Primer Probe Research Articles

Development of a novel serogrouping method for the rapid detection of 21 Escherichia coli O-serotypes using multiplex real-time PCR

Escherichia coli O-serotypes are associated with pathogenesis; thus, rapid and accurate serogrouping is required to prevent foodborne outbreaks. In this study, a novel multiplex real-time PCR method was developed for E. coli serogrouping to overcome some limitations of conventional and in silico serogrouping. Two O-serotype genes, wzy and wzx, were selected, and 21 primer–probe sets were designed for determining O-serotypes. To evaluate this, 11 O-serotype reference strains and 43 environmental isolates were tested: serogrouping took <40 min and the detection limit was 1–10 pg DNA, indicating that rapid identification was achieved with high sensitivity and without false-positive results. Subsequent food tests revealed that the method worked perfectly even at 101 CFU per ground beef sample; thus, O-serotypes were identifiable in food environments. The developed multiplex real-time PCR serogrouping method can rapidly, inexpensively, and accurately identify E. coli O-serotypes; therefore, it could help prevent foodborne outbreaks.

Synchronous detection of Burkholderia pseudomallei and its ceftazidime resistance mutation based on RNase-HII hydrolysis combined with lateral flow strip assay.

Melioidosis is a severe and often fatal infectious disease caused by Burkholderia pseudomallei, which poses significant challenges due to its high mortality rate and frequent misdiagnosis. To effectively treat infected patients, especially in epidemic regions like Hainan with a high resistance rate to ceftazidime (CAZ), early diagnosis and resistance testing are critical. Here, we designed a strategy that combines RNase-HII-dependent PCR with lateral flow strip assay (LFSA) for simultaneous detection of B. pseudomallei and its CAZ resistance mutation. In this strategy, we utilized rhPCR technology to design specific primers with a C3-spacer modification. These primers target a 115-base pair region within the ORF2 of the B. pseudomallei type III secretion system gene cluster, as well as the P174L mutation in the penA gene, which is a major mutation associated with CAZ resistance in Hainan. The primers contain complementary RNA bases that can be hydrolyzed only in the presence of thermostable RNase-HII enzymes, facilitating subsequent PCR reactions. Additionally, we introduced two pairs of universal probes carrying fluorescein isothiocyanate (FITC) and biotin, as well as digoxin and biotin. The sequences of these universal probes align with specific regions of the primers, resulting in target products labeled with different tags. The resulting amplification products are then subjected to LFSA, where the presence of specific markers is visually interpreted based on color development. These markers flow to test line 1 (T1) and are captured by a fixed anti-FITC antibody, generating a red line that indicates the presence of B. pseudomallei. Similarly, the occurrence of a red line on test line 2 (T2), which is fixed with anti-digoxin antibodies, indicates the presence of the P174L mutation in B. pseudomallei. This protocol serves as an excellent tool for the rapid diagnosis of melioidosis and provides a basis for selecting appropriate antibiotic medication. It has the potential to revolutionize the diagnosis of melioidosis, particularly in resource-limited settings. Furthermore, this technique holds promise as a versatile tool for disease diagnosis in general. IMPORTANCE This study focused on the development of a reaction system using rhPCR to amplify a specific gene, ORF2, of B. pseudomallei and to identify the P174L mutation associated with increased drug resistance to ceftazidime (CAZ). The system incorporated universal primer probes and a simple temperature cycle reaction. The amplified products were then analyzed using lateral flow strip assay (LFSA) for strain identification and mutation interpretation. The developed system provides a reliable basis for diagnosing melioidosis and selecting appropriate drugs. Its potential impact is particularly significant in resource-limited settings where access to advanced diagnostic techniques is limited. This platform stands out for its simplicity, convenience, sensitivity, specificity, and portability. It shows promise as a point-of-care testing method for detecting single nucleotide polymorphism in genes associated with other diseases. By leveraging the advantages of this platform, researchers and healthcare professionals can potentially expand its use beyond melioidosis and apply it to the rapid detection of genetic variations in other disease-related genes.

