Post-agricultural Soils Research Articles

Mycobiome of Post-Agricultural Soils 20 Years after Application of Organic Substrates and Planting of Pine Seedlings

A 20-year study of a pine stand on post-agricultural land showed that woody debris in the form of organic matter can be successfully used to restore symbiotic mycorrhizal communities, as is the case with forest soils. Woody substrates restored organic matter in soils altered by long agricultural use and had a positive effect on the composition of mycobiota antagonistic to pathogens, especially to Heterobasidion annosum, the causal agent of the dangerous disease root and stump rot of many forest tree species, including stands of Pinus sylvestris (L.). In a study that started in 2001 in the forest district of Czarne Człuchowskie (northern Poland), the following organic materials were used: wood residues (W), sawdust (S), bark compost (B), and compost applied to the root zone during planting (G). The organic materials were spread in the form of mulch over the entire area during planting. After twenty years, it was found that the substrates used provided suitable growth conditions for mycobiome useful for pines. The addition of organic matter did not change the alpha biodiversity of the soil, but in the long term led to significant changes in the composition of mycobiota (beta biodiversity). The changes in the soil after the addition of organic material naturally accelerated the formation of the forest habitat. A number of fungi evolved that degraded added lignin and cellulose while being antagonists of H. annosum and other pine pathogens. In particular, the well-known hyperpathogens of the genus Trichoderma played an important role by promoting resistance of the soil environment to pathogens. Soil enrichment by bark compost and wood residues increased the relative abundance of Trichoderma more than fourfold.Mycorrhizal fungi became dominant in soil enriched with organic matter. After enriching the soil with bark compost, the relative abundance of Amphinema and Inocybe increased to 5%. The relative abundance of Russula in soil enriched with wood residues and sawdust increased to 9% and 5%, respectively. Mycorrhizal fungi, e.g., of the genus Ąmanita, Rusula, which formed root mycorrhizae, not only increased the root receiving area many times over, but also protected the roots (mechanically and chemically from pathogens). Altogether, the observed positive changes increase the chances that the first generation of pines will survive on the ground.

Microbial growth rates, carbon use efficiency and enzyme activities during post-agricultural soil restoration

Microorganisms are critical for litter decomposition, organic carbon (C) and nutrient transformations in soil, corresponding to the vegetation succession. The dynamics of microbial activities and ecological functions during the soil recovery after agricultural land use (post-agricultural restoration) remains unclear. We investigated the effects of vegetation and soil restoration duration on active microbial biomass, microbial growth rates, C use efficiency (CUE, analyzed by 14C glucose utilization), and enzyme activities in three soil types of Russia: Haplic Luvisol in a deciduous forest (chronosequence from 0 to 37 years), Luvic Phaeozem in forest steppe (0–66 years), and Haplic Phaeozem in forest steppe (0–42 years). The microbial CUE (0.66–0.82) decreased during restoration and was highly dependent on soil type: the lowest in Luvisol and the highest in Haplic Phaeozem. The activities of β-1,4-glucosidase, β-1,4-N-acetylglucosaminidase, leucine aminopeptidase, and acid phosphatase increased during post-agricultural restoration. Microbial growth rates and the proportion of active microorganisms increased with restoration, reflecting a shift of microbial community to fast-growing decomposers (mainly r strategists) caused by large litterfall from recovered natural vegetation. The increase of the portion of active microorganisms and microbial growth rates was correlated with activities of enzymes responsible for C, N and P cycling. In conclusion, the post-agricultural restoration activates microorganisms, raises microbial growth, increases enzyme activities and accelerates microbially-mediated C and nutrient turnover.

