Positions C3 Research Articles

Proteolysis of tilapia skin collagen: Identification and release behavior of ACE-inhibitory peptides

The structure–activity relationship (SAR) and release behavior of angiotensin I-converting enzyme inhibitory (ACEi) peptides obtained from enzymolysis of collagen influence the large-scale production of ACEi peptides. However, researchers have paid insufficient attention to these areas. In this study, we extracted collagen from tilapia skin, and hydrolyzed it using three proteases. A total of 270 peptides were released from the collagen parent protein. The SAR of these larger collagen ACEi peptides indicated that the presence of proline at position C2 of three C-terminal sequences has a greater effect on increasing the ACEi activity of the peptide than at position C1. The release behavior of these collagen peptides showed that bromelain and alcalase preferentially cleave the N-terminal region of the collagen α1 subunit and then the C-terminal region. These enzymes evenly cleave regions of the collagen α2 subunit. Collagenase preferentially cleaves the C-terminal region of the collagen subunit, followed by the N-terminal region, and then the middle region. The pattern of peptide release from different proteases and the SAR of larger collagen peptides can help guide food production processes to ensure food safety, and to produce high-quality active peptide products.

Two-Step Synthesis of Heptacyclo[6.6.0.02,6 .03,13 .04,11 .05,9 .010,14 ] tetradecane from Norbornadiene: Mechanism of the Cage Assembly and Post-synthetic Functionalization.

A selective and scalable two‐step approach to the dimerization of norbornadiene (NBD) into its thermodynamically most stable dimer, heptacyclo[6.6.0.02,6.03,13.04,11.05,9.010,14] tetradecane, (HCTD) is reported. Calculations indicate that the reaction starts with the Rh‐catalyzed stepwise homo Diels–Alder cyclisation of NBD into its exo‐cis‐endo dimer. Treatment of this compound with acid promotes its evolution to HCTD via a [1,2]‐sigmatropic rearrangement. The assemblies of 7,12‐disubstituted cages from 7‐(alkyl/aryl) NBDs, as well as the selective post‐synthetic C−H functionalization of the core HCTD scaffold at position C1, or positions C1 and C4 are described.

Two‐Step Synthesis of Heptacyclo[6.6.0.02,6.03,13.04,11.05,9.010,14] tetradecane from Norbornadiene: Mechanism of the Cage Assembly and Post‐synthetic Functionalization

AbstractA selective and scalable two‐step approach to the dimerization of norbornadiene (NBD) into its thermodynamically most stable dimer, heptacyclo[6.6.0.02,6.03,13.04,11.05,9.010,14] tetradecane, (HCTD) is reported. Calculations indicate that the reaction starts with the Rh‐catalyzed stepwise homo Diels–Alder cyclisation of NBD into its exo‐cis‐endo dimer. Treatment of this compound with acid promotes its evolution to HCTD via a [1,2]‐sigmatropic rearrangement. The assemblies of 7,12‐disubstituted cages from 7‐(alkyl/aryl) NBDs, as well as the selective post‐synthetic C−H functionalization of the core HCTD scaffold at position C1, or positions C1 and C4 are described.

The Substituent-Induced Symmetry-Forbidden Electronic Transition Allows Significant Optical Limiting under Weak Sky-Blue Irradiance.

We report a novel material containing a rare metal-free dopant chromophore with controlled electronic symmetry, which exhibits strong optical limiting (OL) capabilities under weak, continuous, sky-blue irradiance. Electron-donating substituents at positions C2 and C7 of pyrene allow significant triplet generation because of the symmetrically forbidden transition between the ground state and the lowest singlet excited state, which leads to accumulation of triplet excitons in the dopant chromophore. This also leads to a small ground state absorption coefficient and induces greater absorption of sky-blue wavelengths when triplet excitons of the chromophore accumulate. Consequently, molecular glass doped with the designed chromophore displays stronger OL characteristics compared with those of the rare element-containing glass that previously demonstrated the greatest OL performance under continuous sky-blue irradiance at sunlight power levels. The described approach to developing cost-effective, state-of-the-art OL materials is crucial for nonlinear optical applications working at a large scale under sunlight or room lights.

