Potato Mop-top Virus Research Articles

The potato mop-top virus TGB2 protein and viral RNA associate with chloroplasts and viral infection induces inclusions in the plastids.

The potato mop-top virus (PMTV) triple gene block 2 (TGB2) movement proteins fused to monomeric red fluorescent protein (mRFP-TGB2) was expressed under the control of the PMTV subgenomic promoter from a PMTV vector. The subcellular localizations and interactions of mRFP-TGB2 were investigated using confocal imaging [confocal laser-scanning microscope, (CLSM)] and biochemical analysis. The results revealed associations with membranes of the endoplasmic reticulum (ER), mobile granules, small round structures (1–2 μm in diameter), and chloroplasts. Expression of mRFP-TGB2 in epidermal cells enabled cell-to-cell movement of a TGB2 defective PMTV reporter clone, indicating that the mRFP-TGB2 fusion protein was functional and required for cell-to-cell movement. Protein-lipid interaction assays revealed an association between TGB2 and lipids present in chloroplasts, consistent with microscopical observations where the plastid envelope was labeled later in infection. To further investigate the association of PMTV infection with chloroplasts, ultrastructural studies of thin sections of PMTV-infected potato and Nicotiana benthamiana leaves by electron microscopy revealed abnormal chloroplasts with cytoplasmic inclusions and terminal projections. Viral coat protein (CP), genomic RNA and fluorescently-labeled TGB2 were detected in plastid preparations isolated from the infected leaves, and viral RNA was localized to chloroplasts in infected tissues. The results reveal a novel association of TGB2 and vRNA with chloroplasts, and suggest viral replication is associated with chloroplast membranes, and that TGB2 plays a novel role in targeting the virus to chloroplasts.

Prevalence and distribution of Potato mop‐top virus in Scotland

This study was undertaken to determine the current occurrence in Scottish seed potato crops of Potato mop‐top virus (PMTV), which is transmitted by Spongospora subterranea and causes spraing (brown arcs and lines) in the flesh of potato tubers, rendering them unsaleable. In 2004, a stratified survey of four commonly grown cultivars was conducted, while in 2007 and 2008, only samples from powdery scab‐affected crops were collected. The incidence of crops in which infection by PMTV was present was 37·5% in the stratified survey in 2004, but was greater in surveys in which tubers with powdery scab were tested (47·2% in 2007 and 44·6% in 2008). Similarly, the frequency of crops with incidences of more than 10% tuber infection was lower (9·4%) in 2004 than in 2007 (25·4%) and in 2008 (26·2%). Significant differences in crop infection were found amongst the four major seed‐producing regions and the counties within these regions. The incidence of crop and tuber infection was least for class Pre‐basic seed potatoes and greatest for class Super Elite 3 and Elite seed potatoes. The results indicate that the prevalence of PMTV has not increased since surveys in the early 1970s.

First Report of Potato mop-top virus on Potatoes in Washington State.

In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea, which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States.

Resistance to multiple viruses in transgenic tobacco expressing fused, tandem repeat, virus-derived double-stranded RNAs

Transgenic tobacco plants expressing fused, tandem, inverted-repeat, double-stranded RNAs derived either from the three viruses [potato virus Y (PVY), potato virus A (PVA), and potato leafroll virus (PLRV)] or the five viruses [PVY, PVA, PLRV as well as tobacco rattle virus (TRV), and potato mop-top virus (PMTV)] were generated in this study to examine whether resistance could be achieved against these three viruses or five viruses, respectively, in the same plant. The transgenic lines were engineered to produce 600- or 1000-bp inverted hairpin transcripts with an intron, in two orientations each, which were processed to silencing-inducing RNAs (siRNAs). Fewer lines were regenerated from the transformants with either 1000-bp inverted hairpin transcripts, or a sense-intron-antisense orientation versus antisense-intron-sense orientation. Resistances to PVA and two strains of PVY (-O and -N) were achieved in plants from most of lines examined, as well as resistance to co-infection by a mixture of PVY-O and PVA, applied to the plants by either rub inoculation or using aphids. This was regardless of the orientation of the inserted sequences for the 600-bp insert lines, but only for one orientation of the 1000-bp insert lines. The lines containing the 1000-bp inserts also showed resistance to infection by TRV inoculated by rub inoculation and PMTV inoculated by grafting. However, all the lines showed only low-to-moderate (15-43%) resistance to infection by PLRV transmitted by aphids. The resistances to the various viruses correlated with the levels of accumulation of siRNAs, indicating that the multiple resistances were achieved by RNA silencing.