Fungi Occurring in Norway Spruce Wood Decayed by Heterobasidion parviporum in Puszcza Borecka Stands (Northeastern Poland)

In many spruce stands, trees are frequently attacked by the pathogen Heterobasidion parviporum, albeit without visible symptoms in the crown. In the present work, the results of the presence of stem rot, assessed by PICUS Sonic Tomography, and the fungal biota on trees and stumps in eight plots in the Puszcza Borecka Forest are described. The plots were located in stands on original forest soil (4) and on post-agricultural soil (4), where around a stump with H. parviporum symptoms (signs of internal rot and basidiocarps), 30 trees were selected and examined for internal rot. Wood samples were collected from two selected trees for fungal molecular analysis. A total of 79 fungal taxa were found, including 57 taxa in plots on post-agricultural soil and 45 on forest soil. There were 395 fungal records on stumps and 22 records on trees, therein, from the inner parts of felled trunks. Significant differences in the Chao-1 diversity index indicate that the origin of the soil—post-agricultural or forest soil—influenced the alpha diversity of the fungal communities in the forests studied. The values of the Shannon and Simpson indices show that the two communities were similar in terms of species numbers. The presence of basidiomata of H. parviporum and two species of Armillaria (mainly A. cepistipes) in samples on all plots is striking, although Armillaria spp. was detected more frequently. Most of the species identified were typical saprotrophs, although rare species were also found, such as Entoloma byssisedum, Onnia tomentosa, Physisporinus vitreus, Postia ptychogaster, and Ramaria apiculata. The presence of H. parviporum in the inner woody parts was confirmed by PCR analysis, and decay was detected even up to a stem height of 6 m. Armillaria was the dominant genus in the studied stands and plays a significant and underestimated role in heartwood decay of old spruce trees in Puszcza Borecka Forest.

Soil Organic Matter, Soil Structure, and Bacterial Community Structure in a Post-Agricultural Landscape

Converting forest and wetland landscapes to agriculture has shown to result in a loss of organic matter, structure, and microbial diversity in the converted soil but recovery of post-agricultural soils remains poorly understood. Here we coupled landscape-scale surveys of soil 1) carbon and nitrogen levels, 2) aggregation, and 3) bacterial metagenomes to investigate soil recovery after 30 years in sites with soils ranging from well drained to poorly drained. Sites with no evidence of past agriculture (Reference) served as recovery endpoints. A secondary aim evaluated the role of nitrogen-fixing symbiosis, here associated with alder (Alnus incana) trees, in soil restoration. Soil carbon levels in restored sites (3.5%) were comparable to levels in a present-day farm (3.4%) but much lower than in Reference sites (>7.3%). The same trend occurred with soil nitrogen levels. Sites with alder trees had more acidic soil pH values. Alder trees promoted soil structure with macroaggregates being the largest fraction of bulk soil (75%). Natural abundance of stable nitrogen isotopes suggested extensive decay of organic matter within aggregates. Comparison of total reads from the soil metagenomes indicated the bacterial community in restored sites were more comparable to the present-day farm than Reference sites, except for a well-drained soil with alder. Dissimilarity among sites in terms of gene abundances in soil bacterial community occurred in carbon metabolism, membrane transport, and genetic repair pathways. Soil recovery in post-agricultural landscapes is slow when agriculture caused a large loss of soil organic matter, as is the case in our study, and when the soil bacterial community structure changed markedly, as it did in our study. However, fairly rapid recovery of soil structure, as we noted in our study, is promising, and now we need a better understanding of plant species that improve soil structure for restoration of both well-drained and poorly drained soils.

The impact of revitalization treatments on biological activity of soil under afforestation on post-agricultural land

In Poland, afforestation is usually carried out on the weakest soils, excluded from agricultural use and wasteland, i.e. post-agricultural land. A characteristic feature of such habitat is poor-quality soil, relatively high content of nutrients for trees, particularly nitrogen, as well as a low level of humus. This is important for the quality of microbiological processes occurring in post-agricultural soils. Restitution of the forest in such a habitat requires the use of various revitalisation treatments for improving soil quality and increasing biological activity and soil fertility. This article presents the results of a long-term experiment on the effectiveness of various revitalisation treatments (zoo- and phytomelioration) on afforested post-agricultural lands after more than 30 years from their application in pine forests in north-western Poland. These treatments consisted of introducing additional organic matter into the soil in the form of bark and sawdust, sowing lupine and introducing soil fauna. The comparative area for afforestation on post-agricultural soils in the presented experiment was the area of forest soils, located in the same habitat, in a pine stand, at the same time. Biological activity of soil was measured with the activity of soil enzymes dehydrogenases and acid phosphatase, the biomass of microorganisms was measured and the content of total dissolved carbon and nitrogen was also determined.

