Weed Problems Research Articles

Mapping hyperspectral NIR images using supervised self-organizing maps: Discrimination of weedy rice seeds

Weedy rice is one of the most problematic weeds in rice-growing regions, particularly in Southeast Asia. Unlike other types of weeds, it is extremely difficult to distinguish weedy rice from cultivated rice directly from paddy seeds as they exhibit common morphological features. As such weed management can be a difficult, time-consuming, and inaccurate process that is often carried out manually. This study offers a novel classification approach based on an artificial neural network (ANN), utilizing self-organizing maps (SOMs), to directly discriminate weedy rice using the near-infrared (NIR) hyperspectral imaging (HSI) technique. The physical attributes, thermal behavior, and chemical profiles of the weedy and cultivated rice were thoroughly investigated by a range of analytical techniques, including optical microscopy, scanning electron microscopy, thermogravimetric analysis, and direct analysis in real-time mass spectrometry (DART-MS). For direct sample analysis by HSI, a global self-organizing map was generated with optimized parameters (scaling value and map size). The color indices (Red, Green, Blue values) of the sample image were defined to obtain a color ratio that can be used to classify unknown samples. The optimal threshold for classification was carefully determined using a receiver operating characteristic (ROC) curve. Performance metrics (sensitivity, specificity, precision, accuracy, and misclassification error) were used to evaluate the performance of the model. Classification accuracies of 98% (Weedy vs PL2) and 88% (Weedy vs RD49) were obtained with balanced sensitivity and specificity. The classification was assessed from the whole sample image, which was completely independent of the selected region of interest. As far as we know, this is the first instance where SOMs have been utilized to appraise seed quality by means of authentic HSI images.

Widespread Occurrence of Glyphosate-Resistant Hairy Fleabane (Erigeron bonariensis L.) in Colombia and Weed Control Alternatives

Glyphosate, the most applied herbicide globally, offers effective non-selective and post-emergent weed control. Evolution of herbicide-resistant weeds is commonly associated with the recurrent application of herbicides with the same mode of action. Native to South America, hairy fleabane (Erigeron bonariensis L.) is the most problematic weed in this sub-continent and has previously been confirmed glyphosate resistant. This research aimed at characterizing glyphosate-resistant populations, thus estimating the frequency of resistance, resistance levels and identifying effective herbicide alternatives to control glyphosate-resistant populations. Glyphosate resistance characterization was initially conducted on ten suspected populations collected in plantain, banana, cassava, passionfruit, papaya, and drybean crops. Two resistant populations were selected and further characterized through dose-response tests; in addition, response to alternative herbicides (paraquat, glufosinate, 2,4-D, pyraflufen-ethyl, and mesotrione) was determined. All surveyed hairy fleabane populations survived (≥80% of individuals) the recommended glyphosate rate of 1080 g ae ha−1; conversely, five populations collected from non-cropping areas were effectively controlled at this same rate. Dose-response tests estimated resistance factors of 3.15- to 22.3-fold versus the most susceptible population. Interestingly, resistance profile and dose-response tests detected hormesis responses at field-recommended rates. The most effective herbicide alternatives to control glyphosate-resistant hairy fleabane were pyraflufen-ethyl and mesotrione.

Seed biology of alkali barnyardgrass (Echinochloa crus-galli var. zelayensis) and junglerice (Echinochloa colona) for improved management in direct-seeded rice

AbstractAlkali barnyardgrass [Echinochloa crus-galli var. zelayensis (Kunth) Hitchc] and junglerice [Echinochloa colona (L.) Link] are problematic annual weeds in direct-seeded rice (Oryza sativa L.) fields in China. The emergence ecology of the two weed species may differ in response to environmental factors. Laboratory and screenhouse experiments were conducted to evaluate the effects of light, burial depth, mulching with wheat (Triticum aestivum L.) residue, and time and depth of flooding on the emergence of the two weed species collected from Nanjing, China. Light strongly increased seed germination. Under dark conditions, E. crus-galli seed germination (85%) was higher than that of E. colona (70%). The seeds of both species exhibited the greatest germination (90% for E. crus-galli and 80% for E. colona) when sown on the soil surface, and emergence decreased with increasing soil burial depth. Burial depths of 2.2 and 1.4 cm reduced seedling emergence by 50% for E. crus-galli and E. colona, respectively. No emergence was found at a depth of 6 cm. The seedling emergence for E. colona was lower than for E. crus-galli at the same soil burial depth. Mulching with wheat residue considerably reduced the seedling emergence and aboveground biomass of both species. The inhibitory effect of mulching with wheat residue on E. colona was more notable than on E. crus-galli. Early and deep flooding significantly suppressed the emergence, height, and biomass of E. crus-galli and E. colona, especially E. colona. The results gained from this study could provide fundamental ecological knowledge for managing Echinochloa species in direct-seeded rice systems.

