assess the socioeconomic characteristics and to explore the farmers’ efficiency of cauliflower production in Gazipur district of Bangladesh by applying the stochastic production frontier approach. Primary data were collected through a field survey of 60 cauliflower farmers from January to March 2023, using a semi-structured interview schedule. The major findings of this study revealed that 95% of the respondents were aged between 30 and 64 years; 48.33% of households had a small family size; and 86.67% of the respondents’ primary occupation was agriculture. Cauliflower production was profitable. Per hectare total cost, total return, gross margin, net return, and benefit-cost ratio (BCR) were Tk. 286112, 386250, 138218, 100138, and 1.35, respectively. The mean farmer's technical efficiency was 90%, which implies that the household cultivating the cauliflower can increase revenue by 10% at a given level of resources. Cauliflower farmers complained of a lack of quality seed, the high price of quality seed, natural calamities, and attacks of pests and diseases. Cauliflower is one of the important vegetable crops grown by farmers, mainly to generate household income. The study area has tremendous potential for cauliflower production.

Productivity and profitability analysis of cauliflower as sole and intercropping with red amaranth and radish leafy vegetable

By using natural resources and agricultural inputs more effectively, intercropping is a desirable technique to boost crop output and economic return. The present study was conducted to figure out the most lucrative crop mix for an intercropping system of cauliflower with red amaranth and radish leafy vegetable. A randomized complete block design with three replications was used to set up the experiment. Treatments included nine different cropping systems, including sole cauliflower, sole red amaranth, sole radish leafy vegetable, cauliflower-red amaranth intercropping (1:1), cauliflower-leafy radish intercropping (1:1), cauliflower-red amaranth-leafy radish intercropping (1:1:1), cauliflower-red amaranth-leafy radish intercropping (2:1:1), cauliflower-red amaranth-leafy radish intercropping (1:2:1) and cauliflower-red amaranth-leafy radish intercropping (1:1:2) Productivity parameters of three intercrops (cauliflower-red amaranth-leafy radish) were collected and measured based on their yield and yield contributing traits in different stages of their growth upto the final harvest. And equivalent yield and land ratio along with benefit cost ratio were analyzed to check their profitability. Result illustrated that cauliflower, red amaranth and leafy radish produced the highest yield of 25.4, 13.5 and 18.6 tha-1, respectively when cultivated as a sole crop. However, when all of the three vegetables were grown as intercropping in different cropping system, cauliflower with red amaranth and leafy radish (1:1:1) produced the highest yield (33.2 tha-1) followed by cauliflower-red amaranth-radish intercropping (1:2:1) and cauliflower-red amaranth-radish intercropping (2:1:1) with the yield of 30.0 t ha-1 and 29.8 tha-1. After assessing the productivity and economic return, cauliflower with red amaranth and leafy radish (1:1:1) obtained the highest gross return (997102 Tk ha-1) and net return (512102 Tk ha-1) using the highest land equivalent ratio (2.0) followed by 900900 Tk ha-1 and 435900 Tk ha-1, respectively in the cropping system cauliflower-red amaranth-radish intercropping (1:2:1). The present study concluded that intercropping leafy vegetables (red amaranth and leafy radish) and cauliflower boosted overall productivity and economic return more than sole intercropping cauliflower.

Expression analysis of key curding and flowering genes in diverse thermosensory groups of cauliflower

Cauliflower is a highly thermosensitive crop with complex developmental transitions that are intricately regulated by genotype-specific, environment-responsive genetic mechanisms. Understanding the genetic behavior of key genes is crucial for mitigating temperature factors in cauliflower production. Substantial differences in expression patterns were observed among the cauliflower genotypes. During curd initiation, Pusa Sharad displayed notable upregulation of BoREM1, CCE1, BoFT, and BoVRN2 genes; Pusa Shukti showed increased expression of BoREM1 and BoFUL-d; and in Pusa Snowball Kt-25, BoREM1 and CCE1 genes were remarkably upregulated. The expression of BoLFY, BoCAL, and BoTFL1 genes was downregulated in all three genotypes at curd initiation. Interestingly, the expression of all genes was relatively lower in the temperate genotype Pusa Snowball Kt-25 compared to Indian types. Increased expression of BoREM1, BoLFY, and BoFUL-d genes at curd loosening in Pusa Sharad indicated their probable association with curd to bolting stage transition. The study holds the potential for further understanding the genetic regulation of curding and flowering, to expand the thermosensitive plasticity of cauliflower genotypes.