Standardized RT-PCR Conditions for Detection and Identification of Eleven Viruses of Potato and Potato spindle tuber viroid

Standardized RT-PCR procedures were developed and validated for detection of Alfalfa mosaic virus (AMV), Impatiens necrotic spot virus (INSV), Tobacco rattle virus (TRV), Tomato spotted wilt virus (TSWV), Potato leaf roll virus (PLRV), Potato mop top virus (PMTV), Potato virus A (PVA), Potato virus M (PVM), Potato virus S (PVS), Potato virus X (PVX), Potato virus Y (PVY), and Potato spindle tuber viroid (PSTVd). Under the same conditions the O, N, NTN, and N:O strains of PVY could be differentiated using previously published multiplex primers.

The Role of Microtubule Association in Plasmodesmal Targeting of Potato mop-top virus Movement Protein TGBp1

Cell-to-cell movement of Potato mop-top virus (PMTV) is mediated by three virus-encoded ‘triple gene block’ (TGB) proteins termed TGBp1, TGBp2 and TGBp3. TGBp1 binds virus RNAs to form viral ribonucleoprotein complexes (vRNPs), the transport form of viral genome. TGBp2 and TGBp3 are necessary for intracellular delivery of TGBp1-containing vRNPs to plasmodesmata. To analyze subcellular localization and transport of TGBp1 we used a single binary vector for agrobacterium-mediated co-expression of PMTV TGBp1 fused to green fluorescent protein and TGBp2/TGBp3. At two days post infiltration (dpi) TGBp1 was found in the nucleus and in association with microtubules (MTs). Similar localization pattern was revealed in cells expressing GFP-TGBp1 alone after particle bombardment. At 3 dpi, in addition to the nucleus and MTs, TGBp1 was detected in numerous granular bodies located both along the MTs and at the cell wall. The latter structures co-localized with plasmodesmata-associated callose depositions. At 4 dpi, GFP-TGBp1 was detected in cell wall-associated bodies and also in residual MTs, the nucleoplasm and large perinuclear inclusions resembling aggresomes. Therefore GFP-TGBp1 association with MTs preceded to its localization to plasmodesmata. Disassembly of cell MTs by colchicine prevented GFP-TGBp1 targeting to plasmodesmata and the MT-dependent aggresome formation. Deletion analysis also revealed a correlation between TGBp1 microtubule association and plasmodesmata targeting. We propose that TGBp1 interaction with MTs may be important for the formation of vRNP bodies destined for the transport to plasmodesmata as well as degradation of the excessive TGBp1.

The Role of Microtubule Association in Plasmodesmal Targeting of Potato mop-top virus Movement Protein TGBp1

The Role of Microtubule Association in Plasmodesmal Targeting of Potato mop-top virus Movement Protein TGBp1

First Report of Potato mop-top virus in North Dakota.

Potato mop-top virus (PMTV) is the type member of the genus Pomovirus. PMTV is an important pathogen of potato, causing significant economic losses in Northern Europe, North and South America, and Asia (3). PMTV in the United States was first reported in Maine (2). PMTV is vectored by the plasmodiophoromycete Spongospora subterranea cv. subterranea, which causes powdery scab of potato (1). S. subterranea and PMTV are usually associated with cool and humid environments. In the spring of 2010, six potato tubers of cv. Russet Burbank were received from a commercial potato farm in Grand Forks County in North Dakota. The tubers had multiple, internal, concentric, necrotic arcs and circles. The presence of PMTV in the necrotic lesions was verified by a positive double-antibody sandwich-ELISA (Agden Ltd., Ayr, Scotland). The tuber lesions had an absorbance value (405 nm) at least two times greater than that of the negative control sample, which consisted of a healthy tuber. Total RNA was extracted from lesions of six different tubers that tested positive by ELISA using a Total RNA Isolation kit (Promega Corp. Madison, WI). These extracts were tested for PMTV by reverse transcription (RT)-PCR using two different sets of primers. The primer set H360/C819 targeted the coat protein (CP) of PMTV and yielded an amplicon of 460 bp (4). The amplicons generated from the necrotic lesions were cloned (TOPO Cloning; Invitrogen, Carlsbad, CA) and sequenced. Another set of primers, pmtF4/pmtR4, designed to bind to a region in RNA 2 of PMTV, yielded a 417-bp amplicon that also was cloned and sequenced (3). The sequences from all six tuber lesions were identical for the respective primer sets. A consensus sequence for each primer pair was submitted to GenBank (Accession No. HM776171 for primers pmtF4/pmtR4 and No. HM776172 for primers H360/C819). The sequences obtained from the H360/C819 and pmtF4/pmtR4 amplicons were 99% identical to the corresponding regions of PMTV isolates from Northern Europe (GenBank Accession Nos. AM503629 and AJ277556, respectively). Freeze-dried, necrotic tuber tissue from all six tubers was also tested at a USDA Laboratory in Prosser, WA by RT-PCR with the H360/C819 primer pair (4), confirming the results above. Cloning and sequencing of one of the amplicons revealed 100% similarity to the sequence described above for these primers (GenBank Accession No. HM776172), confirming the presence of PMTV in the symptomatic tubers. None of the symptomatic tubers tested positive for Tobacco rattle virus, Tomato spotted wilt virus, Alfalfa mosaic virus, Potato leafroll virus, or the necrotic strains of Potato virus Y by RT-PCR. To our knowledge this is the first report of PMTV in North Dakota.