The Wood of Scots Pine (Pinus sylvestris L.) from Post-Agricultural Lands Has Suitable Properties for the Timber Industry

Scots pine (Pinus sylvestris L.) is a widespread species throughout Europe and at the same time is dominant in Polish forests and of key importance in the wood industry. Pine stands are subjected to numerous environmental stresses, and one of them is the different physico-chemical and biological properties of post-agricultural soils compared to forest soils, which may affect the properties of the resulting wood and its industrial suitability. The research material taken at the height of 1.3 m from tree trunks (breast height diameter, dbh) in the form of sections and discs was collected in an 80-year-old pine stand from four plots, representing former agricultural and ancient forest land, and two types of habitats: fresh coniferous forest and fresh mixed coniferous forest. The forest habitat trophy had a decisive impact on the dendrometric characteristics and properties of pine wood (density, modulus of elasticity, bending strength, and compressive strength along the tracheids). The history of soil use (post-agricultural or forestry) did not affect the analyzed pine wood properties. Regardless of the forest habitat type and soil type history, pine wood at the dbh height showed a variability of features typical of century-old cultivated stands. Individual pine trunks were characterized by significant individual variability.

Effects of sewage sludge supplementation on heavy metal accumulation and the expression of ABC transporters in Sinapis alba L. during assisted phytoremediation of contaminated sites.

ATP binding cassette (ABC) transporters, types C, G, and B were monitored via qPCR in order to investigate the influence of heavy metal (HM) contamination of post-industrial and post-agricultural soils and the effects of its supplementation with sewage sludge, on Sinapis alba plants. Five house-keeping genes were selected and validated to ensure the best reference points. The relative expression of ABC types C and G genes was profoundly affected by experimental conditions and included their upregulation after plants exposure to heavy metals and downregulation after supplementation with sewage sludge. However, ABC type C was more responsive then type G. The experimental conditions altered the expression of ABC type C gene faster than ABC type G and thus, the expression of ABC type C can therefore potentially be used as a bioindicator during assisted phytoremediation of degraded sites. In clean soil, supplementation with sewage sludge with a slight content of heavy metals still caused an upregulation in the expression of ABC types C and G, which showed that proper toxicity assessments are necessary to ensure safe application of sewage sludge into soils. Results showed that the analysed genes take a significant part in plants metal detoxification and that their expression is regulated at transcriptional level after exposure to soil contaminated with heavy metals by both, industrial activities and by sewage sludge supplementation. Thus, their expression can potentially be used as an early-warning biomarker when soil supplementation with sewage sludge is incorporated into the soil-management process.

Vegetation restoration and organic matter accumulation on former agricultural lands in the boreal zone of Russia

This work investigates the influence of vegetation succession processes on the soil changes of former arable lands. It was noted that on post-agricultural soils, accumulation of organic matter in the soil differs, depending on the state of the land plot. The analysis shows that influence of vegetation on the accumulation of organic matter in the former arable horizon has a distinctly linear nature. The dominant species are mesotrophic and mesophyte plants, requiring little more than soils with mineral nutrients and sufficient humidity. The amount of organic matter accumulated in the upper horizon of the soil is greater than that of the underlying horizon. The content of organic matter in the soil horizons of the studied area is characterized by a distinct decreasing pattern in the direction from the forest edge to the field edge. Overall, it can be noted that farther away from the forest edge, the soils change from moderately acidic to slightly acidic. At this stage, depending on the succession state of the post-agricultural soil plot, the amount of organic matter in it is determined either by the species forming the soil cover and (or), to a greater extent, by tree and shrub vegetation. The optimum of the organic matter accumulation shifts to the zone with a large share of tree species.