Economic Analysis of Main Season and Off-season Vegetable Production: A Case Study in Dhading District, Nepal

This survey research was conducted in Benighat Rorang Rural Municipality of Dhading district of Nepal in 2022. Main objective of the study was to analyze the profitability of main season and off-season production of selected vegetables in Dhading district. Multistage sampling technique was used to select 60 respondents (commercial vegetable farmers) who were interviewed face-to-face administering a semi-structured questionnaire to collect primary data. Though the average cost of production of cauliflower and tomato in off-season was higher than in main season, net incomes from these crops in off-season were higher than in main season (p&lt;0.01). Benefit-cost ratios of cauliflower and tomato in main season (2.09 and 1.13 respectively) were lower than in off-season (2.78 and 1.47 respectively). Results indicated that growing vegetables in off-season is more profitable than in main season. The major problems perceived by the commercial vegetable farmers in the study area were high fluctuation in market price of vegetables followed by disease and insect pest damage. Study suggests that off-season vegetable production can be used as better alternative for income generation taking advantage of premium price. Government support to off-season vegetable production could make this business more profitable and sustainable.

Pengaruh Pemangkasan Cabang Lateral dan Dosis Pemberian Pupuk NPK pada Tanaman Bunga Kol (Brassica Oleracea Var. Botrytis L)

Cauliflower is a vegetable that has commercial value and good prospects, especially for public consumption. According to the Central Bureau of Statistics of the Republic of Indonesia cauliflower production has decreased from 2019 to 2021, it is necessary to improve maintenance, one of which is by pruning lateral branches to increase productivity, thereby increasing the rate of photosynthesis to produce high productivity and the right dose of NPK fertilizer to maximize growth in the vegetative and generative phases thereby increasing the yield of cauliflower plants. This study aims to determine the effect of pruning lateral branches and doses of NPK fertilizer on the growth and yield of cauliflower.&#x0D; The research was conducted in the hamlet of Jinarum, Girilayu, Matesih, Karanganyar from July to September 2022. The research method used a Completely Randomized Block Design (RAKL) consisting of 2 treatment factors and 3 replications. The first factor is lateral branch pruning P0: without pruning, P1: pruning lateral branches 3 WAP, P2: pruning lateral branches 5 MST. The second factor is the dose of NPK fertilizer with doses of N1: 150 kg/ha, N2: 200 kg/ha, N3: 250 kg/ha.&#x0D; The results showed (1) Pruning lateral branches had a very significant effect on fresh stover, dry stover, crop diameter, crop weight per plant, and crop weight per plot. However, it did not have a significant effect on plant height and number of leaves. (2) NPK fertilizer doses had a very significant effect on fresh stover, dry stover, crop diameter, and crop weight per plant, had a significant effect on crop weight per plot, and had no significant effect on plant height and number of leaves. (3) The interaction between treatments had a very significant effect on fresh stover, dry stover, and crop weight per plant, and had no significant effect on plant height, number of leaves, crop diameter, and crop weight per plot. (4) The highest yield was obtained in the pruning treatment 3 weeks after planting with a dose of NPK fertilizer of 200 kg/ha, namely the crop weight of 11,997.4 grams per plot (. 26,644 kg/ha).&#x0D; Kata kunci : pruning lateral branches, the dose of NPK fertilizer

Exploration and Characterization of Flower Cabbage (Brassica oleracea Var. Botrytis) In Banuhampu District

Cauliflower (Brassica oleracea var. botrytis) is one of the vegetable commodities with high economic value. Cauliflower production in Indonesia reached 204,328 tonnes in 2020. This research was conducted from January to May 2022 in 3 sub-district in Banuhampu district. This study aimed to identify the morphological characters and growth diversity of cauliflower from Banuhampu district. The research method used is a survey method with purposive sampling consisting of two stages of activity, exploration and characterization. Morphological characterization was carried out on leaves and curds. The exploration has been carried out has succeed in characterizing 18 sampel of cauliflower which show narrow to broad phenotypic variability in the characters of leaves and curds, while the analysis of the level of similarity between samples obtained a coefficient value of 42 to 100%.