Multienzyme isothermal rapid amplification and lateral flow dipstick combination assay for visible detection of chicken chaphamaparvovirus

Chicken chaphamaparvovirus (CkChpV) is a newly emerging pathogen that is currently prevalent in chickens with diarrhea symptoms. To diagnose CkChpV more conveniently and rapidly, this study established a multienzyme isothermal rapid amplification (MIRA) assay, with a reaction time of only 15 min and optimal reaction temperature of 38°C. In combination with the lateral flow dipstick assay, the CkChpV-MIRA assay can be completed within 20 min. We revealed that the detection limit of the MIRA assay using standard plasmids as templates was as low as 21.3 copies, and its sensitivity was 100 times higher than that of nested PCR. Moreover, the designed primer set and probe could only detect CkChpV specifically, and there was no cross reaction with avian nephritis virus, rotavirus, chicken parvovirus virus, Newcastle disease virus, and infectious bronchitis virus, which may cause diarrhea. These findings demonstrated that the CkChpV-MIRA assay established in this study is convenient, sensitive, and specific and does not require sophisticated equipment. It is more suitable for the detection of CkChpV in clinical samples.

Simultaneous Detection of Influenza A/B, Respiratory Syncytial Virus, and SARS-CoV-2 in Nasopharyngeal Swabs by One-Tube Multiplex Reverse Transcription Polymerase Chain Reaction.

The treatment and outcome of respiratory virus infections differ. SARS-CoV-2, as well as other respiratory viruses such as influenza virus (A and B) and respiratory syncytial virus (RSV), require simultaneous, cost-effective, and rapid differential detection. We used a gold standard five-target single-step RT-PCR to detect influenza viruses, RSV, and SARS-CoV-2, and this method can be extended to detect influenza virus subtypes. As a result, this five-target single-step RT-PCR method is ideal for differentiating respiratory viruses. The 5' nuclease activity of Taq DNA polymerase is used in the real-time reverse transcription PCR assay. The Taq man fast viral 1-step enzyme is a 4× Master mix and five-target primer probe mix that detects influenza A, influenza B, SARS-CoV-2 ORF1ab, respiratory syncytial viruses A/B and actin. When compared with TaqMan TM and Invitrogen superscript TM III Platinum and the Meril Kit for SARS-CoV-2, the assay demonstrated 100% sensitivity, specificity, and amplification efficiency of 90.1% for target genes. In conclusion, our one-tube multiplex RT-PCR assay offers a rapid and reliable method for the simultaneous detection of influenza A/B, RSV, and SARS-CoV-2 from nasopharyngeal swabs. This assay has the potential to enhance diagnostic capabilities and improve public health responses during respiratory outbreaks, enabling timely interventions and informed decision making.

Development and clinical validation of a one-step pentaplex real-time reverse transcription PCR assay for detection of hepatitis virus B, C, E, Treponema pallidum, and a human housekeeping gene