From Farms to Forests: Landscape Carbon Balance after 50 Years of Afforestation, Harvesting, and Prescribed Fire

Establishing reliable carbon baselines for landowners desiring to sustain carbon sequestration and identify opportunities to mitigate land management impacts on carbon balance is important; however, national and regional assessments are not designed to support individual landowners. Such baselines become increasingly valuable when landowners convert land use, change management, or when disturbance occurs. We used forest inventories to quantify carbon stocks, estimate annual carbon fluxes, and determine net biome production (NBP) over a 50-year period coinciding with a massive afforestation effort across ~80,000 ha of land in the South Carolina Coastal Plain. Forested land increased from 48,714 ha to 73,824 ha between 1951 and 2001. Total forest biomass increased from 1.73–3.03 Gg to 17.8–18.3 Gg, corresponding to biomass density increases from 35.6–62.2 Mg ha−1 to 231.4–240.0 Mg ha−1. Harvesting removed 1340.3 Gg C between 1955 and 2001, but annual removals were variable. Fire consumed 527.1 Gg C between 1952 and 2001. Carbon exported by streams was <0.5% of total export. Carbon from roots and other harvested material that remained in-use or in landfills comprised 49.3% of total harvested carbon. Mineral soil carbon accounted for 41.6 to 50% of 2001 carbon stocks when considering depths of 1.0 or 1.5 m, respectively, and was disproportionately concentrated in wetlands. Moreover, we identified a soil carbon deficit of 19–20 Mg C ha−1, suggesting opportunities for future soil carbon sequestration in post-agricultural soils. Our results provide a robust baseline for this site that can be used to understand how land conversion, forest management, and disturbance impacts carbon balance of this landscape and highlight the value of these baseline data for other sites. Our work also identifies the need to manage forests for multiple purposes, especially promotion of soil carbon accumulation in low-density pine savannas that are managed for red-cockaded woodpeckers and therefore demand low aboveground carbon stocks.

Soil Organic Carbon Accumulation in Post-Agricultural Soils under the Influence Birch Stands

The aim of this study was to demonstrate the effects birch renewal on the soil organic carbon accumulation and on dehydrogenase activity. We selected 12 research plots with birch stands of different ages (1–4 years, 5–8 years, 9–12 years, and 13–17 years) to determine soil texture, pH, total carbon and nitrogen levels, and base cation content. The total organic carbon stock was calculated for the soil profiles. Additionally, dehydrogenase activity was determined. Naturally regenerated birch stands on post-agricultural land facilitated carbon accumulation. Based on our results, dehydrogenase activity is useful in assessing the condition of post-agricultural soils, and its determination allowed for us to assess the processes occurring in post-agricultural soils that are associated with the formation and carbon distribution.

Survey of some attributes of post-agricultural lands in Polish State Forests

Based on materials gained in March 2015 from the Forest Data Bank the survey of some attributes (forest address including Regional Directorate of State Forest (RDSF), area in hectares, soil unit, forest site type, dominant species in a forest stand and age of the dominant species in a stand) of post-agricultural lands occurring in Polish State Forests was conducted in the paper. Distribution of post-agricultural lands in Poland by RDSF as well as the structure of soil units, forest site types, dominant tree species and the age of the species was presented and analyzed in the article. Distribution of post-agricultural lands is not regular in regions of Poland as the highest share of such lands in the total area of State Forests was stated for a northern part of the country (RDSF in Szczecinek, Pila and Olsztyn) and the lowest for central-southern regions (RDSF in Katowice, Radom and Krakow). In spite Brunic Arenosols distinctly prevail in cover of post-agricultural lands occurring in State Forests (65.8%) the soil unit is not the dominant one in all regions of Poland. Namely, in RDSF located in mountainous and upland areas Cambisols and Luvisols predominate. In terms of forest site types structure, mesotrophic sites clearly prevail in post-agricultural lands as two forest site types (fresh mixed coniferous forest and fresh mixed broadleaved forest) cover 62.4% of all such lands. In spite Scots pine ( Pinus sylvestris L.) is the main tree species overgrowing post-agricultural soils in Polish State Forests the share of the species in young plantations established in last two decades has clearly decreased. It has resulted from appearing since 1990s an increasing importance of ecologisation of forestry in Poland what has been reflected e.g. in a distinctly increase of a share of broadleaved species in young plantations introduced on post-agricultural lands in last decades. The trend has especially pertained oak species ( Quercus petraea and Q. robur ) and beech ( Fagus sylvatica ) of which much higher share was stated for the youngest analyzed age class (<20 years) of post-agricultural woodlands than for older forest stands.