Structural and mechanistic basis of capsule O-acetylation in Neisseria meningitidis serogroup A

O-Acetylation of the capsular polysaccharide (CPS) of Neisseria meningitidis serogroup A (NmA) is critical for the induction of functional immune responses, making this modification mandatory for CPS-based anti-NmA vaccines. Using comprehensive NMR studies, we demonstrate that O-acetylation stabilizes the labile anomeric phosphodiester-linkages of the NmA-CPS and occurs in position C3 and C4 of the N-acetylmannosamine units due to enzymatic transfer and non-enzymatic ester migration, respectively. To shed light on the enzymatic transfer mechanism, we solved the crystal structure of the capsule O-acetyltransferase CsaC in its apo and acceptor-bound form and of the CsaC-H228A mutant as trapped acetyl-enzyme adduct in complex with CoA. Together with the results of a comprehensive mutagenesis study, the reported structures explain the strict regioselectivity of CsaC and provide insight into the catalytic mechanism, which relies on an unexpected Gln-extension of a classical Ser-His-Asp triad, embedded in an α/β-hydrolase fold.

A stabilized glycomimetic conjugate vaccine inducing protective antibodies against Neisseria meningitidis serogroup A

Neisseria meningitidis serogroup A capsular polysaccharide (MenA CPS) consists of (1 → 6)-2-acetamido-2-deoxy-α-D-mannopyranosyl phosphate repeating units, O-acetylated at position C3 or C4. Glycomimetics appear attractive to overcome the CPS intrinsic lability in physiological media, due to cleavage of the phosphodiester bridge, and to develop a stable vaccine with longer shelf life in liquid formulation. Here, we generate a series of non-acetylated carbaMenA oligomers which are proven more stable than the CPS. An octamer (DP8) inhibits the binding of a MenA specific bactericidal mAb and polyclonal serum to the CPS, and is selected for further in vivo testing. However, its CRM197 conjugate raises murine antibodies towards the non-acetylated CPS backbone, but not the natural acetylated form. Accordingly, random O-acetylation of the DP8 is performed, resulting in a structure (Ac-carbaMenA) showing improved inhibition of anti-MenA CPS antibody binding and, after conjugation to CRM197, eliciting anti-MenA protective murine antibodies, comparably to the vaccine benchmark.

A further insight into methyltestosterone metabolism: New evidences from in vitro and in vivo experiments.

Although the metabolism of methyltestosterone (MT) has been extensively studied since the 1950s using different techniques, the aim of this study was to investigate the hydroxylation in positions C2, C4 and C6 after in vitro experiments and in vivo excretion studies using gas chromatography time-of-flight (GC/TOF) and gas chromatography/tandem mass spectrometry (GC/MS/MS). The results could be influenced by the mass spectrometric analyser used. Incubations were carried out with human liver microsomes and six enzymes belonging to the cytochrome P450 family using MT as a substrate. The trimethylsilyl derivatives of the samples were analysed using GC/TOF and GC/MS/MS once the correct MS/MS transitions had been selected, mainly for 6-hydroxymethyltestosterone (6-OH-MT) to avoid artefact interferences. A urinary excretion study was then performed after the administration of a 10 mg single oral dose of MT to a volunteer. The formation of hydroxylated metabolites of MT in the C6, C4 and C2 positions after both in vitro and in vivo experiments was observed. Sample evaluation using GC/TOF showed an interference for 6-OH-MT that could only be resolved in GC/MS/MS by monitoring specific transitions. The transitory detection of these hydroxylated metabolites in urine agrees with previous investigations that had described this metabolic route as being of little significance. In doping analysis, the formation of 4-hydroxymethyltestosterone (oxymesterone) from MT cannot be underestimated. Although it is only detected as a minor and short-term excretion metabolite, it cannot be overlooked as it was found in both in vitro and in vivo experiments. The use of a combination of different mass spectrometric instruments allowed reliable conclusions to be reached, and it was shown that special attention must be given to artefact formation.