BackgroundWith the safety of blood transfusion being a major public health concern, the development of a rapid, sensitive, specific, and cost-effective multiplex PCR assay for simultaneous detection of hepatitis B virus(HBV), hepatitis C virus (HCV), hepatitis E virus (HEV), and Treponema pallidum(T. pallidum) in blood is crucial.MethodsFive primer pairs and probes were designed towards conserved regions of target genes and used to establish a one-step pentaplex real-time reverse transcription PCR(qRT-PCR) assay for simultaneous detection of HBV, HCV, HEV, T. pallidum, and RNase P(housekeeping gene), providing sample quality check. The clinical performance of the assay was further determined with 2400 blood samples from blood donors and patients in Zhejiang province, and compared the results with commercial singleplex qPCR and serological assays.ResultsThe 95% limit of detection(LOD) of HBV, HCV, HEV, and T. pallidum were 7.11 copies/µL, 7.65 copies/µL, 8.45 copies/µL, and 9.06 copies/µL, respectively. Moreover, the assay has good specificity and precision. Compared to the singleplex qPCR assay, the novel assay for detecting HBV, HCV, HEV, and T. pallidum presented 100% clinical sensitivity, specificity, and consistency. Several discrepant results between serological and pentaplex qRT-PCR assays were found. Of 2400 blood samples, there were 2(0.08%) HBsAg positive samples, 3(0.13%) anti-HCV positive samples, 29(1.21%) IgM anti-HEV positive samples and 6(0.25%) anti-T. pallidum positive samples proven negative in nucleic acid detection. 1(0.04%) HBV DNA positive sample and 1(0.04%) HEV RNA positive sample were detected negative by serological testing.ConclusionsThe developed pentaplex qRT-PCR is the first assay on simultaneous, sensitive, specific, and reproducible detection of HBV, HCV, HEV, T. pallidum, and RNase P in a single tube. It could detect pathogens in blood during the window period of infection and is a good tool for effectively screening blood donors and early clinical diagnosis.

Establishment of a recombined mannose-binding lectin protein-magnetic beads-enriched binding recombinant enzyme-assisted polymerase chain reaction assay for Candida in blood samples

Objective: To establish a nested recombinant enzyme-assisted polymerase chain reaction (RAP) technique combined with recombined mannose-binding lectin protein (M1 protein)-magnetic beads enrichment for the detection of Candida albicans (C. albicans) and Candida tropicalis (C. tropicalis) in blood samples for the early diagnosis of candidemia albicans and candidiemia tropicalis. Methods: The primer probes for highly conserved regions of the internal transcribed spacerregions of C. albicans and C. tropicalis were deigned to establish RAP assays for the detections of C. albicans and C. tropicalis; The sensitivity and reproducibility of nucleic acid tests with gradient dilutions of standard strains and specificity of nucleic acid tests with common clinical pathogens causing bloodstream infection were condcuted. M1 protein-magnetic bead enriched plasma C. albicans and C. tropicalis were used for RAP and PCR in with simulated samples and the results were compared. Results: The sensitivity of the established dual RAP assay was 2.4-2.8 copies/reaction, with higher reproducibility and specificity. M1 protein-magnetic bead enrichment of pathogen combined with the dual RAP assay could complete the detections of C. albicans and C. tropicalis in plasma within 4 hours. Fie the pathogen samples at concentration <10 CFU/ml, the number of the samples tested by RAP was higher than that tested by PCR after enrichment. Conclusion: In this study, a dual RAP assay for the detections of C. albicans and C. tropicalis in blood sample was developed, which has the advantages of accuracy, rapidity, and less contaminants and has great potential for rapid detection of Candidemia.

Seems fishy: environmental DNA impacts on sketa22 quality control in salmonidae dominated waterbodies using qPCR and ddPCR

Globally, water resources used for recreation and drinking water are threatened by fecal pollution. These pollutants can cause gastrointestinal illness and environmental degradation. Additionally, most sources of fecal pollution are non-point sources stemming from multiple species. Identifying these sources is vital to categorizing the exposure risk from contact and improving remediation efforts. A common technique to provide species-specific information for fecal source identification is microbial source tracking (MST). MST quantifies DNA of host or host-associated microorganisms through polymerase chain reaction (PCR) technologies such as quantitative PCR (qPCR) or droplet digital PCR (ddPCR). MST techniques have been implemented globally and are used for routine monitoring. In the United States (US), the US Environmental Protection Agency has provided several approved standard PCR methods for MST and other recreational water quality applications. These methods have specified quality controls including sample processing controls (SPC) and assessments for sample inhibition. A standard SPC used in EPA methods involves spiking samples with salmon testes DNA (nominally originating from Chum Salmon, Oncorhynchus keta and quantifying them using Sketa22, a genus specific TaqManTM assay). This quality control (QC) behaves similarly to the microbial species being monitored. MST testing in Fall 2022 indicated elevated Sketa22 recoveries and re-analysis of samples indicated the detection of external Salmonidae DNA on both qPCR and ddPCR platforms. Our research was designed to identify the cause of this interference. Results indicate that the primer probe set may react with wild Salmonidae DNA. Analyzing the Sketa22 sequence using BLAST indicated matches with many species of Salmonidae present in the sampled stream system. Consequently, further research is required to identify the effectiveness of Sketa22 as a QC when native and migratory Salmonidae are present. General recommendations are provided to account for excess ambient Salmonidae DNA.