Dominant weed species exert significant impacts on hazelnut orchards and rural livelihoods

Turkey contributes ~76% towards global hazelnut production; thus, it has significant socioeconomic impacts in the country. However, product losses due to weeds and challenges faced during harvesting impair hazelnut production. Therefore, weed management in hazelnut orchards is one of the major challenges faced by hazelnut producers in Turkey. Multiple complaints are received regarding weed spreading in hazelnut orchards of Turkey to different institutes. This study aimed at determining the dominant weed taxa faced by hazelnut producers and providing basic data for the precautionary measures and management strategies that could be opted to manage weed spreading. For this purpose, face-to-face interviews were conducted with the hazelnut producers between 2018 and 2020. Weed species causing significant problems in hazelnut orchards were identified according to their life forms, morphological and biological characteristics and defined as “dominant/robust” species. Considering this definition, the hazelnut producers complained of 32 taxa belonging to 19 families in hazelnut orchards. The identified taxa were compared with the earlier reported taxa from hazelnut orchards in the Black Sea region (the primary growing region of hazelnut production in Turkey) and this comparison revealed 14.81–38.89% similarities. In addition, it has been determined that the most problematic weeds in hazelnut orchards are Calystegia sepium, Coronilla varia, Dioscorea communis, Hedera spp., Rubus spp. The results showed that significant changes occurred in hazelnut fields over time and the main reason for this change was the dominant weeds. For this reason, it is recommended to consider the management strategies according to the dominant weed species in the hazelnut production areas. The results also provide empirical data for the development of effective management strategies in the region.

Evaluation of Herbicides for the Control of Yellow Nutsedge (Cyperus esculentus L.) and Johnsongrass (Sorghum halepense L.) Under Non-Crop Conditions

Yellow nutsedge (Cyperus esculentus L.) and Johnsongrass (Sorghum halepense (L.) Pers.) are two of the most difficult weeds to control mostly due to their asexual reproduction. Yellow nutsedge reproduces through underground tubers and Johnsongrass through rhizomes. In addition, Johnsongrass is a problematic weed because of its competitive nature due to its C4 carbon fixation pathway metabolism. It typically grows to 1.8 to 2.5 m tall and can severely reduce yields in corn, cotton, soybeans, and other crops. Two separate field studies were conducted in 2020 at the Delta Research and Extension Center in Stoneville, Mississippi to evaluate the effectiveness of various herbicides on yellow nutsedge and Johnsongrass control in a non-crop scenario. The experiments were conducted as randomized complete block designs with 7 and 11 herbicide treatments for yellow nutsedge and Johnsongrass, respectively. All treatments were replicated three times. Research plots were 4-m wide and 6-m long with 3-m alleys between replications. The 7 yellow nutsedge herbicide treatments consisted of trifloxysulfuron, bentazon, halosulfuron, halosulfuron + thifensulfuron, glyphosate, glufosinate, and paraquat. The 11 Johnsongrass herbicide treatments included clethodim, quizalofop, fluazifop, cyhalofop, fenoxaprop, pinoxaden, glufosinate, glyphosate, clethodim + glyphosate, glufosinate + clethodim, and glufosinate + clethodim + glyphosate. Glyphosate and halosulfuron + thifensulfuron provided only 77 and 72% control of yellow nutsedge by five-weeks after application (WAA). On the other hand, glyphosate, clethodim + glyphosate, glufosinate + clethodim, and glufosinate + clethodim + glyphosate provided 99 to 100% Johnsongrass control 4 WAA. Johnsongrass regrowth evaluation was assessed 3-weeks after the experimental area was mowed. Johnsongrass regrew in every herbicide treatment except for glyphosate which was the only treatment that provided 100% Johnsongrass control with no-regrowth.