The N-Terminal Domain of PMTV TGB1 Movement Protein Is Required for Nucleolar Localization, Microtubule Association, and Long-Distance Movement

The triple-gene-block (TGB)1 protein of Potato mop-top virus (PMTV) was fused to fluorescent proteins and expressed in epidermal cells of Nicotiana benthamiana under the control of the 35S promoter. TGB1 fluorescence was observed in the cytoplasm, nucleus, and nucleolus and occasionally associated with microtubules. When expressed from a modified virus (PMTV.YFP-TGB1) which formed local lesions but was not competent for systemic movement, yellow fluorescent protein (YFP)-TGB1 labeled plasmodesmata in cells at the leading edge of the lesion and plasmodesmata, microtubules, nuclei, and nucleoli in cells immediately behind the leading edge. Deletion of 84 amino acids from the N-terminus of unlabeled TGB1 within the PMTV genome abolished movement of viral RNA to noninoculated leaves. When the same deletion was introduced into PMTV.YFP-TGB1, labeling of microtubules and nucleoli was abolished. The N-terminal 84 amino acids of TGB1 were fused to green fluorescent protein (GFP) and expressed in epidermal cells where GFP localized strongly to the nucleolus (not seen with unfused GFP), indicating that these amino acids contain a nucleolar localization signal; the fusion protein did not label microtubules. This is the first report of nucleolar and microtubule association of a TGB movement protein. The results suggest that PMTV TGB1 requires interaction with nuclear components and, possibly, microtubules for long-distance movement of viral RNA.

Application of cDNA Macroarray for Simultaneous Detection of 12 Potato Viruses.

A complementary DNA (cDNA) macroarray was developed for simultaneous detection of 12 different potato viruses. A suitable region in the viral genome for each was selected for Alfalfa mosaic virus, Cucumber mosaic virus, Potato aucuba mosaic virus, Potato leafroll virus, Potato mop-top virus, Potato virus A, Potato virus M, Potato virus S, Potato virus X, Potato virus Y, Tomato ringspot virus, and Tomato spotted wilt virus, and their respective cDNAs were cloned into plasmid vectors. Capture probes for each virus ranging from 290 to 577 bp were generated by polymerase chain reaction (PCR) and immobilized on a nylon membrane. Total RNAs were extracted from each of these virus infected-plants, and cDNAs were synthesized from the RNA extracts using a random 9-mer primer. Subsequently, PCR reactions were performed using one primer pair for each of the 12 viruses. During PCR, amplified cDNAs were labeled with biotin and used as a target for hybridization analyses on a macroarray membrane. Hybridization signals between capture probes for the 12 viruses and their respective target cDNAs were observed using chemiluminescent or colorimetric detection. In all viruses, hybridization signals with capture probes were detected only when homologous virus targets were examined, and no hybridization to healthy plant extract was observed, facilitating identification of each virus. The results by colorimetric detection agreed with those obtained using chemiluminescence. The macroarray method developed was 5 × 102 to 4 × 106 times more sensitive than enzyme-linked immunosorbent assay and 5 to 5 × 104 times more sensitive than reverse-transcription PCR, except for Alfalfa mosaic virus. Colorimetric detection and substantial reduction in cross-hybridization signals much improved the method compared with other array-based detection methods for practical use.