Validation of a rapid HLA-DQA1*05 pharmacogenomics assay to identify at-risk resistance to anti-tumor necrosis factor therapy among patients with inflammatory bowel disease.

The HLA-DQA1*05 variant (rs2097432) is associated with increased risk of immunogenicity to tumor necrosis factor antagonists, with subsequent resistance to therapy in patients with inflammatory bowel disease. Identification of these patients would optimize personalized therapeutic selection. Genomic DNA was extracted from 80 deidentified samples in an unselected patient population with an unknown rs2097432 genotype. Split sample analysis was performed using a reference laboratory. Primer probes for a TaqMan quantitative polymerase chain reaction (qPCR) assay (Thermo Fisher Scientific) were custom designed. Synthesized genomic-block fragments were used as controls. All qPCR reactions were performed using a TaqMan GTXpress Master Mix (Thermo Fisher Scientific) on the Applied Biosystems 7500 system under fast cycling conditions. Of 80 samples, 50% were wild-type reference genotypes, 22.5% were heterozygous, and 27.5% were homozygous variant calls, comparable to population data. Split analysis samples between 2 independent laboratories were 100% concordant. The detection limit tested across genomic-block controls processed in duplicate was reproducible on sample input from 10 ng titrated down to 1.25 ng across 2 independent runs. Further, analytical specificity assessed with previous wild-type reference and homozygous variant DNA spiked into genomic-block controls produced appropriate heterozygous genotypes. Here we present validation of a lab-developed test for a rapid HLA-DQA1*05 (rs2097432) pharmacogenomics assay targeting a hotspot identified by genome-wide association studies. Targeted genotyping employed here will allow for expeditious personalized therapeutic selection.

Programmable strand displacement-driven assembly of single quantum dot nanosensor for accurately monitoring human SMUG1 uracil-DNA glycosylase at single-cell level

Human single-stranded selective monofunctional uracil glycosylase (hSMUG1) is an important uracil-DNA glycosylase (UDG) subfamily responsible for repair of uracil and oxidized pyrimidine derivatives as well as maintenance of genomic integrity. The abnormal hSMUG1 level is closely associated with various human diseases and cancers. Herein, we demonstrate for the first time the programmable strand displacement-driven assembly of single quantum-dot (QD) nanosensor for accurately monitoring hSMUG1 at single-cell level. We used an oxidation marker 5-hydroxymethyluracil (5hmU) as a novel specific catalysis site for hSMUG1. The presence of hSMUG1 catalyzes 5hmU excision to activate exponential strand-displacement cascades for producing abundant primer probes. Subsequently, primer probes induce the self-assembly of 605QD-dsDNA-Cy5 nanostructures and fluorescence resonance energy transfer (FRET) between 605QD and Cy5. The FRET signal can be quantified via single-molecule imaging. This single QD nanosensor exhibits a detection limit of 7.08 × 10−11 U/μL over a wide dynamic range of 8 orders of magnitude. Importantly, it can measure enzymatic kinetics, screen potential inhibitors, discriminate hSMUG1 expression between cancer cells and normal cells, and quantify hSMUG1 activity in various cancer cells at single-cell level, promising a new avenue for hSMUG1-related biomedical studies and clinical diagnostics.