Herbicide‐resistant barnyardgrass (Echinochloa crus‐galli) in global rice production

AbstractBarnyardgrass (Echinochloa crus‐galli (L.) Beauv.), an annual species of the family Poaceae, is a major weed problem in rice‐producing countries throughout the globe. Synthetic herbicides can effectively control this grass in rice paddies, but the development of resistant biotypes after the continuous use of the same active ingredients has led to low herbicide efficacy and yield losses. In this review, a summary of resistant‐barnyardgrass cases in global rice production is reported based on data from the International Herbicide‐Resistant Weed Database. The first case of resistant barnyardgrass in rice paddies was to the photosystem‐II inhibitor propanil in the late 1980s. Eighty‐five (85) out of 116 cases in the period from 1986 to 2022 refer to resistant barnyardgrass (E. crus‐galli var. crus‐galli, E. crus‐galli var. formosensis and E. crus‐galli var. zelayensis) in 16 countries. Barnyardgrass has been found resistant to acetolactate synthase (ALS) inhibitors (34 cases), acetyl‐CoA carboxylase (ACCase) inhibitors (23 cases), photosystem‐II inhibitors (11 cases), auxin mimics/cellulose biosynthesis inhibitors (9 cases), very long chain fatty acid inhibitors (6 cases), and microtubule assembly inhibitors (1 case). The majority of all resistance cases reported to the active ingredients penoxsulam, bispyribac‐sodium, and imazamox (ALS inhibitors), cyhalofop‐butyl and fenoxaprop‐ethyl (ACCase inhibitors), propanil (photosystem‐II inhibitors), and quinclorac (auxin mimics/cellulose biosynthesis inhibitors). Although target‐site resistance with specific mutations has been identified, non‐target site resistance mainly through herbicide detoxification is also of great concern increasing the chance of multiple herbicide resistance evolution. Rotation of herbicides should be adopted concerning the modes of action used as well as the application methods to mitigate resistance evolution of this weed in rice paddies.

Abutilon theophrasti’s Resilience against Allelochemical-Based Weed Management in Sustainable Agriculture – Due to Collection of Highly Advantageous Microorganisms?

Abutilon theophrasti Medik. (velvetleaf) is a problematic annual weed in field crops which has invaded many temperate parts of the world. Since the loss of crop yields can be extensive, approaches to manage the weed include not only conventional methods, but also biological methods, for instance by microorganisms releasing phytotoxins and plant-derived allelochemicals. Additionally, benzoxazinoid-rich rye mulches effective in managing common weeds like Amaranthus retroflexus L. have been tested for this purpose. However, recent methods for biological control are still unreliable in terms of intensity and duration. Rye mulches were also ineffective in managing velvetleaf. In this review, we present the attempts to reduce velvetleaf infestation by biological methods and discuss possible reasons for the failure. The resilience of velvetleaf may be due to the extraordinary capacity of the plant to collect, for its own survival, the most suitable microorganisms from a given farming site, genetic and epigenetic adaptations, and a high stress memory. Such properties may have developed together with other advantageous abilities during selection by humans when the plant was used as a crop. Rewilding could be responsible for improving the microbiomes of A. theophrasti.

Population Dynamics of Digitaria sanguinalis and Effects on Soybean Crop under Different Glyphosate Application Timings