Detection, distribution and control of Potato mop‐top virus, a soil‐borne virus, in northern Europe

Potato mop‐top virus (PMTV; genus Pomovirus; family Virgaviridae) is transmitted by the soil‐borne Spongospora subterranea f.sp. subterranea, a protoctist that causes powdery scab on potato. PMTV is distributed widely in the potato growing areas in South and North America, Japan and northwestern Europe. This article reviews the current knowledge on detection, distribution and control of PMTV with focus on the Baltic Sea region. Since the 1980s, PMTV has caused great economic losses to potato production in the Nordic countries (Norway, Sweden, Denmark and Finland), but its occurrence in other countries of the Baltic Sea region remained unknown. To fill this knowledge gap, harmonised sampling and virus detection procedures including bioassays and serological and molecular methods were employed by 21 research institutions to detect PMTV in potato tubers and soil samples in 2005–2008. Potato growing areas were widely contaminated with PMTV in the Nordic countries. Only the main seed potato production area in northern Sweden and the High Grade seed potato production zone in Finland were negative for PMTV. Intensive and systematic surveys in Poland in 2004–2008 found no evidence of PMTV, except a single PMTV‐infected tuber detected in 2008. Surveys in the Baltic countries (Lithuania, Latvia and Estonia) and northwestern Russia (Leningrad province) were negative for PMTV, except infection of minitubers in a screenhouse in Latvia in 2005. Varying percentages of tubers expressing spraing symptoms in Sweden, Norway, Denmark and Poland were infected with Tobacco rattle virus, and bioassays indicated similar results for Russia. Incidence of symptomless infections with PMTV was high in tubers of many potato cultivars. Here, we discuss the contrasting patterns of distribution of PMTV in the Baltic Sea region, factors playing a role in dispersal and establishment of PMTV in new fields and means for controlling PMTV and its spread to new areas. We emphasise the use of the current virus‐specific methods for the detection of PMTV in symptomless potato tubers and the high risks of disseminating PMTV to new fields and areas in viruliferous resting spores of S. subterranea in the soil adhering to seed tubers. PMTV‐resistant potato cultivars will provide the only sustainable means for preventing yield losses in the infested fields and the prospects of resistance breeding are summarised.

First Report of Potato mop-top virus on Potato in Poland.

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production.

Foliar Symptoms Caused by Potato mop-top virus on Potato Plants During Vegetative Propagation in Scotland and Their Association With Tuber Yield, Spraing and Tuber Infection

The effect of foliar symptomatic infection by Potato mop-top virus (PMTV) on yield of tubers, spraing and infection in daughter tubers, and foliar symptom development and tuber infection in the following generations of propagation was investigated in commercial seed potato crops in Scotland. Six crops covering cvs Atlantic, Hermes, Nicola and Cara were studied between 2000 and 2006 by labelling paired replicates of plants with foliar symptoms and plants with no symptoms. Tubers from plants with no symptoms rarely produced plants with foliar symptoms in the following generation. Plants with no symptoms produced more infected tubers if they had been derived from plants with foliar symptoms the previous year than from plants with no symptoms. The proportion of daughter plants with foliar symptoms produced by tubers from plants with foliar symptoms in year 1 ranged from 19–41% and seemed to be associated with the severity of foliar symptoms. The detection of PMTV by ELISA in samples of leaves from plants with foliar symptoms ranged from 13% for cv. Cara to 59% for a crop of cv. Atlantic in 2004. The amounts of spraing were generally low but tended to be greater for tubers from plants with foliar symptoms than those from plants with no symptoms. These results indicate that roguing plants with foliar symptoms in seed potato crops could achieve an improvement in crop health but might be impractical when diseased plants are too prevalent.

Diagnosis of Potato Mop-Top Virus in Soil Using Bait Plant Bioassay and RT-PCR-microplate Hybridization

Spraing (brown rings or arcs) of potato caused by Potato mop-top virus (PMTV) occurred in a field of Tokachi, Hokkaido, Japan in 2005. To monitor the expansion of spraing-affected areas, we developed a soil diagnostic method that consisted of a bioassay using tomato as bait plant to trap the vector of PMTV, Spongospora subterranea, the causal agent of powdery scab of potatoes, followed by reverse transcription-polymerase chain reaction-microplate hybridization (RT-PCR-MPH) to detect the virus from roots of bait plants. After incubation of tomato seedlings grown with their roots immersed in a soil suspension at 18°C for 9 days, total RNA extracted from bait roots was analyzed by RT-PCR-MPH using PMTV-specific primers and a digoxigenin (DIG)-labeled probe. Soil diagnosis using the present method in an infested area revealed 137 of 224 fields (61.2%) were infested by PMTV although tubers harvested from only one of these fields had spraing.