Discovery of unknown new ponds occupied by the endangered giant water bug Kirkaldyia deyrolli (Hemiptera: Heteroptera: Belostomatidae) by combining environmental DNA and capture surveys

AbstractBasic ecological information (e.g. habitat or distribution) is indispensable for conserving endangered species. The giant water bug Kirkaldyia deyrolli is an aquatic insect in the large stink bug family (Belostomatidae). It inhabits ponds and is a critically endangered species. In this study, we developed a species‐specific primer–probe set (the cytochrome c oxidase I region in mitochondrial DNA) that was used in real‐time polymerase chain reaction (PCR) assays to detect K. deyrolli environmental DNA (eDNA). Next, using eDNA analysis, we investigated the presence of K. deyrolli in 89 study ponds (including one pond that had already been identified as the habitat of this species) in Shimane Prefecture, Japan. The eDNA of K. deyrolli was detected in 11 of these 89 ponds. Furthermore, when the traditional method of direct capture survey was carried out in four of the 10 ponds where K. deyrolli eDNA had been detected and no prior occupancy information for this species was available, the capture of one K. deyrolli (female) was successful in only one pond. This study showed that combining eDNA analysis and direct capture methods can lead to discovering previously unknown habitats essential for conserving an endangered species.

Long Non-Coding RNA Detection Based on Multi-Probe-Induced Rolling Circle Amplification for Hepatocellular Carcinoma Early Diagnosis.

Long non-coding RNAs (lncRNAs) played vital roles in physiological and pathological conditions. Consistent results from cell experiments, animal experiments, and clinical studies suggested that lncRNA HULC was an oncogenic lncRNA serving as a potential diagnostic and prognostic marker of hepatocellular carcinoma. In this study, we developed a fluorescent biosensor for lncRNA HULC detection based on rolling circle amplification (RCA) induced by multi-primer probes. Multiple primer probes can not only combine with lncRNA to break its secondary structure, which was conducive to lncRNA captured by Y-shaped probes, but also trigger multiple RCA reactions to achieve signal amplification and the goal of sensitive detection of lncRNA. Compared to previous detection methods, in this scheme, we took advantage of the long sequence characteristics of lncRNA to make it a carrier that can bind multiple primers to initiate RCA. This newly designed biosensor provided a linear range from 1 pM to 100 nM with a detection limit of 0.06 pM. This method can provide a new idea for the application of isothermal amplification in detecting lncRNA. Furthermore, the application of the biosensor in liver cancer cell lines and whole blood samples from hepatocellular carcinomatosis patients also confirmed that the method had good selectivity and sensitivity to lncRNA HULC. This method offered a new way for transforming specific lncRNA into clinical application for diagnosis, prognosis, or predicting treatment response.

Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

Development of a one-run real-time PCR detection system for pathogens associated with poultry infectious diseases.

Infectious diseases are an important issue in the poultry industry, requiring early diagnosis and countermeasures. To address this, we present a system based on TaqMan real-time PCR to detect pathogen genome in specimens collected from chickens. We designed 12 primer-probe sets for pathogens causing respiratory or systemic symptoms. In field samples, we detected three viruses, including DNA and RNA viruses, and three bacteria. The chicken anemia virus and Avibacterium paragallinarum were detected only in young and laying hens, respectively. Bacteria were detected only in throat swabs, and gallid alphaherpesvirus 2 was detected in different specimens at each developmental stage. Our novel TaqMan real-time PCR system effectively detects pathogen's gene in chickens, while taking age into account.