Large crabgrass (Digitaria sanguinalis) is one of the most problematic weeds in summer crops in Argentina. Emergence throughout the season of several cohorts allows the weed to escape postemergence control. Demographic models are useful tools to understand and compare the effect of different agronomic management decisions on weed population growth, as well as to identify critical functional stages that affect population growth rates. The objectives of this work were (i) to study population dynamics of D. sanguinalis in soybean, (ii) to determine the effect of glyphosate application timing on weed demographic parameters and soybean yield losses, and (iii) to evaluate the effect of weed density on soybean yield loss. A field experiment was conducted in two locations, in a completely randomized design with three replicates. Treatments included a control without glyphosate and glyphosate applied at soybean stages V4 or R1. The demographic stages (initial seedbank, seedlings, and adult plants) and parameters (establishment, survival, and fecundity) were estimated. Reproductive organs were evaluated in each cohort, including raceme per plant, spikelets per raceme, and seeds per spikelet. Weed and crop biomass and yield crop were assessed at harvest. Three cohorts were identified, the first of which emerged in November and contributed 93% of the total seedlings and 71% of the total adults. Glyphosate applied at V4 reduced the survival rate of the first cohort, as well as the total shoot biomass and the fecundity rate, increasing the biomass and crop grain yield. Both application timings affected tillers per plant, racemes per tiller, and fertile spikelets per raceme. Glyphosate at R1 did not effectively reduce weed competition, but reduced seed production as application at V4. Yield losses estimated with the model of the rectangular hyperbola according to weed density showed a yield loss at low densities (I) of 18%, and a maximum yield loss (A) of 82%. To avoid yield losses, herbicide applications targeting the first cohort are more effective than later applications targeting subsequent cohorts. However, at both times glyphosate applications reduced the number of seeds entering the seedbank, and therefore the population growth rate.

Weed seed bank as affected by tillage, residue, and fertilization management under sweet corn‐wheat cropping sequence in Iran

AbstractSoil weed seed bank is an important factor determining above‐ground floristic composition and weed density in agricultural systems. The quantitative and qualitative measures of weed seed bank can help growers to predict the extent to which they are facing weed problems. Along with tillage, crop residues can affect the fate of weeds in the upcoming crops. To investigate such effects, we compared the effects of tillage systems [conventional tillage (CT), reduced tillage (RT), and no tillage (NT)], wheat residue retention, and nitrogen (N) rates (0, 69, 138, and 207 kg N ha−1) on depth‐related characteristics of the weed seed bank under a sweet corn‐wheat sequence during 2014–2015 growing seasons in Shiraz, Iran. Soil bank was not affected by tillage systems but tended to be slightly higher under RT. The highest (898 seeds m−2) and lowest (322 seeds m−2) weed population at 0–10 cm depth were found when 138 kg N ha−1 in 2015 and 207 kg N ha−1 in 2014 were applied. Species richness and diversity were higher under NT and RT practices at the top layer, but CT system was more diversified at deeper depths. They were higher when crop residues were retained as well. Barnyard grass (Echinochloa crus‐galli [L.] Beauv), common lambsquarter (Chenopodium album L.), common purslane (Portulaca oleracea L.), field bindweed (Convolvulus arvensis L.), flixweed (Descoreinia sofia [L.] Webb. & Berth.), henbit (Lamium amplexicaule L.), pigweeds (Amaranthus spp.), and stinking goosefoot (Chenopodium vulvaria L.) were the most common weeds found in all tillage systems and soil depths. Grasses were relatively lower than broadleaves regardless of treatments. Weed seed bank was mostly affected by weather conditions than treatments in this short‐term experiment.

Effect of depth of flooding on growth and fecundity of fall panicum (Panicum dichotomiflorum)

AbstractFall panicum is the most prevalent and problematic weed in rice in Florida. Outdoor studies were conducted in 2021 to determine the effect of flooding on fall panicum growth and its ability to produce and develop panicles. Fall panicum at the two- to four-leaf and four- to six-leaf stages of development were flooded in stock tanks maintained at flooding depths of 0, 10, 15, 20, and 30 cm for 56 d. Plant height, number of tillers and leaves, leaf area, shoot biomass, root biomass, and panicle branches for both fall panicum leaf stages of development decreased with increasing flooding depth. Fall panicum flooded at the two- to four-leaf stage survived flood depth of 15 cm, whereas plants flooded at the four- to six-leaf stage survived and emerged from a flood depth of up to 20 cm. The 10-cm flood depth resulted in the tallest plants with more leaves, tillers, and leaf area for both growth stages. The probability of fall panicum survival and ability to produce panicles decreased as flood depth increased. Flood depth required for 50% survival for four- to six-leaf-stage plants was estimated to occur at 14 cm, whereas that for plants at the two- to four-leaf stage occurred at 12 cm. The flood depth required to reduce panicle branch production by 50% was estimated to be 15 and 20 cm for two- to four-leaf, and four- to six-leaf-stage plants, respectively. These results show that flooding >10 cm is required to significantly reduce fall panicum survival and ability to produce panicles. Since flood level in rice is usually maintained at an average of 10 cm, chemical weed control will be important to supplement flooding for effective control of fall panicum in rice.

