Primer Sequences Research Articles

Retraction Note: MicroRNA-132 stimulates the growth and invasiveness of trophoblasts by targeting DAPK-1.

The article "MicroRNA-132 stimulates the growth and invasiveness of trophoblasts by targeting DAPK-1, by Y.-P. Wang, P. Zhao, J.-Y. Liu, S.-M. Liu, Y.-X. Wang, published in Eur Rev Med Pharmacol Sci 2020; 24 (19): 9837-9843-DOI: 10.26355/eurrev_202010_23193-PMID: 33090386" has been retracted by the authors due to some inaccuracies in the miRNA-132 primer sequence. The Publisher apologizes for any inconvenience this may cause. https://www.europeanreview.org/article/23193.

ADVANTAGES OF USING TETRA-PRIMER ARMS-PCR REACTION METHOD FOR DETECTING CARRIERS OF HH3, HH5 FERTILITY HAPLOTYPES IN CATTLE

the strategy for eliminating harmful mutations in the Holstein breed includes genetic monitoring of the prevalence of hidden hereditary anomalies using molecular genetic methods. Currently, there is a tendency to increase the number of hereditary diseases in highly productive breeding animals due to intensive selection and inbreeding. The aim of this study was to develop new and improve existing molecular genetic methods for diagnosing carriers of fertility haplotypes HH3, HH5 in Holstein cows and to study the incidence of these diseases. Diagnosis of heterozygous carriers of the mutation in the coding part of the SMC2 gene was carried out using the tetra-primer ARMS-PCR reaction, the sequences of external and internal primers were determined using the Primer 1 program. Allele-specific primers were used to detect carriers of the deletion in the TFB1M gene, the sizes of the PCR product in homozygous healthy animals 442 bp, in heterozygous carriers 442 bp. and 256 b.p. According to the results of genetic monitoring in the study population, the frequency of heterozygous carriers of the HH3 fertility haplotype was 3.23%, HH5 - 8.35%. It is recommended, in order to control the risk of morbidity of breeding stock with hereditary anomalies, to carry out genetic screening of breeding stock of dairy farms with the coverage of diagnostic tests ranging from 10% to 20% of the total livestock.

The cell cycle stage of bovine zygotes electroporated with CRISPR/Cas9-RNP affects frequency of Loss-of-heterozygosity editing events

At the embryonic level, CRISPR technologies have been used to edit genomes reliably and efficiently in various mammalian models, with Ribonucleoprotein (RNP) electroporation potentially representing a superior delivery method into mammalian zygotes. However, detailed insights of the interactions between varying technical settings as well as the time point of electroporation in a bovine zygote’s cell cycle on developmental metrics and the frequency and type of editing events are largely unknown. The present study uncovers that increasing pulse lengths result in higher Full Edit rates, with Mosaicism in Full-Edit embryos being significantly affected by adjusting RNP-electroporation relative to zygote cell cycle. A considerable proportion of Full Edit embryos demonstrated loss-of-heterozygosity after RNP-electroporation prior to S-phase. Some of these loss-of-heterozygosity events are a consequence of chromosomal disruptions along large sections of the target chromosomes making it necessary to check for their presence prior use of this technique in animal breeding. One out of 2 of these loss-of-heterozygosity events, however, was not associated with loss of an entire chromosome or chromosomal sections. Whether analysed loss-of-heterozygosity in these cases, however, was a false negative result due to loss of PCR primer sequences after INDEL formation at the target side or indeed due to interhomolog recombination needs to be clarified in follow up studies since the latter would for sure offer attractive options for future breeding schedules.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

