Potent Aptamers Research Articles

New High-Affinity Thrombin Aptamers for Advancing Coagulation Therapy: Balancing Thrombin Inhibition for Clot Prevention and Effective Bleeding Management with Antidote.

Thrombin is a key enzyme involved in blood clotting, and its dysregulation can lead to thrombotic diseases such as stroke, myocardial infarction, and deep vein thrombosis. Thrombin aptamers have the potential to be used as therapeutic agents to prevent or treat thrombotic diseases. Thrombin DNA aptamers developed in our laboratory exhibit high affinity and specificity to thrombin. In vitro assays have demonstrated their efficacy by significantly decreasing Factor II activity and increasing PT and APTT times in both plasma and whole blood. Aptamers AYA1809002 and AYA1809004, the two most potent aptamers, exhibit high affinity for their target, with affinity constants (Kd) of 10 nM and 13 nM, respectively. Furthermore, the in vitro activity of these aptamers displays dose-dependent behavior, highlighting their efficacy in a concentration-dependent manner. In vitro stability assessments reveal that the aptamers remain stable in plasma and whole blood for up to 24 h. This finding is crucial for their potential application in clinical settings. Importantly, the thrombin inhibitory activity of the aptamers can be reversed by employing reverse complement sequences, providing a mechanism to counteract their anticoagulant effects when necessary to avoid excessive bleeding. These thrombin aptamers have been determined to be safe, with no observed mutagenic or immunogenic effects. Overall, these findings highlight the promising characteristics of these newly developed thrombin DNA aptamers, emphasizing their potential for therapeutic applications in the field of anticoagulation therapy. Moreover, the inclusion of an antidote in the coagulation therapy regimen can improve patient safety, ensure greater therapeutic efficacy, and minimize risk during emergency situations.

The Diagnostic Potential of RNA Aptamers against the NS1 Protein of Dengue Virus Serotype 2.

Dengue infection, caused by the dengue virus, is a global threat which requires immediate attention and appropriate disease management. The current diagnosis of dengue infection is largely based on viral isolation, RT-PCR and serology-based detection, which are time-consuming and expensive, and require trained personnel. For early diagnosis of dengue, the direct detection of a dengue antigenic target is efficacious, and one such target is NS1. NS1-based detection is primarily antibody-centric and is beset by drawbacks pertaining to antibodies such as the high cost of synthesis and large batch-to-batch variation. Aptamers are potential surrogates of antibodies and are much cheaper, without exhibiting batch-to-batch variation. Given these advantages, we sought to isolate RNA aptamers against the NS1 protein of dengue virus serotype 2. A total of 11 cycles of SELEX were carried out, resulting in two potent aptamers, DENV-3 and DENV-6, with dissociation constant values estimated at 37.57 ± 10.34 nM and 41.40 ± 9.29 nM, respectively. These aptamers can be further miniaturized to TDENV-3 and TDENV-6a with an increased LOD upon their usage in direct ELASA. Moreover, these truncated aptamers are highly specific against the dengue NS1 while showing no cross-reactivity against the NS1 of the Zika virus, the E2 protein of the Chikungunya virus or the LipL32 protein of Leptospira, with target selectivity retained even in human serum. The usage of TDENV-3 as the capturing probe and TDENV-6a as the detection probe underpinned the development of an aptamer-based sandwich ELASA for the detection of dengue NS1. The sensitivity of the sandwich ELASA was further improved with the stabilization of the truncated aptamers and the repeated incubation strategy, which enabled a LOD of 2 nM when used with the target NS1 spiked in human serum diluted at 1:2000.

Generation of an RNA aptamer against LipL32 of Leptospira isolated by Tripartite-hybrid SELEX coupled with in-house Python-aided unbiased data sorting

Leptospirosis is a potentially life-threatening zoonosis caused by pathogenic Leptospira. The major hurdle of the diagnosis of Leptospirosis lies in the issues associated with current methods of detection, which are time-consuming, tedious and the need for sophisticated, special equipments. Restrategizing the diagnostics of Leptospirosis may involve considerations of the direct detection of the outer membrane protein, which can be faster, cost-saving and require fewer equipments. One such promising marker is LipL32, which is an antigen with high amino acid sequence conservation among all the pathogenic strains. In this study, we endeavored to isolate an aptamer against LipL32 protein via a modified SELEX strategy known as tripartite-hybrid SELEX, based on 3 different partitioning strategies. In this study, we also demonstrated the deconvolution of the candidate aptamers by using in-house Python-aided unbiased data sorting in examining multiple parameters to isolate potent aptamers. We have successfully generated an RNA aptamer against LipL32 of Leptospira, LepRapt-11, which is applicable in a simple direct ELASA for the detection of LipL32. LepRapt-11 can be a promising molecular recognition element for the diagnosis of leptospirosis by targeting LipL32.