Utilizing germinability thresholds for optimizing stale seedbed applications to control red rice (Oryza spp.) in California rice cropping systems

Abstract“Weedy” red rice is a problematic weed with phenotypic similarities to cultivated rice. Limited herbicide availability has driven a need for nonchemical control options for managing this pest. One preplanting strategy that is being explored is the stale seedbed methodology, which aims to maximize soil seedbank withdrawals via germination. This technique is adapted in rice by flooding a field, waiting for germination and emergence of weed seedlings, and completing the method with a mechanical or chemical control application. Optimization of this process is dependent on maximizing weed seed germination, which is primarily influenced by both temperature and moisture availability. Germinability across a range of these factors is not well understood in California red rice. Thus, this study aimed to determine germinability of California red rice accessions under various temperature and water potential treatments. Previously described red rice accessions 1, 2, 3, and 5, along with ‘M206’, a common California rice cultivar, were exposed to temperatures from 10 to 40 C in 5 C increments in combination with water potentials of 0, −0.2, −0.4, or −0.8 MPa until either germination or weed seed decay occurred. Statistical analysis indicated a three-way interaction between accession, temperature, and water potential. Germination reached 95% or greater when seeds were exposed to temperatures from 20 to 35 C in combination with 0 or −0.2 MPa. Germination was lowest when seeds were water stressed (−0.8 MPa) and when temperatures were colder than 20 C or warmer than 35 C. The ‘M206’ cultivar was utilized for comparison and demonstrated cold tolerance by germinating at 10 C, whereas weedy accessions 1, 2, and 3 did not. When temperatures were at or above 15 C, however, ‘M206’ germinated less often compared with all weedy accessions. Historical preplant temperatures in this region align with those required for weedy rice germination. Thus, the stale seedbed methodology is a viable strategy in years when ample floodwater is available.

Sensitivity of herbicide-resistant rigid ryegrass (Lolium rigidum) populations to cinmethylin, a new herbicide site of action

AbstractRigid ryegrass (Lolium rigidum Gaudin) is the most problematic weed in Australia, with evolved resistance to multiple herbicide sites of action. Selection pressure by cinmethylin (Group 30, a fatty-acid thioesterase inhibitor) has been limited, because few populations have been exposed to the herbicide since its introduction in 2019. In this study, we examined the sensitivity of L. rigidum populations to this new herbicide. From a screening of almost 500 field populations in 2020, 28 potentially resistant populations were further investigated in a dose–response experiment. Seedlings from five populations surviving treatments of 250 or 375 g ai ha−1 cinmethylin were grown to maturity and seeds were harvested. The level of resistance found among the five putative-resistant parental populations of L. rigidum was negligible. In one population, one round of selection with cinmethylin resulted in a 2-fold increase in the lethal dose causing 50% mortality in the progeny population, although this dose was still only one-sixth of the recommended field rate of cinmethylin. Having a unique site of action, cinmethylin is a viable preemergence herbicide option to control existing multiple-resistance populations of L. rigidum. Comprehensive field monitoring and recurrent selection studies under controlled environmental conditions are needed to better ascertain the risk of L. rigidum evolving a high level of resistance to cinmethylin, although current data suggest that this risk is relatively low.

Sobrevivência e distribuição do banco de sementes de arroz daninho após 22 anos de cultivo de arroz em diferentes sistemas

ABSTRACT: Weedy rice (Oryza sativa L.) is the most problematic weed in rice fields due to the few control management alternatives to control it, because of the genetic similarity with the crop. Different cropping systems (regarding soil preparation before sowing) have been used as options to control the persistence and emergence of the weed seedbank. Therefore, the objective of this study was to evaluate the longevity and vertical distribution of weedy rice seeds in the soil seedbank after 22 years of different rice cropping systems. Data was analyzed as a two-way factorial, with cropping systems carried out for 22 years [no-tillage (NT), conventional tillage (CT), wet direct-seeded (WDS)] as one factor and sampling depth (0-2, 2-5, 5-10 and 10-20 cm) as the other factor. The number of whole and deteriorated seeds per m-2 were assessed, as well as the viability (%). No effect between the systems were detected up to 5 cm, however at 5-10 cm CT and WDS showed higher amount of seeds, and WDS at 10-20 cm. As the sampling depth increased, NT showed fewer amount of seeds, while less reduction of the soil seedbank was observed in WDS. CT and WDS spread viable seeds in the soil profile from 0 to 20 cm depth. After 22 years there are viable weedy rice seeds up to 10 cm of depth in the three cropping systems and there is no difference among them up to 5 cm of depth, demonstrating the serious problem of the seedbank for this species.