PB2281: HOW TO AVOID FALSE-NEGATIVE AND FALSE-POSITIVE COVID-19 PCR TESTING

Background: Since early 2020 the most demanded molecular genetic test is real-time reverse transcription polymerase chain reaction (RT-PCR) for SARS-CoV-2. However, up to 40% of test results for COVID-19 in the presence of clinical manifestations of the disease might be negative. A false-negative analysis means untimely treatment of the patient and the possible spread of infection from a non-isolated person. Despite the fact that there are many highly sensitive RT-PCR test systems for COVID-19 on the market, the search for new reliable approaches to increase the robustness of testing is still relevant. Aims: To develop a PCR testing approach featured to minimize the risk of the false-negative results and to increase assay sensitivity and specificity by the use of multiple targets. Methods: A cotton swab taken from the nasopharynx was placed in an Eppendorf tube with 300 μl of phosphate-buffered saline. The resulting suspension (100 μl) was taken for RNA isolation using the Riboprep Amplisens kit (InterlabService, Russia). Primer sequences for RT-PCR are shown in Table 1. Results: The reason for a false-negative result might originate from any stage of the analysis: poor-quality or empty swab, poor RNA isolation, inactivation of reverse transcriptase or Taq polymerase in the test. To control the entire process usually control DNA or an RNA-containing virus (eg bacteriophage MS-2) is added to the sample before RNA isolation. This is sufficient to control RNA isolation, reverse transcription, and PCR amplification. However, improper swab application, handling, transporting, or even attempts to falsify the sample, cannot be excluded this way. Here we propose to include primers for the detection of human ABL1 gene RNA to control swab quality and integrity. Designed primers work with the cDNA of the ABL1 gene, not genomic DNA. Therefore achieved ABL1 gene amplification ensures that enough material containing host RNA was taken by the swab, RNA was nicely isolated, reverse transcribed, and PCR-amplified. For SARS-CoV-2 detection, we propose to use primers targeted to the conserved region of the nucleocapsid gene and the less conserved region of the spike gene (currently specific for the Omicron strain). The simultaneous appearance of three signals corresponding to the nucleocapsid, spike, and ABL1 gene indicates infection with the Omicron strain. The amplification of ABL1 gene and nucleocapsid only indicate other than Omicron infection. The appearance of ABL1 amplification only indicates a true negative result for SARS-CoV-2. All other variants are null and void. Image:Summary/Conclusion: A system has been developed for multiplex PCR diagnostics of SARS-CoV-2, which makes it possible to eliminate errors leading to false-negative and false-positive results at all stages of analysis. This is accomplished by the presence of specific primers for human RNA, controlling proper swab application, handling, and all the stages of RT-PCR. Targeting diverse regions of SARS-CoV-2 increases the reliability of the results and makes it possible to identify the virus strain.

On the Exploration of the Natural Sequence of Primes With Cellular Automata Targeting Enhanced Data Security and Privacy

Enhanced data security and privacy are one of the major concerns in today’s digital society. The role of Primes towards the enhancements of data security and privacy is undeniable. Though several prime generations were presented, yet a cost effective and an easy to implement generation of Prime sequence should always have an advantage targeting real life applications. Hence, prime sequence generation using Cellular Automata (CA) is presented in this article as CA based modelling are easy to implement at the cost of flip-flops. The main contribution of this research is to explore the natural sequence of primes (i.e., primes A000040) with a special class of group CA, at fixed boundary environment; which may potentially be used as a Prime source towards the enhancements of data security and privacy. Experimental results confirm that the first 50 members of A000040 series may be explored at automata size 8 only. Detailed investigations towards the CA configuration and its dynamics in view of the generation of prime A000040 sequence, are also presented in this article.

All-in-one multiplex isothermal reaction combining miniaturized device enables rapid screening of infected samples

Timely and large-scale screening of pathogen-caused infection is highly important to prevent the latent epidemic. With its high amplification efficiency and less requirement on the instrument, the isothermal nucleic acids amplification (INAA) technique has shown great potential in realizing point-of-care (POC) detection of pathogens. However, the ability to realize a high-order multiplexity in one tube, which is significant in the screening of a wide array of pathogens, is still a tricky task for INAA. Herein, we develop a high-order one-pot multiplexing detection method using recombinase-assisted loop-mediated isothermal amplification (RALA). The method shows a high-level multiplexity that could bear over 40 primer sequences in one pot, capable of screening 11 target pathogens with high sensitivity. Furthermore, a simple and portable device was developed in this study to facilitate POC detection. Coupled with this miniaturized device, the strategy was successfully applied to the highly efficient screening of contrived real-life samples. Taken together, this study provides a new but facile choice for rapid screening of infected samples, showing the potential in controlling the transmission of infectious pathogens.

