Position Of Vulva Research Articles

Prevalence of yam nematodes in diverse soil communities, and their morphometrics in the Krachi-Nchumuru District of Ghana

Yam (Dioscorea spp.) is susceptible to dry rot disease, which limits its yields in farmers fields in West Africa.The objective of this study was to assess the occurrence and characteristics of the plant-parasitic nematode (Scutellonema bradys) on yam from the Volta Region of Ghana. A survey was conducted in KrachiI-Nchummuru District in the Volta region in Ghana, using a semi-structured questionnaire in ten communities. Majority of the farmers (62%) were unaware of nematodes and their damage caused to yam. Most interviewees (84%) mentioned the ‘pona’ yam variety as the most susceptible genotype to rot, especially in storage. Twelve nematode genera were identified in soils, and eight under storage conditions. Soil samples had, for relative abundance, 31.5% of nematodes as Scutellonema bradys and 16.8% as Meloidogyne spp. On the other hand, relative abundances in yam peels for S. bradys, Meloidogyne spp. and Pratylenchus spp. were 88.4, 6.0 and 3.3%, respectively. Body lenghts of female S. bradys ranged from 747.3 to 861.9 um. There was a strong positive correlation between tail length and head region diameter (r = 0.81); and stylet knob height and vulva position (r= 0.68). Agglomerative hierarchical clustering (AHC) showed 5 major groups at a dissimilarity of 90%, with sub-groups formed at dissimilarity value of 50%. In-depth survey of communities in the Krachi Nchumuru district revealed that, Scutellonema bradys is a threat to yam production in this region, and results in considerable dry rot disease and yield losses.

A new plant-parasitic nematode species associated with coffee, Rotylenchus bunae n. sp. (Nematoda: Hoplolaimidae) from Jimma, Ethiopia

Summary Rotylenchus bunae n. sp. was discovered in the coffee rhizosphere in Gera district of Jimma, Ethiopia, and has been morphologically and molecularly characterised. The new species is identified by a female body length of 725-876 μm, hemispherical lip region with 4-5 lip annuli, stylet length of 28-30 μm, lateral field areolation only in the pharyngeal region, no cuticular striations, pharyngeal gland overlapping intestine dorsally by 15-26 μm, double epiptygma, no clear spermathecae, vulva position at 54-58% of body length from anterior end, prominent fasciculi in mid and posterior body, rounded or sometimes slightly truncated, coarsely crenated tail with 11-13 annuli, and phasmids located at 7-16 annuli anterior to anus. No males were detected. This species was found closely related to other African Rotylenchus species, such as R. unisexus and R. wimbii; however, it could be well separated from them by both morphology and molecular data (D2-D3 of 28S and partial 18S of rDNA).

Synopsis of gastropod-associated nematodes of Ciscaucasia (Russian Federation) with the description of a new species of Pellioditis Dougherty, 1953 (syn. Phasmarhabditis Andrássy, 1976).

Caucasus is known as one of the few biodiversity hotspots in Europe and is characterised by rich gastropod fauna while the nematode fauna in association with gastropods has remained largely understudied. Surveys conducted in 2019 and 2021 in the North Caucasus of the Russian Federation (Stavropol Upland and western and central parts of Krasnodar Krai) has revealed the presence of three new species of Pellioditis, a facultative parasite of land gastropods, and two species of obligate parasites, the intestinal parasite Angiostoma kimmeriense and a new, still undescribed species of a larval ectoparasite Alloionema sp. The new associations of Cruznema sp. and Rhabditophanes sp. with land gastropods were recorded for the first time in the Russian Federation. The new species of Pellioditis Dougherty, 1953 described here is based on the analysis of morphology and molecular studies of two distant and morphologically distinct strains, thermalis and sindicae. Pellioditis thermalis n. sp. was characterised by females possessing a tail of about 95-100 μm long, broadly conical in shape in the thermalis and sindicae strains, with a rounded anterior part and a subulate terminal part as long as the former; prominent phasmids located at the mid-tail, equatorial vulva position, a lateral field of three ridges (four incisions), males with spicules featuring a hole at the distal tip, ensheathed infective juveniles with average length 717 μm in the thermals strain and 771 μm in the sindicae strain, and exsheathed ones 644 μm and 682 μm, respectively. ITS-based phylogenetic analyses revealed that all Pellioditis species found in Ciscaucasia and Transcaucasia probably belong to two separate clades, with independent evolutionary histories of colonisation of this area. The entire Caucasus range area appears to serve as a biodiversity hotspot for the genus Pellioditis, presumably due to its complicated geological history and repeated isolation events for its terrestrial mollusc hosts.