Fragment-based approach to novel bioactive purine derivatives

Abstract Using purine as a scaffold, the methods for preparation of novel 2-aminopurine and purine derivatives substituted at position C 6 by the fragments of natural amino acids, short peptides, and N-heterocycles, including enantiopure ones, have been proposed. The methods for determination of the enantiomeric purity of the obtained chiral compounds have been developed. Conjugates exhibiting high antimycobacterial or anti-herpesvirus activity against both laboratory and multidrug-resistant strains were revealed among the obtained compounds.

Synthesis and pharmacological evaluation of novel cis and trans 3-substituted anilidopiperidines.

4-Anilidopiperidine class of synthetic opioid analgesics, with it's representative fentanyl, are by far the most potent and clinically significant for the treatment of the severe chronic and surgical pain. However, side effects of μ-opioids are often quite serious. In order to improve the pharmacological profile of this class of opioid analgesics, a novel fentanyl analogs were designed, synthesized and evaluated in vivo for their antinociceptive activity. The title compounds were prepared using known synthetic transformations, including N-bromoacetamide mediated Hofmann rearrangement, highly selective carbamate cleavage with trimethylsilyl iodide and dehydration of carboxamide group to nitrile in the presence of SOCl2. The antinociceptive activity of the synthesized compounds was determined by tail-immersion and formalin test. The scalable synthetic route towards novel fentanyl analogs bearing nitrogen groups in position C3 of piperidine ring is designed. In addition, Hofmann rearrangement was substantially improved for the more efficient synthesis of previously published 3-substituted fentanyl analogs. The series of ten fentanyl analogs was tested in vivo for their antinociceptive activity. The most potent compound of the series was found to be cis-4, based on the determined ED50 values in tail-immersion test. Of ten compounds tested for their antinociceptive activity, compound cis-4 is characterized by high potency, rapid beginning and short duration of action and due to this might be incorporated in different pharmaceutical forms.

Structure-activity relationship analysis of dammarane-type natural products as muscle-type creatine kinase activators

Muscle-type creatine kinase (CK-MM) is the target protein of ginsenosides in skeletal muscle. 20(S)-protopanaxadiol [20(S)-PPD] is an activator of CK-MM and exerts an anti-fatigue effect. In this study, twelve dammarane-type compounds were used for structure-activity relationship analysis in terms of enzyme activity, intermolecular interaction, and molecular docking. Enzyme activity analysis showed that 20(S)-PPD, 20(R)-PPD, 20(S)-protopanaxatriol [20(S)-PPT], 25-OH-PPD, 24-COOH-PPD, panaxadiol (PD), and ginsenoside Rh2 significantly increased CK-MM activity. Panaxatriol (PT), ocotillol, ginsenoside Rg1, and ginsenoside Rd had no significant influence on CK-MM activity, while jujubogenin inhibited its activity. Biolayer Interferometry (BLI) assay produced the same results as those on enzyme activity. The interaction intensity between dammarane-type compounds and CK-MM was linearly related to the compounds’ maximum increment rate of enzyme activity. Molecular docking showed the following sequence of docking scores: Rd > Rg1 > Rh2 > 24-COOH-PPD > 20(S)-PPD > 20(S)-PPT > 25-OH-PPD > 20(R)-PPD > ocotillol > PT > PD > jujubogenin. We demonstrated that 20(S)-PPD was the best activator of CK-MM among the 12 dammarane-type compounds. The cyclization of the dammarane side chain, the hydroxyl group at position C6, and the glycosylation of C3, C6, and C20 reduced the ability to activate CK-MM. These findings can help in the development of enhanced CK-MM activators through structural modification.