Isolation of a novel DNA aptamer against LipL32 as a potential diagnostic agent for the detection of pathogenic Leptospira.

Leptospirosis is a potentially life-threatening zoonosis caused by pathogenic Leptospira and for rapid diagnostics, direct detection is desirable. LipL32 protein is the most suitable biomarker for direct detection. DNA aptamers are sought to be generated against LipL32 by Systemic Evolution of Ligands via Exponential Enrichment (SELEX). LepDapt-5a is the most potent aptamer candidate among all the candidates, as determined by direct Enzyme-linked Aptasorbent Assay (ELASA). LepDapt-5a was predicted to form a G-quadruplex structure as predicted by QGRS Mapper and validated experimentally by direct ELASA. The diagnostic potential of the aptamer was further tested on a direct and sandwich ELASA platform. A LOD of 106 mL-1 and 105 mL-1 were estimated by direct and sandwich ELASA platforms, respectively, which are within the range associated with leptospiremia levels. The dot blot assay developed was able to attain a LOD of 104 CFU mL-1 against pathogenic Leptospira, which is also within the leptospiremia level. This is the first-ever DNA aptamer and hybrid-heterodimeric aptamer constructed against LipL32. The diagnostic potentiality of the LepDapt-5a DNA aptamer was proven on three major diagnostic platforms, which are direct ELASA, sandwich ELASA, and aptamer-based dot assay.

Beyond G-Quadruplexes-The Effect of Junction with Additional Structural Motifs on Aptamers Properties.

G-quadruplexes constitute an important type of nucleic acid structure, which can be found in living cells and applied by cell machinery as pivotal regulatory elements. Importantly, robust development of SELEX technology and modern, nucleic acid-based therapeutic strategies targeted towards various molecules have also revealed a large group of potent aptamers whose structures are grounded in G-quadruplexes. In this review, we analyze further extension of tetraplexes by additional structural elements and investigate whether G-quadruplex junctions with duplex, hairpin, triplex, or second G-quadruplex motifs are favorable for aptamers stability and biological activity. Furthermore, we indicate the specific and pivotal role of the G-quadruplex domain and the additional structural elements in interactions with target molecules. Finally, we consider the potency of G-quadruplex junctions in future applications and indicate the emerging research area that is still waiting for development to obtain highly specific and effective nucleic acid-based molecular tools.

High bio-recognizing aptamer designing and optimization against human herpes virus-5

While the world is tackling one of the direst health emergencies, it has come to light that in the fight against viruses, preparedness is everything. A disease with the initial symptoms of the common flu has the capacity to disrupt the life of 7.8 billion people and thus no infection and especially no virus can be ignored. Hence, we have designed the high bio-recognizing DNA aptamer for diagnosis and therapeutics role against glycoprotein-B (gB) of Human Herpes Virus-5 (HHV-5). HHV-5 is linked with epidemiological and asymptomatic diseases leading to high mortality. Herein, we report potent aptamer (5’CTCGCTTACCCCTGGGTGTGCGGG3’) which has high specificity to gB with energy score -523.28 kJ/mol, more than reference aptamer L19 (-363.50 kJ/mol). The stable binding of aptamer with gB was confirmed with atomic fluctuations 0.1 to 1.8 Å through anisotropic network analysis. Aptamer formed stem-loop conformation (-1.0 kcal/mol) by stochastic simulation and found stable with physicochemical properties. Importantly, aptamer was found biologically significant with consisting of putative transcription factors in its vicinity (SP1, GATA1, AP2, NF1) and also possesses homology with exonic sequence of SGSH gene which indicated regulatory role in blockade of viruses. Inaddition, we also proposed plausible mechanism of action of aptamer as antiviral therapeutics.