Leidynema bestium sp. n. (Oxyuridomorpha: Thelastomatidae) an intestinal parasite of blaberid cockroaches from Yaroslavl Zoo, Russia

A new species of thelastomatid Leidynema bestium sp. n. is described from the hind gut lumen of the cockroaches Diploptera punctata (Eschscholtz, 1922) and Elliptorhina chopardi (Lefeuvre, 1966). The new species is characterized by a combination of morphological features: presence of lateral alae in both sexes with posterior margin of alae in females not ending in the shape of a spike; longitudinal striation of the anteriormost annuli in males; four male genital papillae, equatorial position of vulva. In the cladogram inferred from analysis of D2-D3 segment of LSU rDNA L. bestium sp. n. demonstrates a position independent of the Leidynema species with known sequences of this taxonomic marker near the basal node for this genus.

Characterisation of Ficophagus virens (Bartholomaeus, Davies, Kanzaki, Ye & Giblin-Davis, 2009) Davies & Bartholomaeus, 2015 from Ficus virens (Moraceae) in India with a tabular key for the Indian species of Ficophagus

Summary A population of Ficophagus was recovered from white fig (Ficus virens) in New Delhi, India. We further described the population as Ficophagus virens based on morphological and morphometric characters, and molecular data. A detailed description of key morphological features, measurements of taxonomic characters, and photomicrography of the male and female specimens are given here. The study also included additional parameters such as lip diam. and height, conus stylet, shaft stylet, knobs diam. and height, vulva position from anterior end, length and width of spermatheca, anal/cloacal body diam., vulval width, and ovary/testis length for better characterisation of species. In addition to 28S rDNA (D2/D3), new sequence data from small subunit rDNA (18S) and mitochondrial cytochrome oxidase I COI marker gene were added. The D2/D3 sequence of F. virens was most similar to the sequence available for the Australian population of F. virens in GenBank. Maximum likelihood (ML) and Bayesian methods were used to analyse phylogenetic relationships of the Indian population of F. virens with those of the Australian populations and other Ficophagus species. This species is a new record from Delhi, India, and hence this report provides a new geographical location for the F. virens nematode after the first report from Australia.

Spirocamallanus sindensis n. sp. from Catfish Rita rita (Siluriformes: Bagridae) of Pakistan

The aimed of present studies to examination of helminth parasites of Indus river Siluriformes catfishes. 57 (41 + and 16 ) specimens were collected from 31 hosts fishes Rita rita (F. Hamilton, 1822) belong to genus Spirocamallanus (Baylis, 1923) processes as live specimen were killed in hot 70% ethanol, preserved, made temporary mounts for detail study. On the basis of differential characters such as body shape and size, striated cuticle format, buccal capsule shape and 13-14 spiral numbers, cephalic and cervical papillae, basal ring shape, spicules shape and size, vulva position and shape, vagina shape, the new species Spirocamallanus sindensis identified.

On the identity of the genus Epacrolaimus Andrássy, 2000 (Nematoda, Dorylaimida), with new insights into its phylogeny.

The type species of the genus Epacrolaimus, Epacrolaimus declinatoaculeatus, is studied from the re-examination of type material of Aporcelaimus vorax, its junior synonym, and the observation of several Iberian populations and a few Iranian specimens. Morphologically, it displays a recognizable morphological pattern characterized by, among other features, the incurved nature of its odontostyle aperture, presence of perioral liplets or lobes, lip region 24-31 μm wide, odontostyle 21-25 μm long and comparatively anterior location of S2N pharyngeal gland nuclei. Nevertheless, variations in some morphological traits (vagina shape and tail shape) and in several morphometrics (body length, uterus length, vulva position, tail length and spicule length) are also noted. Sequences of D2-D3 domains of the 28S rDNA, 18S rDNA and COI mtDNA were obtained from several Iberian populations. Their analyses, in particular those from D2-D3 sequences, revealed the existence of a highly supported clade ((Epacrolaimus + Sectonema) + Metaporcelaimus), with a closer relationship between Epacrolaimus and Palaearctic populations of Sectonema, whereas the remaining aporcelaimid genera occupied placements in other clades. These results are discussed, with especial emphasis on the intricate separation of Epacrolaimus and Sectonema, which display significantly different protruding stomatal structure in spite of their close evolutionary relationship as derived from molecular trees.

Miconchus prokini sp. nov. (Nematoda: Mononchida) from lake El'gygytgyn, Chukotka, Russia

A new nematode species in the order Mononchida, Miconchus prokini sp. nov., found in Lake El'gygytgyn (Chukotka, Russia) is described and illustrated. The new species is the largest member of the genus known to date. It is morphologically close to Miconchus rex in the big body size, vulva position in females, the number of precloacal supplements in males and in the relative length of the pharynx in both sexes, but it has a longer body (L = 7.7–13.1 mm in M. prokini vs. L = 6.5–7.0 mm in M. rex) and spicules (225–252 µm in M. prokini vs. 180 µm in M. rex), and a shorter tail (c = 9.3–15.2 in M. prokini vs. c = 5.3–7.1 in M. rex).