Influence of resting and pine sawdust application on chemical changes in post-agricultural soil and the ectomycorrhizal community of growing Scots pine saplings

Abstract Changes in chemical compounds and in ectomycorrhizal structure were determined for Scots pine growing on post agricultural soil lying fallow for 3, 6 and 15 years, after amendment with pine sawdust. Soil without any amendments was used as the control treatment. Comparing the ectomycorrhizal structure 15 years after the application of pine sawdust revealed no significant differences in abundance or species richness between soil with and without organic enrichment. The results showed that the ectomycorrhizal status depends on soil conditions (soil pH, nitrogen content), which remain unaffected by saw dust application. In all treatments, the most frequently occurring ectomycorrhizae genera were Dermocybe, Hebeloma, Suillus, Tomentella and Tricholoma. Two species (Paxillus involutus, Amanita muscaria) were specific to the control plots that lay fallow for 15 years.

First Report of Fagus sylvatica Infection by Fusarium avenaceum in Forest Container Nurseries in Northeastern Poland.

Container nurseries in northeastern Poland annually provide several million tree seedlings used for afforestation of post-agricultural soils and restocking of forests. Beech (Fagus sylvatica), one of the main forest tree species in Poland, is largely applied in this process. We have observed in container nurseries of young beech saplings in Poland symptoms of wilting and damping off. The average rate of damage in container cultures was 21 to 31%, including those beech seedlings (5 to 7%) that eventually succumbed. The infected leaves, stems, and roots were washed in distilled water and then disinfected with 70% ethanol and 1% sodium hypochlorite. The plates with plant material were incubated at 22°C for approximately 7 days. A total of 14 single-spore fungal cultures isolated from infected beech seedlings were identified, based on morphological features, as F. avenaceum (1,2). PDA colonies consisted of flat, aerial mycelium that was white to rose, with rose to carmine pigment on the reverse surface, with small black sclerotial bodies. Microconidia were cylindrical with one to four septa, predominantly 10 to 25 μm long. Macroconidia were hyaline, straight to slightly curved, four- to six-septate (generally 50 to 65 × 4 to 4.5 μm). All isolates were deposited in the Department of Plant Diagnostics and Pathophysiology Fungal Culture Collection (Accession Nos. FL.Ol.35.13-42.13) (University of Warmia and Mazury in Olsztyn, Poland) and are stored in 15% glycerol at -80°C. DNA from the fungal cultures was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete of EF1α gene sequence was amplified with the primers avef11 (CGACTCTGGCAAGTCGACCA) and avef12 (TACCAATGACGGTGACATAG) and sequenced. A single sequence from isolate FL.Ol.35.13, which was used in the beech infection study (Gen Bank Accession No. KM985475), was obtained. It had the length of 411 bp and was 100% identical to sequences of several isolates of F. avenaceum at GenBank (HQ704072.1, EF512014.1, and HQ704073). To verify pathogenicity of the fungus, a controlled infection was carried out with spores of isolate FL.Ol.35.13. The spores were used at the density of 2 × 105/ml. Seeds of beech were sown to sterile perlite, and after cotyledon emergence they were watered with F. avenaceum spore suspension (5 ml/plant). Control plants were treated with water only. After 30 days, the rate of disease was estimated. Severely infected seedlings showed typical symptoms of damping-off and Fusarium wilt, while in less-affected seedlings, zonated spots with F. avenaceum sporodochia could be seen on cotyledons. No infection symptoms were seen on control seedlings. Fungal cultures were started from plants subjected to controlled infection, and, based on morphological features, the fungus was identified again as F. avenaceum. To our knowledge this is the first report of Fusarium (F. avenaceum) disease of beech in container nurseries in Poland.