New synthetic route to ethynyl-dUTP: A means to avoid formation of acetyl and chloro vinyl base-modified triphosphates that could poison SELEX experiments

5-Ethynyl-2′-deoxyuridine is a common base-modified nucleoside analogue that has served in various applications including selection experiments for potent aptamers and in biosensing. The synthesis of the corresponding triphosphates involves a mild acidic deprotection step. Herein, we show that this deprotection leads to the formation of other nucleoside analogs which are easily converted to triphosphates. The modified nucleoside triphosphates are excellent substrates for numerous DNA polymerases under both primer extension and PCR conditions and could thus poison selection experiments by blocking sites that need to be further modified. The formation of these nucleoside analogs can be circumvented by application of a new synthetic route that is described herein.

Oligonucleotide-Based Mimetics of Hepatocyte Growth Factor.

Oligonucleotide-based hepatocyte growth factor (HGF) mimetics are described. A DNA aptamer to Met, a cognate receptor for HGF, was shown to induce Met activation when used in dimer form. The most potent aptamer dimer, ss-0, which was composed solely of 100-mer single-stranded DNA, exhibited nanomolar potency. Aptamer ss-0 reproduced HGF-induced cellular behaviors, including migration and proliferation. The present work sheds light on oligonucleotides as a novel chemical entity for the design of growth factor mimetics.

Oligonucleotide‐Based Mimetics of Hepatocyte Growth Factor

AbstractOligonucleotide‐based hepatocyte growth factor (HGF) mimetics are described. A DNA aptamer to Met, a cognate receptor for HGF, was shown to induce Met activation when used in dimer form. The most potent aptamer dimer, ss‐0, which was composed solely of 100‐mer single‐stranded DNA, exhibited nanomolar potency. Aptamer ss‐0 reproduced HGF‐induced cellular behaviors, including migration and proliferation. The present work sheds light on oligonucleotides as a novel chemical entity for the design of growth factor mimetics.

Searching the Sequence Space for Potent Aptamers Using SELEX in Silico.

To isolate functional nucleic acids that bind to defined targets with high affinity and specificity, which are known as aptamers, the systematic evolution of ligands by exponential enrichment (SELEX) methodology has emerged as the preferred approach. Here, we propose a computational approach, SELEX in silico, that allows the sequence space to be more thoroughly explored regarding binding of a certain target. Our approach consists of two steps: (i) secondary structure-based sequence screening, which aims to collect the sequences that can form a desired RNA motif as an enhanced initial library, followed by (ii) sequence enrichment regarding target binding by molecular dynamics simulation-based virtual screening. Our SELEX in silico method provided a practical computational solution to three key problems in aptamer sequence searching: design of nucleic acid libraries, knowledge of sequence enrichment, and identification of potent aptamers. Six potent theophylline-binding aptamers, which were isolated by SELEX in silico from a sequence space containing 4(13) sequences, were experimentally verified to bind theophylline with high affinity: Kd ranging from 0.16 to 0.52 μM, compared with the dissociation constant of the original aptamer-theophylline, 0.32 μM. These results demonstrate the significant potential of SELEX in silico as a new method for aptamer discovery and optimization.

Probing the Coagulation Pathway with Aptamers Identifies Combinations that Synergistically Inhibit Blood Clot Formation

Coordinated enzymatic reactions regulate blood clot generation. To explore the contributions of various coagulation enzymes in this process, we utilized a panel of aptamers against factors VIIa, IXa, Xa, andprothrombin. Each aptamer dose-dependently inhibited clot formation, yet none was able to completely impede this process in highly procoagulant settings. However, several combinations of two aptamers synergistically impaired clot formation. One extremely potent aptamer combination was able to maintain human blood fluidity even during extracorporeal circulation, a highly procoagulant setting encountered during cardiopulmonary bypass surgery. Moreover, this aptamer cocktail could be rapidly reversed with antidotes to restore normal hemostasis, indicating that even highly potent aptamer combinations can be rapidly controlled. These studies highlight the potential utility of using sets of aptamers to probe the functions of proteins in molecular pathways for research and therapeutic ends.