DFT investigation on the linear and nonlinear optical properties of the tautomers and derivatives of 2-aminobenzothiazole (ABT) in the gas phase and different solvents

This effort was performed to investigate the nonlinear optical (NLO) properties of 2-aminobenzothiazole (ABT) molecule at a sophisticated level of theory (DFT/CAM-B3LYP/6-311++G(d,p)). The study included the investigation of NLO properties of the three tautomeric forms of ABT in the gas and solvents of different polarities. The study extended to study the NLO properties of the most stable tautomeric form of ABT (T1ABT) substituted at position C3 with electron-donor/electron-acceptor groups. Additionally, the quantum chemical parameters of the three tautomeric forms in the gas and six solvents were calculated and analyzed.

Crystal structure of 5-[(benzo-yloxy)meth-yl]-5,6-dihy-droxy-4-oxo-cyclo-hex-2-en-1-yl benzoate.

The crystal structure of the natural product zeylenone, C21H18O7, was confirmed by single-crystal X-ray diffraction. The crystal structure has three chiral centers at positions C1, C5 and C6 of the cyclo-hexa-none ring, but the absolute configuration could not be determined reliably. The methyl benzoate and benzo-yloxy substituents at positions C1 and C5 of the cyclo-hexenone ring are on the same side of the ring with the dihedral angle between their mean planes being 16.25 (10)°. These rings are almost perpendicular to the cyclo-hexenone ring. The benzoate groups and two hydroxyl groups on the cyclo-hexenone ring form strong hydrogen bonds to consolidate the crystal structure. In addition, weak C-H⋯O hydrogen bonds also contribute to the packing of the structure.

A Novel Function of Sphingosine Kinase 2 in the Metabolism of Sphinga-4,14-Diene Lipids

The number, position, and configuration of double bonds in lipids affect membrane fluidity and the recruitment of signaling proteins. Studies on mammalian sphingolipids have focused on those with a saturated sphinganine or mono-unsaturated sphingosine long chain base. Using high-resolution liquid chromatography-tandem mass spectrometry (LC-MS/MS), we observed a marked accumulation of lipids containing a di-unsaturated sphingadiene base in the hippocampus of mice lacking the metabolic enzyme sphingosine kinase 2 (SphK2). The double bonds were localized to positions C4–C5 and C14–C15 of sphingadiene using ultraviolet photodissociation-tandem mass spectrometry (UVPD-MS/MS). Phosphorylation of sphingoid bases by sphingosine kinase 1 (SphK1) or SphK2 forms the penultimate step in the lysosomal catabolism of all sphingolipids. Both SphK1 and SphK2 phosphorylated sphinga-4,14-diene as efficiently as sphingosine, however deuterated tracer experiments in an oligodendrocyte cell line demonstrated that ceramides with a sphingosine base are more rapidly metabolized than those with a sphingadiene base. Since SphK2 is the dominant sphingosine kinase in brain, we propose that the accumulation of sphingadiene-based lipids in SphK2-deficient brains results from the slower catabolism of these lipids, combined with a bottleneck in the catabolic pathway created by the absence of SphK2. We have therefore uncovered a previously unappreciated role for SphK2 in lipid quality control.

5-Aryl-2,2′-bipyridines bearing fluorinated anilines residues at C6 position: synthesis and photophysical properties

A convenient synthetic approach to 5-aryl-2,2′-bipyridines bearing a (poly)fluorine-containing aniline residue at position C6 based on sequential ipso-substitution of the cyano group at position C5 of 3-(2-pyridyl)-1,2,4-triazines and the aza-Diels–Alder reaction has been proposed. The influence of the number and the position of the fluorine atoms on the reactivity of fluoroanilines has been estimated by means of DFT calculations. It was shown that the reaction cannot be realized if a nitro group is present in the ortho-position or two fluorine atoms occupied the ortho-positions in aniline. Photophysical properties of prospective “push–pull” fluorophores have been studied. Incorporation of fluorine atom into position 4 of aniline fragment in 5-p-tolylbipyridines causes small bathochromic shift of emission maximum, whereas the replacement of the methoxy group at the position C4 of the aniline moiety in 5-(4-methoxyphenyl)-2,2′-bipyridine with fluorine atom leads to a significant hypsochromic shift of emission maximum and to significant increase in quantum yield; the positive solvatochromism has been observed.