Carbon and greenhouse gas balances in an age sequence of temperate pine plantations

Abstract. This study investigated differences in the magnitude and partitioning of the carbon (C) and greenhouse gas (GHG) balances in an age sequence of four white pine (Pinus strobus L.) afforestation stands (7, 20, 35 and 70 years old as of 2009) in southern Ontario, Canada. The 4-year (2004–2008) mean annual carbon dioxide (CO2) exchanges, based on biometric and eddy covariance data, were combined with the 2-year means of static chamber measurements of methane (CH4) and nitrous oxide (N2O) fluxes (2006–2007) and dissolved organic carbon (DOC) export below 1 m soil depth (2004–2005). The total ecosystem C pool increased with age from 46 to 197 t C ha−1 across the four stands. Rates of organic matter cycling (i.e. litterfall and decomposition) were similar among the three older stands. In contrast, considerable differences related to stand age and site quality were observed in the magnitude and partitioning of individual CO2 fluxes, showing a peak in production and respiration rates in the middle-age (20-year-old) stand growing on fertile post-agricultural soil. The DOC export accounted for 10% of net ecosystem production (NEP) at the 7-year-old stand but &lt;2% at the three older stands. The GHG balance from the combined exchanges of CO2, CH4 and N2O was 2.6, 21.6, 13.5 and 4.8 t CO2 equivalent ha−1 year−1 for the 7-, 20-, 35- and 70-year-old stands, respectively. The maximum annual contribution from the combined exchanges of CH4 and N2O to the GHG balance was 13 and 8% in the 7- and 70-year-old stands, respectively, but &lt;1% in the two highly productive middle-age (20- and 35-year-old) stands. Averaged over the entire age sequence, the CO2 exchange was the main driver of the GHG balance in these forests. The cumulative CO2 sequestration over the 70 years was estimated at 129 t C and 297 t C ha−1 year−1 for stands growing on low- and high-productivity sites, respectively. This study highlights the importance of accounting for age and site quality effects on forest C and GHG balances. It further demonstrates a large potential for net C sequestration and climate benefits gained through afforestation of marginal agricultural and fallow lands in temperate regions.

Elevated CO2 and O3 effects on ectomycorrhizal fungal root tip communities in consideration of a post-agricultural soil nutrient gradient legacy.

Despite the critical role of EMF in nutrient and carbon (C) dynamics, combined effects of global atmospheric pollutants on ectomycorrhizal fungi (EMF) are unclear. Here, we present research on EMF root-level community responses to elevated CO2 and O3. We discovered that belowground EMF community richness and similarity were both negatively affected by CO2 and O3, but the effects of CO2 and O3 on EMF communities were contingent on a site soil pH and cation availability gradient. These results contrast with our previous work showing a strong direct effect of CO2 and O3 on sporocarp community dynamics and production. We discuss the possible role of carbon demand and allocation by EMF taxa in the discrepancy of these results. EMF communities were structured by a legacy of spatially defined soil properties, changing atmospheric chemistry and temporal dynamics. It is therefore necessary to understand global change impacts across multiple environmental gradients and spatiotemporal scales.

Hybrid poplar plantations are suitable habitat for reintroduced forest herbs with conservation status

Plantations of fast-growing tree species may be of use in conservation by accelerating the restoration of forest habitat on abandoned farmland and increasing connectivity in fragmented landscapes. The objective of this study was to determine if hybrid poplar plantations can be suitable habitats for the reintroduction of native forest plant species and, if so, which abiotic factors predict successful reintroduction. Four species of forest herb species (Trillium grandiflorum, Sanguinaria canadensis, Maianthemum racemosum, Asarum canadense), of which three have legal conservation status, were transplanted into experimental plantations of two hybrid poplar clones and nearby second-growth woodlots at six sites in southern Quebec, Canada. The transplanted individuals were protected from deer browsing with exclusion cages. After two years, the plant responses of all four species were stable or increased over two years in both types of hybrid poplar plantations. Sanguinaria showed a better response in the plantations than in the woodlots, preferring the rich post-agricultural soils of the plantations with low C:N ratios. Asarum and Maianthemum showed no significant difference between stand types, while Trillium grew better in the woodlots than in the plantations. Much of the variability in the response of the latter three species was unexplained by the measured environmental variables. These results suggest that certain forest herb species can be reintroduced as juvenile plants into plantations, knowing that their spontaneous recolonization is often limited by dispersal and/or seedling establishment. Plantations could also contribute to the conservation of biodiversity by providing an environment for the cultivation of forest herb species as an alternative to their destructive harvest from natural populations.