Probing high-affinity 11-mer DNA aptamer against Lup an 1 (β-conglutin)

Aptamers are synthetic nucleic acids with great potential as analytical tools. However, the length of selected aptamers (typically 60-100 bases) can affect affinity, due to the presence of bases not required for interaction with the target, and therefore, the truncation of these selected sequences and identification of binding domains is a critical step to produce potent aptamers with higher affinities and specificities and lowered production costs. In this paper we report the truncation of an aptamer that specifically binds to β-conglutin (Lup an 1), an anaphylactic allergen. Through comparing the predicted secondary structures of the aptamers, a hairpin structure with a G-rich loop was determined to be the binding motif. The highest affinity was observed with a truncation resulting in an 11-mer sequence that had an apparent equilibrium dissociation constant (K D) of 1.7 × 10(-9) M. This 11-mer sequence was demonstrated to have high specificity for β-conglutin and showed no cross-reactivity to other lupin conglutins (α-, δ-, γ-conglutins) and closely related proteins such as gliadin. Finally, the structure of the truncated 11-mer aptamer was preliminarily elucidated, and the GQRS Mapper strongly predicted the presence of a G-quadruplex, which was subsequently corroborated using one-dimensional NMR, thus highlighting the stability of the truncated structure.

Characterization and application of aptamers for Taq DNA polymerase selected using an evolution-mimicking algorithm

Using an evolution-mimicking algorithm (EMA), we have recently identified DNA aptamers that inhibit Taq DNA polymerase. In the present study, we have attempted to improve further the inhibitory activities of aptamers, as well as to characterize those aptamers with the most potent inhibitory activities. To characterize the most potent aptamer and demonstrate its applicability, the abilities to inhibit Tth DNA polymerase and to modulate specific amplification in PCR were investigated. This aptamer inhibited both Tth DNA polymerase and Taq DNA polymerase and improved the specificity of detection of a low-copy-number target gene in PCR using these DNA polymerases.

Differential Susceptibility of HIV-1 Reverse Transcriptase to Inhibition by RNA Aptamers in Enzymatic Reactions Monitoring Specific Steps during Genome Replication

Nucleic acid aptamers to HIV-1 reverse transcriptase (RT) are potent inhibitors of DNA polymerase function in vitro, and they have been shown to inhibit viral replication when expressed in cultured T-lymphoid lines. We monitored RT inhibition by five RNA pseudoknot RNA aptamers in a series of biochemical assays designed to mimic discrete steps of viral reverse transcription. Our results demonstrate potent aptamer inhibition (IC50 values in the low nanomolar range) of all RT functions assayed, including RNA- and DNA-primed DNA polymerization, strand displacement synthesis, and polymerase-independent RNase H activity. Additionally, we observe differences in the time dependence of aptamer inhibition. Polymerase-independent RNase H activity is the most resistant to long term aptamer suppression, and RNA-dependent DNA polymerization is the most susceptible. Finally, when DNA polymerization was monitored in the presence of an RNA aptamer in combination with each of four different small molecule inhibitors, significant synergy was observed between the aptamer and the two nucleoside analog RT inhibitors (azidothymidine triphosphate or ddCTP), whereas two non-nucleoside analog RT inhibitors showed either weak synergy (efavirenz) or antagonism (nevirapine). Together, these results support a model wherein aptamers suppress viral replication by cumulative inhibition of RT at every stage of genome replication.

Identification of Potent and Selective RNA Antagonists of the IFN-γ-Inducible CXCL10 Chemokine

CXCL10 (also known as IP-10 in humans and CRG-2 in mice) is a nonglycosylated chemokine and a member of the non-ELR CXC chemokine subfamily implicated in a variety of inflammatory conditions. The role of CXCL10 in different disease states still requires clarification, and new approaches are necessary to better understand its biological function. We report here the isolation of a series of nuclease-resistant RNA aptamers that act to antagonize human CXCL10 function in a number of in vitro and cell-based assays. The two most potent aptamers identified were highly selective for human CXCL10. A further aptamer was identified that antagonized both the human and the mouse CXCL10. A combination of a molecular-biology-based truncation and solid-phase synthesis enabled the truncation of one of the aptamers from 71 to 34 nucleotides. This was followed by PEGylation, 3' capping, and further stabilization of the RNA aptamer, while its high potency was maintained. These aptamers could be utilized as powerful target validation tools and may also have therapeutic potential. To our knowledge, the CXCL10 aptamers generated are the most potent antagonists of CXCL10/CXCR3 signaling reported to date.