Interaction mechanism of flavonoids on bovine serum albumin: Insights from molecular property-binding affinity relationship.

The molecular structure properties-binding affinity relationship of a series of flavonoids and bovine serum albumin (BSA) was investigated in vitro from comparing the binding constants determined through the fluorescence method. As a result, the binding process was greatly influenced by different structural elements or substituents of flavonoids under analysis. The hydroxylation at the positions C3, C6, C4', C5' (for type I) and C5, C3' (for type II) were in favor of forming hydrogen bonds with the amino acids of BSA, which was of great importance in the binding and interaction between flavonoids and the protein. The decreased affinity could be realized by the methoxylation (C8, C3' and C4') and glycosylation (C3 and C7) of flavonoid type I. However, the adverse trend on binding affinity was observed when the methoxylation and glycosylation appeared at the sites C4' and C7, C4' of structure type II, respectively. Meanwhile, glycosylation at C7 mainly induced the decline in the affinity of flavonoids (type III), and the hydrogenation of the C2C3 double bond for type I was beneficial to increase the affinity on BSA. Moreover, part of flavonoids could mediate the conformational alteration of secondary structures of the protein during the interaction process, which was inferred by means of the synchronous fluorescence spectra. The determinations of ANS fluorescence probe suggested that hydrophobic interaction played an important role in the binding of a majority of flavonoids to BSA. Further evidences from the site-specific experiments revealed that the location of flavonoids 19, 29 and 34 binding on BSA mainly belonged to site I, while compound 3 bound to both sites I and II. Additionally, molecular modelling studies further confirmed the indispensable character of hydrophobic interaction and hydrogen bonds, and illustrated the preferred complex binding behaviors.

Biocompatibility and structural characterization of glycosaminoglycans isolated from heads of silver-banded whiting (Sillago argentifasciata Martin & Montalban 1935)

Glycosaminoglycans (GAGs) were extracted from heads of silver-banded whiting (SBW) fish and subjected to preliminary biocompatibility testing per ISO 10993: intracutaneous irritation, maximization sensitization, systemic toxicity, and cytotoxicity. When the GAG solution was injected intradermally, the observed irritation was within ISO limits and comparable to a marketed control. There was no evidence of sensitization, systemic toxicity, or cellular toxicity on the test organisms treated with the GAG mixture from SBW fish heads. Fractionation by size-exclusion chromatography has shown three distinct fractions: F1 as low molecular weight hyaluronic acid (190 kDa), F2 (82 kDa) and F3 (64 kDa), both as chondroitin sulfates. Structural characterization by 1D and 2D nuclear magnetic resonance spectroscopy and disaccharide analysis have shown sulfation ratios at positions C4:C6 of the F2 and F3 fractions respectively as 70:20% and 50:30%, and the balance of non-sulfated and 4,6-di-sulfated units. The preliminary results here suggest that GAG-based extracts from SBW fish heads are suitable alternative products to be used in soft tissue augmentation, although further long-term biocompatibility studies are still required.

IR spectroelectrochemistry as efficient technique for elucidation of reduction mechanism of chlorine substituted 1,10-phenanthrolines

The electrochemical behaviour of 4,7-dichloro-1,10-phenanthrolines was studied in non-aqueous solution using cyclic voltammetry, controlled potential electrolysis, in-situ UV–Vis and IR spectroelectrochemistry, and HPLC-DAD (HPLC with diode array detector) and HPLC-MS/MS techniques. The substitution of phenanthrolines at position C2 and C5 with methyl groups, chlorine and/or fluorine atoms influences the redox properties and the potential gap between the oxidation and reduction potentials. Reduction leads to the formation of a radical anion and the subsequent cleavage of halide from the molecule. Compounds containing also chlorine or fluorine atoms at position C5 were found to be the most easily reduced. The oxidation of 4,7-dichloro-1,10-phenanthrolines proceeds primarily on the conjugated aromatic rings of phenanthroline forming a short living radical cation at the first oxidation wave and a dication at the second oxidation wave. The changes of the absorption spectra during IR spectroelectrochemistry suggested the formation of an unstable species, whose dimeric structure was hypothesized. Frontier molecular orbitals calculations and theoretical calculations of IR spectra support the findings.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Estradiol Metabolism: Crossroads in Pulmonary Arterial Hypertension.