Effect of rice husk mulching on germination percentage, yield and economics of pea (Makhyatmubi) Pisum sativum L.

Mulch can effectively minimize water vapour loss, soil erosion, weed problems and nutrient loss. Modification of soil microclimate by mulching favours seedling emergence and root proliferation. Organic mulches add nutrients to the soil when decomposed by microbes in the soil. A field experiment was conducted during the rabi season of 2018 and the treatments comprised of one control (T1 -no mulch) and six levels of rice husk mulching viz, T2 (10q/ha), T3 (20q/ha), T4 (30q/ha), T5 (40q/ha), T6 (50q/ha)and T7 (60q/ ha) were laid out in RBD with three replications. The application of rice husk mulching 60q/ha (T7 ) had significant effect on the germination percentage of the crop. The highest number of pods, pods per plant and longest pod length were recorded in the treatment of rice husk mulching with 60q/ha (T7 ). The test weight was found to be non-significant. With respect to economics of yield production in pea, higher gross returns, net returns and returns per rupee invested (B:C ratio) was obtained by 60q/ha rice husk mulching as compared to the other treatments. From the present investigation it was observed that pea was found to perform better in rice husk mulching of 60q/ha.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

Amaranthus hybridus L. RESISTANT TO GLYPHOSATE AND CHLORIMURON IN PARAGUAY

Amaranthus species are extremely problematic weeds due to their aggressiveness and resistance, being Amaranthus palmeri S. Watson, Amaranthus retroflexus L., Amaranthus tuberculatus (Moq.) J. D. Sauer, and Amaranthus hybridus L. prominent worldwide. The present research aimed to study A. hybridus populations in Paraguay where the use of glyphosate and chlorimuron herbicides presented management challenges. This research was conducted in the municipalities of Corpus Christi and Hernandarias, Paraguay, in 2016, 2017, 2018, 2019, and 2020. Weed seeds with resistance indicators were collected, cultivated, and following a screening process, cultivated for seed production (heritability up to F2), and the seeds were collected to obtain the herbicide dose-response curve. The herbicides glyphosate and chlorimuron were tested in portions of 1-8, 1-4, 1-2, 1, 2, 4, and 8 times the recommended dose on the package inserts (720 g acid equivalent (ae) ha 1 and 20 g active ingredient (ai) ha1, respectively). Among the A. hybridus populations evaluated in Paraguay, biotype from Hernandarias with multiple resistance to ALS-inhibiting (HRAC 2) and EPSPs-inhibiting (HRAC 9) herbicides, and biotype from Corpus Christi with resistance to ALS-inhibiting herbicides (HRAC 2) were found. Therefore, rotation and combination of herbicides, as well as integration with non-chemical measures, are essential to control and prevent selection of resistant biotypes. Studies aimed to develop integrated weed management plans are essential for effective control. In countries like Paraguay, this becomes imperative because of the lack of research on this topic.

Characterization of acetolactate synthase gene (ALS) in Echinochloa colona (L.) Link., a hexaploid weed species

Junglerice (Echinochloa colona) is one of the most problematic weed species in rice fields in Colombia. Herbicides inhibitors of the enzyme acetolactate synthase (ALS) have been widely used to control junglerice and other grass species. ALS inhibitors have the highest reports of resistance worldwide, and Colombia has recent reports of ALS resistance in E. colona. The timely and accurate detection of resistance sources is imperative for mitigating and managing herbicide resistance. However, for E. colona there are no published [...]