Effect of temperature on the transmission of Potato mop‐top virus from seed tuber and by its vector, Spongospora subterranea

Potato mop‐top virus (PMTV) causes disease in both the growing plant and tubers (spraing) of potato and is transmitted by the plasmodiophorid Spongospora subterranea, the cause of powdery scab. The effect of temperature during plant growth on the transmission of PMTV from infected seed tubers and from infested growing media was investigated in a series of glasshouse experiments. Symptoms developed on foliage of plants derived from infected seed tubers but none developed when PMTV was transmitted by S. subterranea in soil. The incidence of foliar symptoms was greatest on plants grown at 12°C, less at 16°C, few at 20°C and absent at 24°C. The transmission of PMTV from infected seed tubers was not significantly affected by temperatures between 12 and 24°C, but when the virus was transmitted by S. subterranea, minimal tuber infection occurred at 24°C and no differences were recorded at temperatures between 12 and 20°C. The incidence of powdery scab on tubers was greatest at 12 and 16°C and very low at 20 and 24°C. However, the incidence and severity of root galling caused by S. subterranea, was greatest at 20 and very low at 24°C. The incidence of powdery scab was greater on tubers of plants derived from infected seed tubers grown in a fluctuating temperature regime of 12 h at 20°C followed by 24 h at 12°C than on those grown at a constant 20°C, whereas the incidence of tuber infection by PMTV and spraing was similar for both regimes. This demonstrates that infection of roots can occur at a higher temperature than that for powdery scab on tubers and that this root infection can enable the transmission of PMTV into the potato plant.

First Report of Tobacco rattle virus Associated with Corky Ringspot in Potatoes Grown in North Dakota

Tobacco rattle virus (TRV) belongs to the genus Tobravirus and causes a stem mottle of potato (Solanum tuberosum) foliage and necrotic arcs and rings in tubers referred to as corky ringspot. This virus is generally transmitted by a number of species of stubby-root nematode. The virus is widespread and has been reported in California, Colorado, Florida, Idaho, Michigan, Oregon, Washington, Minnesota, and Wisconsin (2). In the spring of 2009, we received potato tubers of cv. Russet Burbank with internal necrotic arcs very similar to those caused by TRV from potato storages located in Grand Forks and Dickey counties of North Dakota. Total RNA was extracted from the necrotic lesions of two tubers from each location using the Total RNA Isolation kit (Promega Corp., Madison WI). These extracts were tested for TRV by reverse transcription (RT)-PCR using primers complementary to nucleotides 6555 to 6575 (Primer A) and identical to nucleotides 6113 to 6132 (Primer B) within the 3' terminus of TRV-SYM RNA-1 (GenBank Accession No. X06172) (3). The expected 463-bp amplicons from two separate tuber samples from each county were cloned (TOPO Cloning; Invitrogen, Carlsbad, CA) and sequenced. The sequences obtained from the four clones at both locations were found to be identical to each other and were 99% identical to the corresponding regions of TRV isolates from Michigan and Florida (GenBank Accession Nos. EU315226.1 and AF055912.1, respectively). Since sequences from all four clones were identical, only one of the sequences was submitted to Genbank (Accession No. GQ223114) and thus represents a consensus sequence. The extracts also tested positive in RT-PCR with a second set of primers corresponding to sequences in TRV RNA-2 yielding a 3.8-kbp amplicon (1). No evidence was found by RT-PCR for several other viruses that cause tuber necrosis in potato (Potato mop top virus, Tomato spotted wilt virus, Alfalfa mosaic virus, and tuber necrosis strains of Potato virus Y). The virus was mechanically transmitted by inoculating sap from symptomatic tubers from both counties to tobacco cv. Samsun NN, which showed typical bright yellow patches and spots on leaves 2 weeks postinoculation. TRV was confirmed in tobacco by RT-PCR from total RNA extracted from tobacco leaves with both sets of the aforementioned primers. To our knowledge, this is the first report of TRV in North Dakota and the first report of corky ringspot disease of potato in this state.