Development of a reverse-transcription droplet digital PCR method for quantitative detection of Cucumber green mottle mosaic virus

Cucumber green mottle mosaic virus (CGMMV) is a re-emerging threat to the production of greenhouse cucumber and other Cucurbitaceae crops worldwide. This seed-borne virus can easily spread from a contaminated seed to seedlings and adjacent plants by mechanical contact between the foliage of diseased and healthy plants, causing extensive yield losses. An accurate method for detecting and quantifying this virus is urgently needed to ensure the safety of the global seed trade. Here, we report the development of a reverse-transcription droplet digital polymerase chain reaction (RT-ddPCR)-based method for specific and high-sensitive detection of CGMMV. By testing three primer–probe sets and optimizing reaction conditions, we showed that the newly developed RT-ddPCR method is highly specific and sensitive, with a detection limit of 1 fg/μL (0.39 copy/μL). The sensitivity of the RT-ddPCR method was compared with that of real-time fluorescence quantitative RT-PCR (RT-qPCR) using a series of plasmid dilutions and total RNAs extracted from infected cucumber seeds, and the detection limit of RT-ddPCR was 10 times higher than RT-qPCR with plasmid dilutions and 100 times higher than RT-qPCR for detecting CGMMV from infected cucumber seeds. The RT-ddPCR method was further assessed for detecting CGMMV from a total of 323 samples of Cucurbitaceae seeds, seedlings, and fruits as compared with the RT-qPCR method. We found that the infection rate of CGMMV on symptomatic fruits was as high as 100%, whereas infection rates were lower for seeds and lowest for seedlings. Notably, the results of two methods in detecting CGMMV from different cucurbit tissues showed the high consistency with Kappa value from 0.84 to 1.0, demonstrating that the newly developed RT-ddPCR method is highly reliable and practically useful for large-scale CGMMV detection and quantification.

Analysis of microRNAs by the Stem-Loop Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction Using A Double Quencher Probe

Abstract Introduction/Objective We created a universal probe that can be used with mature micro RNAs (miRNAs) using a double quencher incorporating the ZEN quencher into the hydrolysis probe required for miRNA analysis by the real- time quantitative polymerase chain reaction (RT-qPCR) using a stem-loop primer. The main purpose of this approach was to improve sensitivity and convenience. Methods/Case Report We conducted studies on miR-21, miR-30a and miR-200c. To assess the relationship between the sequence interval and reactivity between the miRNA-specific sequence on the stem-loop primer and detection probe, various sequence patterns were examined using miRNA from K562 cells. The sensitivity and reactivity of the designed primers and probes were examined using each synthetic miRNA and transurethral resection of bladder tumor (TURBT) samples. The synthetic RNA was serially diluted in 10% increments. Twenty-seven TURBT cases were examined. The prepared samples were extracted with the FastGene RNA Basic Kit and FastGene miRNA Enhancer. After extraction, cDNA was prepared using FastGene Scriptase II. We performed quantitative analysis by the RT-qPCR using a ZEN double quencher probe. The samples were analyzed with the Taq Man miRNA assay. Results (if a Case Study enter NA) The probe and miRNA-specific sequences of the stem-loop primer showed better reactivity when the design contained less space within the sequences. Serial dilution of the samples using synthetic miRNA showed that linearity depended on the addition amount, and occurred at a concentration of log 7 or more. In the TURBT samples, the Δ of the mean Cp value, and the correlation coefficients of miR-21, miR-30a, and miR-200c, were 3.13 and 0.966; 1.10 and 0.991; and 0.39 and 0.997, respectively, compared with the TaqMan miRNA assay. Conclusion This demonstrates that our method has the same or higher sensitivity than the TaqMan miRNA assay. Overall, these findings suggest that the analysis of miRNA with a stem-loop primer using the double quencher probe is useful.

Investigating SARS-CoV-2 RNA in five municipal wastewater treatment plants, hospital wastewater and wastewater collection networks during the COVID-19 pandemic in Ardabil Province, Iran

Since 2019, the outbreak of coronavirus with acute respiratory symptoms has caused an epidemic worldwide. Transmission of the disease through respiratory droplets was announced as the main mode of transmission in 2020. But in this study, we discussed the method of indirect transmission of the virus through sewage. In this study, effluents related to urban and hospital wastewater treatment plants in 5 regions of Ardabil Province (northwest of Iran) were investigated. In this research, 120 samples were kept in pre-test conditions (temperature -20 degrees Celsius). To identify the viral genome, special primer and chain reaction probe targeting ORF1ab and N (nucleoprotein gene) genes were used. Out of a total of 120 samples, a total of 3 samples were positive. Wastewater epidemiology (WBE) can be considered as a cost-effective method in the diagnosis and prediction of pathogenic agents. And be considered an effective method for decision-making in order to protect the health of citizens.