Development and Validation of a Novel Ferroptosis-Related LncRNA Signature for Predicting Prognosis and the Immune Landscape Features in Uveal Melanoma.

BackgroundFerroptosis is a newly iron-dependent mode of programmed cell death that is involved in a variety of malignancies. But no research has shown a link between ferroptosis-related long non-coding RNAs (FRLs) and uveal melanoma (UM). We aimed to develop a predictive model for UM and explore its potential function in relation to immune cell infiltration.MethodsIdentification of FRLs was performed using the Cancer Genome Atlas (TCGA) and FerrDb databases. To develop a prognostic FRLs signature, univariate Cox regression and least absolute shrinkage and selection operator (LASSO) were used in training cohort. Kaplan-Meier (K-M) and receiver operating characteristic (ROC) curve analyses were used to assess the reliability of the risk model. The immunological functions of FRLs signature were determined using gene set enrichment analysis (GSEA). Immunological cell infiltration and immune treatment were studied using the ESTIMATE, CIBERSORT, and ssGSEA algorithms. Finally, in vitro assays were carried out to confirm the biological roles of FRLs with known primer sequences (LINC00963, PPP1R14B.AS1, and ZNF667.AS1).ResultsA five-genes novel FRLs signature was identified. The mean risk score generated by this signature was used to create two risk groups. The high-risk score UM patients had a lower overall survival rate. The area under the curve (AUC) of ROC and K-M analysis further validated the strong prediction capacity of the prognostic signature. Immune cells such as memory CD8 T cells, M1 macrophages, monocytes, and B cells showed a substantial difference between the two groups. GSEA enrichment results showed that the FRLs signature was linked to certain immune pathways. Moreover, UM patients with high-risk scores were highly susceptible to several chemotherapy drugs, such as cisplatin, imatinib, bortezomib, and pazopanib. Finally, the experimental validation confirmed that knockdown of three identified lncRNA (LINC00963, PPP1R14B.AS1, and ZNF667.AS1) suppressed the invasive ability of tumor cells in vitro.ConclusionThe five-FRLs (AC104129.1, AC136475.3, LINC00963, PPP1R14B.AS1, and ZNF667.AS1) signature has effects on clinical survival prediction and selection of immunotherapies for UM patients.

Occurrence of common core structure and genotype-specific signatures among the Vibrio of environmentally diverse vended crabs and shrimps from selected Lagos seafood markets, Nigeria

Abstract. Odeniyi OA, Olawuyi OJ, Ogunsanya O, Unuofin JO. 2022. Occurrence of common core structure and genotype-specific signatures among the Vibrio of environmentally diverse vended crabs and shrimps from selected Lagos seafood markets, Nigeria. Biodiversitas 23: 3081-3090. This study investigated the occurrence of Vibrio species from the gastrointestinal tract of vended crabs and shrimps using Multiplex polymerase chain reactions (Multiplex PCR) method. Different primer pairs were used to detect the presence of hsp, sodB, SodB-R, ctx, toxR, and Vchol virulent genes in the samples. The phylogenetic relationships among the Vibrio species were determined and the polymorphic information content of selected Vibrio primer products was generated using Powermarker V3.25 Dendo-UPGMA program based on Jaccard’s coefficient. The detection of Vibrio virulence genes confirmed the presence of Vibrio species in the DNA extracts of 19 out of the 60 crustacean samples. Among the Vibrio species, Vibrio parahaemolyticus was the most frequently identified species (47.4%), followed by Vibrio cholerae (36.8%), and Vibrio mimicus (15.8%), while the presence of Vibrio vulnificus was not detected in the crab and shrimp samples. Phylogenetically, the Vp.tdh primer constituted the highest allele number, gene diversity and polymorphic information content of 18.00, 0.9444 and 0.9415, respectively, while the mean of the Vp.tdh and Vp.trh primer sequence combination was polymorphic (0.7153). Among the 19 positive Vibrio strains, different major clusters and subclusters were identified, indicating the relatedness between the identified species. The result of this study indicates that the innocuously vended crab and shrimp samples are indeed reservoirs of pathogenic Vibrio species whose consumption by humans might affect the health of the general populace.