Why are acidophilic plants abundant in post-agricultural forests?1

Abstract The development of post-agricultural forests provides a unique opportunity to understand the mechanisms controlling plant community assembly. In particular, identifying traits associated with colonization can point to the causes of community development. The trait of association with the soil pH gradient has not yet been explored in this context. I test whether acidophilic species are more frequent in post-agricultural forests and discuss several possible explanations for this pattern. Species with low pH optima clearly tended to be more frequent in post-agricultural forests, yet the mean pH of post-agricultural forest soils did not differ from adjacent forests that had never been cleared. Calciphilic species nevertheless could remain absent from post-agricultural forests if they depended on high-pH microsites that agriculture had destroyed, or they could be less able to tolerate the lower nutrient status of post-agricultural forest soils. Alternatively, acidophilic species may have more effectiv...

MICROSITE-LIMITED RECRUITMENT CONTROLS FERN COLONIZATION OF POST-AGRICULTURAL FORESTS

Assessing the relative roles of dispersal limitation and environmental effects in population dynamics and community assembly is fundamental to understanding patterns of species distribution and diversity. In forests growing on abandoned agricultural lands, both legacies of vegetation disturbance and changes in the abiotic environment shape the diversity and composition of recovering communities. Here I specify how interactions among historical, environmental, and biological factors influence species distributions, focusing on three fern species with contrasting distributions across forests of different history in central New York, USA: Dryopteris carthusiana, Dryopteris intermedia, and Polystichum acrostichoides. Using population surveys, spore-trap and spore-bank studies, and a three-year field experiment, I compare demographic rates among species and between forest types to determine which life history stages limit colonization and which traits explain species distributions. Adult plants of all three species were larger and more likely to produce spores in post-agricultural forests than in adjacent, uncleared stands. Though lower population densities led to fewer spores in post-agricultural soils, spore availability still exceeded recruitment by four to five orders of magnitude. Sowing additional spores had relatively little effect, while microhabitat conditions had the greatest impact on establishment rates. Given similar microsites, the two forest types had equal rates of establishment, but some forest-floor features preferentially occupied by juvenile plants were less frequent in post-agricultural stands. The availability of suitable sites for establishment, created by small-scale heterogeneity on forest floors, thus limits both the growth of fern populations and the colonization of new habitats. In fact, reduced microtopographic variation in post-agricultural forests may represent a greater hindrance to plant establishment than changes in mean environmental conditions. Among the three fern species, establishment rates differed as species distributions would predict, with the strongest colonizer consistently having the highest rates and the slowest colonizer the lowest. Rather than random or trait-mediated dispersal, the different distributions of these species reflect life history traits that determine establishment rates and thus colonization ability. This case study demonstrates that ecological interactions based on the unique life histories of individual species can override dispersal in determining species distributions.

Variability of Carabidae in time and space in open areas

The temporal and spatial variability of carabid fauna was studied on a colliery spoil heap area in Germany and on an area of post-agricultural soil in Poland using pitfall traps. Applying Mean Individual Biomass (MIB) of carabids as an indicator of environmental quality, all plots were assessed as being young stages of succession. Species richness and total carabid abundance fluctuated remarkably among different plots and study years. Total numbers of individuals fluctuated significantly in time, whereas species richness remained strikingly constant. The Jaccard’s index ofspecies similarity was low for the level of individual sampling plots but high for the total catches when comparing different years. Individual species showed asynchronicity of fluctuations in numbers of individuals at the level of individual plots. Based on these results we suggest that the observed patterns can be explained by the ‘spreading of risk’ hypothesis.

Pine mortality after planting on post-agricultural lands in South Africa

Successful afforestation has been practiced in South Africa for more than a century. Recently, however, problems with afforestation of pines have occurred in the northeastern part of the Eastern Cape Province. Rapid mortality of Pinus patula and P. elliottii have occurred when small container seedlings were planted on old-agricultural soils. Death would often occur within 5 months of planting. Growth of surviving trees was retarded and new needles were chlorotic and stunted. Acceptable survival was obtained when seedlings were planted on virgin grasslands. Apparently, some unseen factor in the post-agricultural soil reduces root growth, increases mortality, and decreases uptake of nutrients. Removal of the infested soil by scalping greatly improves survival and growth as does soil fumigation with methyl bromide.