Pulmonary arterial hypertension (PAH) is a debilitating and progressive disease that predominantly develops in women. Over the past 15 years, cumulating evidence has pointed toward dysregulated metabolism of sex hormones in animal models and patients with PAH. 17β-estradiol (E2) is metabolized at positions C2, C4, and C16, which leads to the formation of metabolites with different biological/estrogenic activity. Since the first report that 2-methoxyestradiol, a major non-estrogenic metabolite of E2, attenuates the development and progression of experimental pulmonary hypertension (PH), it has become increasingly clear that E2, E2 precursors, and E2 metabolites exhibit both protective and detrimental effects in PH. Furthermore, both experimental and clinical data suggest that E2 has divergent effects in the pulmonary vasculature versus right ventricle (estrogen paradox in PAH). The estrogen paradox is of significant clinical relevance for understanding the development, progression, and prognosis of PAH. This review updates experimental and clinical findings and provides insights into: (1) the potential impacts that pathways of estradiol metabolism (EMet) may have in PAH; (2) the beneficial and adverse effects of estrogens and their precursors/metabolites in experimental PH and human PAH; (3) the co-morbidities and pathological conditions that may alter EMet and influence the development/progression of PAH; (4) the relevance of the intracrinology of sex hormones to vascular remodeling in PAH; and (5) the advantages/disadvantages of different approaches to modulate EMet in PAH. Finally, we propose the three-tier-estrogen effects in PAH concept, which may offer reconciliation of the opposing effects of E2 in PAH and may provide a better understanding of the complex mechanisms by which EMet affects the pulmonary circulation–right ventricular interaction in PAH.

Minor chemical modifications of the aminosteroid derivative RM-581 lead to major impact on its anticancer activity, metabolic stability and aqueous solubility

The aminosteroid (AM) RM-581 is built around a mestranol backbone and has recently emerged as this family’s lead candidate, showing in vitro and in vivo potency over different types of cancer, including high fatality pancreatic cancer. To extend the structure-activity relationships (SAR) to other estrane analogs, we synthesized a focused series of RM-581 derivatives at position C3 or C2 of its steroidal core. These new AM derivatives were first tested on a large selection of prostate, breast, pancreatic and ovarian cancer cell lines. The impact of these modifications on metabolic stability (human liver microsomes) was also measured. A SAR study revealed a fine regulation of anticancer activity related to the nature of the substituent. Indeed, the addition of potential prodrug groups like acetate, sulfamate or phosphate (compounds 8, 9 and 10) at C3 of the phenolic counterpart provided better antiproliferative activities than RM-581 in breast and pancreatic cancer cell types while maintaining activity in other cancer cell lines. Also, the phosphate group was highly beneficial on water solubility. However, the bulkier carbamate prodrugs 6 (N,N-dimethyl) and 7 (N,N-diethyl) were less active. Otherwise, carbon homologation (CH2) at C2 (compound 33) was beneficial to metabolic stability and, in the meantime, this AM conserved the same anticancer activity as RM-581. However, the replacement of the hydroxy or methoxy at C3 by a hydrogen or an acetyl (compound 17 or 21b) was detrimental for anticancer activity, pointing to a crucial molecular interaction of the aromatic oxygen atom at this position. Overall, this work provided a better knowledge of the structural requirements to maintain RM-581’s anticancer activity, and also identified minor structural modifications to increase both metabolic stability and water solubility, three important parameters of pharmacological development.