Visible-Light CDMA Communications Using Inverted Spread Sequences

Visible-light communication (VLC) using light-emitting diodes (LEDs) is gaining attention in the wireless communication field. LEDs can be used as data transmitters without losing their main functionality as lighting devices. In some VLC applications, such as traffic signs and road signals in intelligent transportation systems, high brightness is required to help people recognize the signs and signals conveyed by the light sources. In this paper, the use of inverted modified prime sequence codes (MPSCs) is shown to be efficient for increasing brightness in an optical code-division multiple access (CDMA) system for VLC, while the original MPSCs, namely non-inverted codes, provide much lower brightness. The average light intensity of a system using an inverted MPSC is several times the intensity of a system using an original MPSC, without losing the capabilities of channel multiplexing and multi-user interference canceling. Average light intensity and normalized fluctuation are investigated for the optical CDMA systems with the original and inverted MPSCs. The results show that the systems with the inverted MPSCs provide higher average light intensity and lower normalized fluctuation than the systems with the original MPSCs do. Moreover, the bit error rates of the systems with the inverted MPSCs are evaluated by computer simulation and compared with those of the systems with the original MPSCs.

Enabling Medicago truncatula forward genetics: identification of genetic crossing partner for R108 and development of mapping resources for Tnt1 mutants.

Though Medicago truncatula Tnt1 mutants are widely used by researchers in the legume community, they are mainly used for reverse genetics because of the availability of the BLAST-searchable large-scale flanking sequence tags database. However, these mutants should have also been used extensively for forward genetic screens, an effort that has been hindered due to the lack of a compatible genetic crossing partner for the M. truncatula genotype R108, from which Tnt1 mutants were generated. In this study, we selected three Medicago HapMap lines (HM017, HM018 and HM022) and performed reciprocal genetic crosses with R108. After phenotypic analyses in F1 and F2 progenies, HM017 was identified as a compatible crossing partner with R108. By comparing the assembled genomic sequences of HM017 and R108, we developed and confirmed 318 Indel markers evenly distributed across the eight chromosomes of the M. truncatula genome. To validate the effectiveness of these markers, by employing the map-based cloning approach, we cloned the causative gene in the dwarf mutant crs isolated from the Tnt1 mutant population, identifying it as gibberellin 3-β-dioxygenase 1, using some of the confirmed Indel markers. The primer sequences and the size difference of each marker were made available for users in the web-based database. The identification of the crossing partner for R108 and the generation of Indel markers will enhance the forward genetics and the overall usage of the Tnt1 mutants.

Target-triggered tertiary amplifications for sensitive and label-free protein detection based on lighting-up RNA aptamer transcriptions

Proteins play vital roles in regulating a series of living activities and can be potentially considered to be useful indicators for diagnosing various diseases. Here, a target-triggered transcription cascade amplification strategy with the use of the fluorescence switch-on RNA aptamer is constructed for label-free and sensitive platelet-derived growth factor-BB (PDGF-BB) protein biomarker detection. The target molecule of PDGF-BB binds a rationally designed multifunctional hairpin probe to switch its structure and to expose a primer binding region. The primer sequence further binds such a region to initiate the target recycling and lighting-up RNA aptamer transcription cascade cycles to yield tremendous RNA aptamers. And, the fluorescence of the organic dye is substantially enhanced upon binding to these RNA aptamers for realizing highly sensitive and label-free PDGF-BB detection with the detection limit being lowered to 0.8 pM. Moreover, the developed strategy has superior selectivity and exhibits a promising potential to detect PDGF-BB spiked into serums with buffer dilution, which makes this method an attractive sensing system for detecting other biomarkers at trace levels.