New Zealand species of the genus Tripyla Bastian, 1865 (Nematoda:Triplonchida: Tripylidae). I : A new species, a new record and key to long-tailed species

This paper describes two species of the genus of Tripyla from New Zealand and also provides a key to species based on the morphology of females in eight long-tailed (c < 5) species in the genus of Tripyla. Tripyla bioblitz sp. nov. is characterized by its more anterior vulva position (V = 43.7–45.4%), relatively short body length (1150–1410 μm) and long tail (c = 4.0–4.4) in the group. Tripyla filicaudata de Man, 1880 is recorded for the first time from New Zealand and from the Southern Hemisphere. In addition, the phylogenetic relationships among species were analyzed using data from the near full length small subunit (SSU) and D2/D3 expansion segments of the large subunit ribosomal (LSU) rRNA genes, and these analyses revealed that T. bioblitz sp. nov. is close to but distinct from T. filicaudata de Man, 1880.

Pratylenchus penetrans Parasitizing Potato Crops: Morphometric and Genetic Variability of Portuguese Isolates.

The root lesion Pratylenchus penetrans is an economically important pest affecting a wide range of plants. The morphometry of five P. penetrans isolates, parasitizing potato roots in Portugal, was compared and variability within and between isolates was observed. Of the 15 characters assessed, vulva position (V%) in females and the stylet length in both females/males showed the lowest coefficient of intra and inter-isolate variability. Moreover, DNA sequencing of the internal transcribed spacers (ITS) genomic region and cytochrome c oxidase subunit 1 (COI) gene was performed, in order to evaluate the intraspecific genetic variability of this species. ITS revealed higher isolate genetic diversity than the COI gene, with 15 and 7 different haplotypes from the 15 ITS and 14 COI sequences, respectively. Intra- and inter-isolate genetic diversity was found considering both genomic regions. The differentiation of these isolates was not related with their geographical origin. In spite of the high intraspecific variability, phylogenetic analyses revealed that both ITS region and COI gene separate P. penetrans from other related species. Our findings contribute to increasing the understanding of P. penetrans variability.

Discopersicus hexagrammatus n. sp. (Rhabditida: Tylenchidae), the second species of the genus.

Discopersicus hexagrammatus n. sp., is described and illustrated from a population associated with the rhizosphere of carrot (Daucus carota L.) in Dezful, Khuzestan province, south-western Iran. Based on morphological and morphometric data, the new species is characterized by a 601-734 µm long body, a prominent perioral labial disc and oblique amphidial slits, 10-11 µm long stylet, vulva at 65-67% of body length, 15.5-17 µm long spicules, and an elongate conoid tail with a pointed terminus. It is the second species of the genus Discopersicus and differs from its counterpart D. iranicus, by its anterior position of vulva, shorter stylet, lower M.B. ratio, different shape of tail tip, and shorter spicules in male specimens. A molecular phylogenetic analysis using the D2-D3 expansion segments of 28S rDNA sequences, placed the new species in close relationship with five sequences of the genus Boleodorus.

Phylogenetic relationships of Leptolaimus de Man, 1876 (Plectida: Leptolaimidae) with description of two new species from the Persian Gulf, Iran

Summary Members of the family Leptolaimidae are reported for the first time from Iran with description of two new species of Leptolaimus from the Persian Gulf in the south of the country. Leptolaimus hormozganensis sp. n. is described based upon three populations. It differs from other Leptolaimus species in the position of the pharyngeal supplement and the number of precloacal tubular supplements and has a single sickle-shaped tubular pharyngeal supplement at mid-pharynx level in both sexes, 9-12 male precloacal supplements and one female preanal supplement. Leptolaimus dimorphus sp. n. is characterised by the presence of a pharyngeal tubular supplement only in some adults, one female preanal supplement and four male precloacal supplements. It differs from other species in that the pharyngeal supplement is only present in some specimens, presence of four male precloacal supplements, tail 50-59 μm long and ventrosublateral position of vulva on either the right or left side of the body. Near full length SSU rDNA sequences are provided for L. hormozganensis sp. n. and two different males (one with, and one without, a pharyngeal supplement) of L. dimorphus sp. n. COI sequences for three populations of L. hormozganensis sp. n. from different regions of the Persian Gulf are also obtained. New sequences of two Leptolaimus species formed a clade with other sequenced Leptolaimus spp. and representatives of two genera of Leptolaimidae, i.e., Aphanolaimus and Paraplectonema in a phylogeny based on SSU rDNA gene with 1.00/81 Bayesian posterior probability/maximum likelihood bootstrap (BPP/BS) values. Molecular phylogeny confirmed the synonymy of Leptolaimus and Halaphanolaimus that was formerly proposed based only on morphology. Based on SSU sequences and morphological characters, the presence of a pharyngeal supplement may not be a species-specific character and should not be used to differentiate genera.