Digital polymerase chain reaction strategies for accurate and precise detection of vector copy number in chimeric antigen receptor T-cell products

Background aimsVector copy number (VCN), an average quantification of transgene copies unique to a chimeric antigen receptor (CAR) T-cell product, is a characteristic that must be reported prior to patient administration, as high VCN increases the risk of insertional mutagenesis. Historically, VCN assessment in CAR T-cell products has been performed via quantitative polymerase chain reaction (qPCR). qPCR is reliable along a broad range of concentrations, but quantification requires use of a standard curve and precision is limited. Digital PCR (dPCR) methods were developed for absolute quantification of target sequences by counting nucleic acid molecules encapsulated in discrete, volumetrically defined partitions. Advantages of dPCR compared with qPCR include simplicity, reproducibility, sensitivity and lack of dependency on a standard curve for definitive quantification. In the present study, the authors describe a dPCR assay developed for analysis of the novel bicistronic CD19 × CD22 CAR T-cell construct. MethodsThe authors compared the performance of the dPCR assay with qPCR on both the QX200 droplet dPCR (ddPCR) system (Bio-Rad Laboratories, Inc, Hercules, CA, USA) and the QIAcuity nanoplate-based dPCR (ndPCR) system (QIAGEN Sciences, Inc, Germantown, MD, USA). The primer–probe assay was validated with qPCR, ndPCR and ddPCR using patient samples from pre-clinical CAR T-cell manufacturing production runs as well as Jurkat cell subclones, which stably express this bicistronic CAR construct. ResultsddPCR confirmed the specificity of this assay to detect only the bicistronic CAR product. Additionally, the authors’ assay gave accurate, precise and reproducible CAR T-cell VCN measurements across qPCR, ndPCR and ddPCR modalities. ConclusionsThe authors demonstrate that dPCR strategies can be utilized for absolute quantification of CAR transgenes and VCN measurements, with improved test–retest reliability, and that specific assays can be developed for detection of unique constructs.

Development of a Novel Primer-TaqMan Probe Set for Diagnosis and Quantification of Meloidogyne enterolobii in Soil Using qPCR and Droplet Digital PCR Assays.

Early detection of pathogens before the planting season is valuable to forecast disease occurrence. Therefore, rapid and reliable diagnostic approaches are urgently needed, especially for one of the most aggressive root knot nematodes, Meloidogyne enterolobii. In this study, we developed a novel primer–TaqMan probe set aimed at M. enterolobii. The primer–probe set was successfully applied in the identification and quantification of M. enterolobii via qPCR technology. It was also suitable for improved PCR technology, known as ddPCR analyses, and this work presents the first application of this technology for plant parasitic nematodes. Compared with qPCR, ddPCR exhibited better performance with regard to analytical sensitivity, which can provide a more accurate detection of M. enterolobii concealed in field soil. In addition, we generated standard curves to calculate the number of eggs in soil using the qPCR and ddPCR platforms. Hopefully, the results herein will be helpful for forecasting disease severity of M. enterolobii infection and adopting effective management strategies.