Rapid identification of new isolates of Acidipropionibacterium acidipropionici by fluorescence in situ hybridization (FISH)

Acidipropionibacterium acidipropionici is widely used for many applications, such as propionic acid production, cereal silage, and also as probiotic. Due to this plethora of applications, new isolates of A. acidipropionici with improved features are being searched for. These new isolates must be accurately identified, however, most approaches become expensive and time-consuming when the number of isolates is high. On the contrary, fluorescence in situ hybridization allows the affordable, reliable, and rapid identification of microorganisms in pure cultures and environmental and medical samples. Therefore, the aim of this work was to apply a fluorescent in situ hybridization probe for the reliable identification of new A. acidipropionici isolates. To this end, probe Pap446, specific for A. acidipropionici, was validated by hybridization assays with strains of this species from different origins, other species of the same genus or family, and unrelated genera. Eight isolates with propionibacterium characteristics were obtained from milk and feces of cows. Probe Pap446, hybridized only with isolates III and VI. The identity of these isolates was further confirmed by PCR using group and species-specific primers for propionibacteria and 16S rDNA sequencing.

Mutations in exon 11 (11.1 and 11.2) of the BRCA1 gene and risk factors for breast cancer in Burkina Faso.

Breast cancer is the leading cause of death among women in both developed and developing countries. It is multifactorial, including genetic predispositions such as oncogenic mutations on BRCA1 and 2 genes. The objectives of the present study were to identify oncogenic mutations in exon 11 of the BRCA1 gene and to determine the risk factors for breast cancer among women population in Burkina Faso.This study involved 100 women, including 50 cases of breast cancer and 50 controls (no clinical signs and no family history of breast cancer or other cancers). Mutations in the BRCA1 gene were detected by PCR using sequence primers specific for exon 11 fragments (11.1 and 11.2).In our study population, age (OR=22.40; CI: 4.33-115.82; p<0.001) and obesity (OR=4.23; CI: 1.64-10.92; p=0.003) were risk factors while multiparity was a protective factor for breast cancer (OR=0.35; CI: 0.15-0.81; p=0.02). A mutation was found on both fragments 11.1 and 11.2 of the BRCA1 gene exon 11 in 04/50 (8.0 %) of patients. No mutations were observed in controls.The present study revealed high frequency of oncogenic mutations in exon 11 fragments (11.1 and 11.2) of the BRCA1 gene. These mutations on exon 11 are and involved in the occurrence of breast cancer in our population. Age and obesity were also risk factors for breast cancer among women population in Burkina Faso.

Prevalence of alcohol dehydrogenase 1B and aldehyde dehydrogenase 2 genotypes in Kashmir, an Asian high-risk region of esophageal squamous cell carcinoma