Response of Different Levels of Nitrogen on Growth and Yield of Cauliflower (Brassica oleracea var. botrytis) Varieties

Nitrogen is the major limiting nutrient in commercial cauliflower production. The effects of six nitrogen doses (0, 70, 80, 90, 115, 130 kg N/ha) were evaluated in two cauliflower varieties (Snow Mystique and Khumal Jyapu) at the Institute of Agriculture and Animal Science, Lamjung Campus from September 2018 to January 2019. This experiment was carried out in a two factorial Completely Randomized Design with twelve treatments and five replications. FYM (25 t/ha), full dose of phosphorus (80 kg/ha) and potassium (60 kg/ha), and half dose of nitrogen were applied as a basal dose and the remaining half dose of nitrogen was applied in two equal split doses at 30 DAT and 60 DAT. The application of 130 kg N/ha gave superior results in plant height (26.32 cm), plant spread (4103 cm2), leaf area (264 cm2), stem diameter (1.96 cm), number of leaves (20.70), root length (26.26 cm), girth of curd (49.46cm) and adjusted yield (21.78 ton/ha). Similarly, the performance of the Snow Mystique variety was significantly superior as compared to Khumal Jypau in terms of growth and yield. Therefore, the combination of an optimum level of nitrogen (130 kg N/ha) and hybrid variety (Snow Mystique) could be recommended for the commercial production of cauliflower.

The response of growth and production in cauliflower with different doses of Paitan liquid organic fertilizer

Organic fertilizers can be used in cauliflower cultivation as liquid organic fertilizer from Paitan. Paitan is a weed with organic matter and nutrients that can increase soil and plant fertility. The response of growth and production of cauliflower was examined with different doses of paitan liquid organic fertilizer. The randomized block design in this research is five groups with five treatments and then tested applying the Duncan New Multiple Range Test at a significance level of 5 % and 1 % utilizing SAS. Paitan liquid organic fertilizer doses given include treatment 20 ml, 40 ml, 60 ml, and 80 ml paitan/plants. Parameters observed on cauliflower were plant height, amount of leaf, leaf width, flower diameter, flower production weight, and flower weight. The findings of the research indicated no significant effect of liquid organic fertilizer on cauliflower plant height, the amount of leaf, leaf width, and flower diameter. The best impact of this research on cauliflower is the weight of flower production and flower weight treatment doses of 80 ml paitan liquid organic fertilizer.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

POTENTIAL OF COLI FRUIT AS ANIMAL FEED IN MOA DISTRICT SOUTHWEST MALUKU

This study aims to determine the distribution area and population of Koli trees on Moa Island and to determine the amount of fruit and mesocarp juice in one production. This research used a survey method, simple random interviews of 30 respondents and direct observation at the research location. Research variables: Respondent profile: age, gender, education level and occupation. Coli tree population structure. Calculating the production of cauliflower and mesocarp fluid. The results of the study: Respondents' age was 23-64 years old, male sex (100%), education level of respondents: Elementary school graduates (SD) 70%, respondent's main occupation: farmer 93.33%, sideline: breeder 80.00%. Koli tree production area/sample village: 16,000m2/1.6Ha consisting of 4 lanes, area of each lane 4,000m2/0.4Ha, consisting of 4 plots, area of each plot: 1,000 m2/0.1Ha, number of coli trees per plot : 8 trees, number of koli trees in the production land area/village: 8×4×4=128 trees. Coli fruit production for 1 harvest is 20 bunches × 20 fruit = 400 fruit/tree, multiplied by the number of koli trees from one village: 400×128 = 51,200 fruit harvested 2/year: 51,200×2 = 102,400 fruit/village/year, liquid mesocarp/fruit: 260grams and 446grams. Mesocarp fluid/village: 446 gram×102,400 fruit = 45,670,400 gram/45,670.4 Kg/45.7 Ton (large fruit), 260 gram×102,400 fruit = 26,624,000 gram/26,624 Kg/26.62 Ton (small fruit). 1 year mesocarp fluid production in 3 sample villages is 79.86-137 tons/year.

Effect of Fertility Levels and Boron on the Development and Production of Cauliflower

A field experiment consisting five levels of fertility and four levels of boron in RBD with three replications was conducted at Horticulture Farm, SKNAU, (Jaipur) during Rabi season. The findings showed that different levels of fertility used to have a significant impact on the growth, yield of cauliflower. Plant height at 30 and 60 DAT, the number of leaves per plant at 30 and 60 DAT and leaf area were all highest when 75% RDF through inorganic fertilizers and 25% RDF through vermicompost were applied. Also, it was found that the application of 50% RDF using inorganic fertilizers and 50% RDF through vermicompost treatment resulted in the highest curd yield per plot and curd yield per ha (190.89 q/ha).