Difference in resistance to spraing caused by Potato mop-top virus among major potato cultivars in Japan and its relationship with resistance to powdery acab

Difference in resistance to spraing caused by <i>Potato mop-top virus </i>among major potato cultivars in Japan and its relationship with resistance to powdery acab

An efficient diagnostic method for the identification of potato viral pathogens

Potato is commonly affected by various pathogens of viral, bacterial, and fungal origin; therefore, simple and accurate diagnostic and identification techniques are of key importance both for the production of virus free planting material and for the monitoring of the phytosanitary state of planting areas. The newly developed test systems based on qualitative fluorescent amplification-based specific hybridization (FLASH-PCR) enable fast and accurate diagnostics of the major potato pathogens, i.e. potato viruses A, Y, X, M, and S, potato leaf roll virus, potato mop top virus, as well as potato spindle tuber viroid, while minimizing the risk of the working zone contamination.

Detection of Potato mop-top virus in Potato Tubers and Sprouts: Combinations of RNA2 and RNA3 Variants and Incidence of Symptomless Infections

Potato mop-top virus (PMTV, genus Pomovirus) causes severe quality problems by inducing necrotic arcs (spraing symptoms) in potato tubers. In this study, coat protein (CP) gene and read-through domain of RNA2 and 8K gene and 3' untranslated region of RNA3 were characterized from 37 PMTV isolates detected in tubers from fields in Finland and a screenhouse in Latvia. Two distinguishable types of RNA2 and RNA3 were found, each showing only little genetic variability. Sequencing and restriction fragment length polymorphism analysis of polymerase chain reaction amplicons indicated that the majority of PMTV isolates infecting tubers comprise restrictotypes RNA2-II and RNA3-B. The incidence of PMTV-infected tubers in 2006 (2007) was 55 (60), 33 (39), and 62 (68)% in cvs. Kardal, Saturna, and Nicola, respectively, grown in the same field in 2006 (2007). Incidence of PMTV-infected tubers that were symptomless was 100 (90)% in Kardal and 88 (44)% in Saturna, and also high in cvs. Bintje (95%) and Van Gogh (63%), tested only in 2006, whereas it was only 12 (2)% in Nicola. Hence, reliance on visual inspection of spraing will miss a large proportion of infected tubers and risk spreading PMTV to new fields in seed tubers. No specific combination of the types of RNA2 and RNA3 was associated with spraing-expressing or symptomless tubers. Using recombinant PMTV CP for comparison, the concentrations of PMTV CP in tuber and sprout tissue were estimated to reach 57 mug/g. Sprout sap interfered less with enzyme-linked immunosorbent assay than did tuber sap.

Unusual Long-Distance Movement Strategies of Potato mop-top virus RNAs in Nicotiana benthamiana

The Potato mop-top virus (PMTV) genome encodes replicase, movement, and capsid proteins on three different RNA species that are encapsidated within tubular rod-shaped particles. Previously, we showed that the protein produced on translational readthrough (RT) of the coat protein (CP) gene, CP-RT, is associated with one extremity of the virus particles, and that the two RNAs encoding replicase and movement proteins can move long distance in the absence of the third RNA (RNA-CP) that encodes the capsid proteins, CP and CP-RT. Here, we examined the roles of the CP and CP-RT proteins on RNA movement using infectious clones carrying mutations in the CP and CP-RT coding domains. The results showed that, in infections established with mutant RNA-CP expressing CP together with truncated CP-RT, systemic movement of the mutant RNA-CP was inhibited but not the movement of the other two RNAs. Furthermore, RNA-CP long-distance movement was inhibited in a mutant clone expressing only CP in the absence of the CP-RT polypeptide. CP-RT was not necessary for particle assembly because virions were observed in leaf extracts infected with the CP-RT deletion mutants. RNA-CP moved long distance when protein expression was suppressed completely or when CP expression was suppressed so that only CP-RT or truncated CP-RT was expressed. CP-RT but not CP interacted with the movement protein TGB1 in the yeast two-hybrid system. CP-RT and TGB1 were detected by enzyme-linked immunosorbent assay in virus particles and the long-distance movement of RNA-CP was correlated with expression of CP-RT that interacted with TGB1; mutant RNA-CP expressing truncated CP-RT proteins that did not interact with TGB1 formed virions but did not move to upper noninoculated leaves. The results indicate that PMTV RNA-CP can move long distance in two distinct forms: either as a viral ribonucleoprotein complex or as particles that are most likely associated with CP-RT and TGB1.