Alcohol dehydrogenase 1B (ADH1B) and acetaldehyde dehydrogenase 2 (ALDH2) are the two essential enzymes for alcohol metabolism. Polymorphic variants in these genes have been linked with an elevated risk of some alcohol-related cancers, including oesophageal squamous cell carcinoma (ESCC). In the current study, we aimed to evaluate the distribution of ADH1B (p.His48Arg; rs1229984) and ALDH2 (p.Glu504Lys; rs671) genotypes and investigate the association of these variants with the ESCC risk in Kashmir, India, a region where ESCC is comparatively more prevalent. We analyzed ADH1B and ALDH2 genotypes in 340 histopathologically verified ESCC cases and 800 controls by polymerase chain reaction with confronting two-pair primer (PCR-CTPP) and direct sequencing. To assess the association of the genotypes with ESCC risk, we used conditional logistic regression models. The frequency of mutant ADH1B 48His (ADH1B*) and ALDH2 504Lys (ALDH2*2) alleles was 29.0% and 1.9% respectively in controls. The odds ratio (OR) for the association between the genotypes ALDH2*1/*2, compared to *1/*1, and ESCC risk was above the unity, whereas it was below unity for ALDH2 *2/*2. However, due to a modest number of individuals with variant genotypes in the ALDH2 gene, 95% confidence intervals (Cis) for their associations with ESCC risk could not be calculated in the adjusted models. The corresponding OR (95% CI) was 0.87 (0.45 – 1.69) for ADH1B*2/*2 and 4.61 (0.20 –105.86) for ADH1B*1/*2. The lack of association between studied ADH1B and ALDH2 polymorphic variants and ESCC risk in Kashmir may be supported by the low prevalence of the mutant alleles, which is much lower than the reported prevalence in Chinese and Japanese populations, and low alcohol drinking in the Kashmiri population.

In silico analysis and expression profiling of Expansin A4, BURP domain protein RD22-like and E6-like genes associated with fiber quality in cotton.

To supply high-quality cotton fibre for the textile industry, the development of long, strong and fine fibre cotton varieties is imperative. An interlinked approach was used to comprehend the role of fibre genes by analyzing interspecific progenies of cotton species. Wild Gossypium species and races are rich source of genetic polymorphism due to environmental dispersal and continuous natural selection. These genetic resources hold mass of outclass genes that can be used in cotton improvement breeding programs to exploit possible traits such as fibre quality, abiotic stress tolerance, and disease and insect resistance. Therefore, use of new molecular techniques such as genomics, transcriptomics and bioinformatics is very important to utilize the genetic potential of wild species in cotton improvement programs. Interspecific lines and Gossypium species used in the study were grown at Central Cotton Research Institute (CCRI), Multan. After retrieving DNA sequence of the genes from NCBI, the primers for gene expression and full-length gene sequence were designed. Expression profiling of Expansin A4, BURP Domain protein RD22-like and E6-like fibre genes was performed through Real Time PCR. BLAST and DNA sequence alignment was conducted for sequence comparison of interspecific lines and Gossypium species. Different in silico analysis were used for characterization of fibre genes and identification of cis acting promoter elements in promoter region. Variable expression of genes related to fibre development was observed at different stages. BLAST and DNA sequence alignment demonstrated resemblance of interspecific lines with G. hirsutum. In silico analysis on the sequence data also confirmed the role of Expansin A4, BURP Domain protein RD22-like and E6-like fibre genes in fibre development. Genetic engineering is also recommended by transferring E6-like, Expansin A4 and BURP Domain RD22-like genes in local cotton cultivars. Similarly, several stress tolerant and light responsive cis acting elements were identified through promotor analysis, which may contribute for fibre development in the breeding programs. Expansin A4, BURP Domain RD22-like and E6-like have positive role in fibre development with variable expression at fiber length and strength associated stages.

Molecular Typing and Rapid Identification of Human Adenoviruses Associated With Respiratory Diseases Using Universal PCR and Sequencing Primers for the Three Major Capsid Genes: Penton Base, Hexon, and Fiber