Effect of Black Plastic Mulching on Yield of Tomato

The use of polyethylene mulch has increased dramatically in the last few years because they have many benefits viz., increase in soil temperature especially in early spring, reduced weed problem, moisture conservation and increased crop yields. Field experiments were conducted to maximize total yield of tomato (Lycopersicon Mill.) using black polyethylene mulch (BPM). Tomato variety Arka Rakshak having triple disease resistance against tomato leaf curl virus, bacterial wilt and early blight. Unmulched treatments under recommended N:P2O5:K2O dose of 120:200:200 yielded an average of 47.74 tha-1for ‘Arka Rakshak ’ which was significantly higher than the widely cultivated var.‘Rocky’(32.20tha-1 ) in the study area. With BPM, highest yield was recorded as 55.3 t/ha in var. Arka Raksha kwhich was significantly higher than cultivar Rocky (37.2 t/ha). A significant increase in yield was recorded over control (no mulch) in both the cultivars. Keywords: Tomato, Black plastic mulch, Unmulch, Triple disease resistance, Cultivars.

First Asp-2078-Gly Mutation Conferring Resistance to Different ACCase Inhibitors in a Polypogon fugax Population from China.

Asia minor bluegrass (Polypogon fugax) is a common and problematic weed throughout China. P. fugax that is often controlled by acetyl-CoA carboxylase (ACCase) inhibitors in canola fields. Herein, we confirmed a P. fugax population (R) showing resistance to all ACCase inhibitors tested with resistance indexes ranging from 5.4-18.4. We further investigated the resistance mechanisms of this R population. Molecular analyses revealed that an amino acid mutation (Asp-2078-Gly) was present in the R population by comparing ACCase gene sequences of the sensitive population (S). In addition, differences in susceptibility between the R and S population were unlikely to be related to herbicide metabolism. Furthermore, a new derived cleaved amplified polymorphic sequence (dCAPS) method was developed for detecting the Asp-2078-Gly mutation in P. fugax efficiently. We found that 93.75% of plants in the R population carried the Asp-2078-Gly mutation, and all the herbicide-resistant phenotype of this R population is inseparable from this mutation. This is the first report of cross resistance to ACCase inhibitors conferred by the Asp-2078-Gly target-site mutation in P. fugax. The research suggested the urgent need to improve the diversity of weed management practices to prevent the widespread evolution of herbicide resistance in P. fugax in China.

Determination of Densities and Frequencies of Problematic Weed Species in Onion Planting Areas of Ankara and Çorum Provinces

This study was conducted in 2019 in order to determine the weed species, their densities and frequency of occurrences in the onion production areas of Ankara and Çorum Provinces. The surveys were carried out in 78 fields, 55 in Ankara and 23 in Çorum. As a result of the surveys, 75 weed species, two of which are parasite, belonging to 28 families and 64 genera, were determined in the onion fields of Ankara Province. The families with the most species were listed as Asteraceae (11), Poaceae (9), Fabaceae (6), Chenopodiaceae (5) and Apiaceae (5). Other families were determined between 1-3 species. Of these weeds, Convolvulus arvensis L. (1.2 plants/m2), Xantium strumarium L. (0.50 plants/m2), Amaranthus retroflexus L. (0.40 plants/m2), Cuscuta sp. (0.37 parazited onion/m2), A. blitoides S. Watson (0.36 plants/m2) were the 5 most intense species. According to the frequency of occurrence, the first five species are determined as; C. arvensis L. (90.90%), X. strumarium L. (65.45%), A. retroflexus L. (54.54), Chenopodium album L. (52.72%), A. albus L. (47.27%). In the onion cultivation areas of Çorum Province, 61 weed species one of which is parasite, belonging to 24 families and 51 genera were determined. The families with the most species were listed as Asteraceae (9), Poaceae,(8) Apiacea (5), Polygonaceae (4), Fabaceae (4); as for other families, between 1-3 species were determined. Considering the densities per m2 of these weeds, the 5 most common weed species are determined as C. arvensis L. (0.80 plants/m2), Anethum graveolen L. (0.56 plants/m2), A. retroflexus L. (0.41 plants/m2), Chrozophora tinctoria (L.) Raf. (0.32 plants/m2), X. spinosum L. (0.31 plants/m2), the first five species in terms of frequency of incidence are; C. arvensis L. (86.95), A. refroflexus L. (56.52%), X. strumarium L. (56.52%), Cirsium arvense (L.) Scop. (52.17%), C. album L. (52.17%).