P423 Recombinase polymerase amplification for Mucormycosis

Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectives(1) To develop a Recombinase polymerase amplification (RPA)-based assay to diagnose mucormycosis. (2) To determine the analytical sensitivity and cross-reactivity of the developed assay. (3) To validate the assay in clinical samples. (4) To determine the turnaround time for the developed assay.MethodsMultiple alignments of the ITS region of Rhizopus arrhizus were used to identify conserved sequences and design 30-32 bp long primers and 45 bp long Exo probes for RPA-based assay as per TwistDX guidelines (Cambridge, UK) using the PrimedRPA program (Higgins et al. 2019) and subject to in silico specificity check using NCBI primer blast. Genomic DNA and plasmid clone of the target region were spiked into human DNA and were used to determine analytical sensitivity. DNA from 35 clinically relevant fungi and bacteria were used to determine the cross-reactivity. A total of 40 sinus tissue samples from patients with microscopy and culture-confirmed mucormycosis and 40 sinus tissue samples from patients without mucormycosis were used to determine the diagnostic sensitivity and specificity of the assay. DNA from relevant fungi, bacteria and molds were extracted using the MPbio FastDNA kit as per the manufacturer’s instructions with an elution volume of 100 μl. All extracted DNA samples were subjected to GAPDH PCR before RPA testing to rule out the presence of inhibitors as per established protocols. A 50 μl RPA reaction using Twistamp Exo kit as per manufacturer's instruction but using 10 μl template instead of 1 μl. The reactions were set up and inserted into a portable Qiagen ESE quant TS2.4 fluorometer incubated at 39°C and fluorescence was acquired every 30 sec over 20 min. The tubes were removed from the fluorometer mixed well and reinserted after 4 min as per kit instructions. Positive control and no template control were set up with each reaction. All relevant data were entered in Microsoft excel and diagnostic sensitivity and specificity were calculated using the Medcalc free online statistical software.ResultsA total of 1246 primer-probe combinations were designed and checked for in silico specificity using NCBI primer blast. Of these 1246 primer probes, 8 primers and 1 probe was finalized for in vitro testing to determine the best primer and probe set. The finalized primers had analytical sensitivity of 10pg and 10 copies and showed no cross-reactivity with any of the 35 clinically relevant fungi and bacteria. All extracted DNA showed amplified GAPDH gene demonstrating the absence of PCR inhibitors in extracted DNA. The sensitivity and specificity of the assay were 97.5% (95% CI: 86.8-99.9) and 97.6% (95% CI: 87.1-99.9). The turnaround time for RPA was 6 h.ConclusionReal-time RPA can be used to rapidly and reliably diagnose mucormycosis.

Bead-Based Multiplexed Droplet Digital Polymerase Chain Reaction in a Single Tube Using Universal Sequences: An Ultrasensitive, Cross-Reaction-Free, and High-Throughput Strategy.

The multiplexed digital polymerase chain reaction (PCR) is widely used in molecular diagnosis owing to its high sensitivity and throughput for multiple target detection compared with the single-plexed digital PCR; however, current multiplexed digital PCR technologies lack efficient coding strategies that do not compromise the sensitivity and signal-to-noise (S/N) ratio. Hence, we propose a fluorescent-encoded bead-based multiplexed droplet digital PCR method for ultra-high coding capacity, along with the creative design of universal sequences (primer and fluorescent TaqMan probe) for ultra-sensitivity and high S/N ratios. First, pre-amplification is used to introduce universal primers and universal fluorescent TaqMan probes to reduce primer interference and background noise, as well as to enrich regions of interest in targeted analytes. Second, fluorescent-encoded beads (FEBs), coupled with the corresponding target sequence-specific capture probes through streptavidin-biotin conjugation, are used to partition amplicons via hybridization according to the Poisson distribution. Finally, FEBs mixed with digital PCR mixes are isolated into droplets generated via Sapphire chips (Naica Crystal Digital PCR system) to complete the digital PCR and result analysis. For proof of concept, we demonstrate that this method achieves high S/N ratios in a 5-plexed assay for influenza viruses and SARS-CoV-2 at concentrations below 10 copies and even close to a single molecule per reaction without cross-reaction, further verifying the possibility of clinical actual sample detection with 100% accuracy, which paves the way for the realization of digital PCR with ultrahigh coding capacity and ultra-sensitivity.