Human adenoviruses (HAdVs) within species B, C, and E are responsible for highly contagious and potentially severe respiratory disease infections. The traditional method to type these pathogens was based on virus neutralization and hemagglutination assays, which are both time-consuming and difficult, particularly due to the nonavailability of reagents. Subsequent molecular typing based on the partial characterization of the hexon gene and/or the restriction enzyme analysis (REA) of the genomes is inadequate, particularly in identifying recombinants. Here, a rapid, simple, and cost-effective method for molecular typing HAdV respiratory pathogens is presented. This incorporates three pairs of universal PCR primers that target the variable regions of the three major capsid genes, i.e., hexon, penton base, and fiber genes, that span the genome. The protocol enables typing and characterization of genotypes within species B, C, and E, as well as of some genotypes within species D and F. To validate this method, we surveyed 100 children with HAdV-associated acute respiratory infections identified by direct immunofluorescence (Hong Kong; July through October, 2014). Throat swab specimens were collected and analyzed by PCR amplification and sequencing; these sequences were characterized by BLAST. HAdVs were detected in 98 out of 100 (98%) samples, distributing as follows: 74 HAdV-B3 (74%); 10 HAdV-E4 (10%); 7 HAdV-C2 (7%); 2 HAdV-C6 (2%); 1 HAdV-B7 (1%); 1 HAdV-C1 (1%); 2 co-infection (2%); and 1 novel recombinant (1%). This study is the first detailed molecular epidemiological survey of HAdVs in Hong Kong. The developed method allows for the rapid identification of HAdV respiratory pathogens, including recombinants, and bypasses the need for whole genome sequencing for real-time surveillance of circulating adenovirus strains in outbreaks and populations by clinical virologists, public health officials, and epidemiologists.

New molecular markers for distinguishing the main phylogenetic lineages within Alternaria section Alternaria

Several members of Alternaria section Alternaria are economically important plant-pathogenic fungi that cause disease on a wide range of host types and plant tissues. The production of Alternaria-derived mycotoxins can lead to significant post-harvest losses due to contamination of agricultural products. Multiple Alternaria species are listed as regulated organisms, which are monitored by international plant protection programmes. These taxa often share high levels of both morphological and phylogenetic similarity, and the establishment of molecular markers that are able to distinguish among them unambiguously has proven to be quite challenging. Previously, we examined fine-scale genome-wide phylogenetic patterns and proposed a list of candidate genes for development into informative markers that are diagnostic for the main section Alternaria lineages. Here, we design primer sets and sequence three new markers (ASA-05, ASA-10, ASA-19) in order to evaluate their diagnostic performance. Sequence data for 49 new independent test taxa were combined with existing data for 38 taxa, and phylogenetic analyses revealed that, in general, the new molecular markers consistently classified section Alternaria strains into one of the main lineages. A discrepancy among the three markers for lineage assignment was observed only for one strain. We also sequenced a commonly used marker in molecular phylogenetics of fungi (rpb2, RNA polymerase II second largest subunit) and found it was outperformed by all three of the new markers. We suggest that an ASA marker presented here could form the basis of a convenient one-locus test for rapid and routine diagnostic screening of unknown section Alternaria strains.

Cysteinyl–leukotriene and prostaglandin pathways in bronchial versus alveolar lavage in allergic asthmatics

Cysteinyl–leukotriene and prostaglandin pathways in bronchial versus alveolar lavage in allergic asthmatics

Piano Music Transcriber

Sheet music is a transcribed or printed type of melodic documentation that portrays the rhythms, harmonies, pitches of music with the assistance of melodic images. Printed music is the most essential instrument for artists to learn and play music. An educated musician can, from this sheet, play an entire grand composition. However, making sheet music from scratch is a very long and intricate process. A lot of musical experience is required for making sheet music from music one hears and even experts tend to make mistakes. This makes it almost impossible for beginners who are unable to distinguish between different chords to play the music that they hear. We aim to create a system that would provide the user with the needed sheet music by taking the input from the user in the form of an audio mp3 file. The proposed system automatically generates sheet music directly from recorded songs. This system proposed is mainly composed of estimation of chords then converting it into MIDI file which is a computer understandable language, and eventually into sheet music. All stereo audio recordings are converted into mono which further resampled to 16 kHz. Music generation is also applied which gives a priming sequence to the model in the types of a MIDI file and then predicts the further notes to help musicians form further melody while the composition of music is taking place. Beginners and lesser experienced musicians also struggle with procuring sheet music for melodies and are limited to only what is available from other professional transcribers. For professional musicians, it helps to lay the foundations and automates a major part of the creation process. Professionals can further improve the automatically generated sheet music without the burden of starting from scratch