Description and molecular characterisation of a new nematode species parasitic in the lungs of Strongylopus grayii (Smith) (Anura: Pyxicephalidae) in South Africa.

Rhabdias delangei n. sp. (Nematoda: Rhabdiasidae) is described from the lungs of the clicking stream frog Strongylopus grayii (Smith) in the Western Cape Province of South Africa. The new species is characterised by the nerve-ring being located just posterior to the mid-length of the oesophagus, a pre-equatorial vulva, as well as a thin-walled and apparently underdeveloped rectum. Pairwise analyses based on ITS-28S and partial cox1 gene fragments showed significant differences between R. delangei n. sp. and its congeners from the Afrotropical Realm. Rhabdias delangei n. sp. is the 12th species of Rhabdias Stiles & Hassall, 1905 recorded in Afrotropical amphibians and the second species of the genus found in pyxicephalid hosts. Our phylogenetic analysis based on the ITS-28S region showed that the new species is closely related to the European species R. rubrovenosa (Schneider, 1866). Furthermore, both species are similar with respect to the underdeveloped rectum and pre-equatorial position of vulva.

First Report of Stunt Nematode (Tylenchorhynchus annulatus) on Corn in Ohio

Stunt nematodes (Tylenchorhynchus spp.) are economically important migratory ectoparasitic nematodes that cause damage to many crops, including corn (Benson and Barker 1985; Handoo et al. 2014). Typical damage includes stunting of roots and shoots, chlorosis, and sometimes wilt and defoliation (Benson and Barker 1985). In 2017 and 2018, soil samples were collected from each of five arbitrarily selected 48 × 14-m sections of a 30-year continuous-corn field in Fulton County, Ohio, planted with corn (Zea mays) hybrid NK0142-3120. Localized stunting and wilting were observed in the field. Plant-parasitic nematodes were extracted from 100 cm³ of soil through sieving and decanting, followed by sucrose centrifugal flotation (Jenkins 1964), and initially identified to genus based on morphological traits, using a compound light microscope. Nematodes with traits typical of Tylenchorhynchus sp. were detected in all samples, with a maximum population density of 848 and 1,212/100 cm³ of soil in 2017 and 2018, respectively. Only females were present. Twenty females were picked and individually examined, measured, and identified as Tylenchorhynchus annulatus (Cassidy), based on morphological and morphometric characteristics (Handoo 2000). Females had stylets with lateral knob inclination and lip region slightly offset from body contour with two to three lip annules. The lateral field contained four incisures. The esophagus did not overlap the intestine. The tail was subcylindrical with a broadly rounded terminus. Body, stylet, and tail lengths ranges and means were 756.1 to 914.7 μm (807.1 μm), 17.7 to 21.8 μm (20.8 μm), and 41.4 to 53.6 μm (47.9 μm), respectively. Vulva position ranged from 52.2 to 57.5% (55.3%) and dorsal esophageal outlet from 2.2 to 3.4 μm (2.8 μm). Additionally, de Man’s ratios were as follows: a = 26.8 to 35.4 (29.8), b = 5.3 to 6.8 (6.0), c = 15.6 to 19.1 (16.9), and c′ = 2.2 to 3.0 (2.7). DNA was extracted from single adult females, and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (Tenente et al. 2004). The PCR product was purified and sequenced. The sequence was deposited in GenBank (MN378401.1) and compared with reference sequences by means of BLAST. The comparison revealed a sequence similarity of 99% with T. annulatus (e.g., GenBank accession no. KJ461532.1). A greenhouse bioassay was conducted to fulfill a modified version of Koch’s postulates and confirm reproduction of T. annulatus on corn. Nine pots, each containing soil naturally infested with an average of 348 T. annulatus/100 cm³ of soil were planted with two dwarf corn plants (PI 401757). Pots with soil media containing no stunt nematodes were used as controls. Pots were maintained in the greenhouse at a mean temperature of 24.4°C (22.2 to 26.7°C). After 10 weeks, nematodes were extracted and enumerated as described above, and reproduction factor (RF) was estimated as final population/initial population. All T. annulatus-infested pots had RF ranging from 1.71 to 4.49, with a mean of 3.18. T. annulatus was not recovered from control pots. According to our greenhouse bioassay, T. annulatus is capable of reproducing on corn. There was also a trend toward lower root mass in infested pots compared with check pots, but the mean difference in root weight was not statistically significant. Further research will be needed to assess the impact of this nematode on corn production. To our knowledge, this is the first report of T. annulatus in Ohio.

Three new species of Cloacininae (Nematoda: Strongyloidea) parasitic in Dorcopsis muelleri (Schlegel, 1866) from Papua and Salawati island, Indonesia.

Three new species of Cloacininae are described from Dorcopsis muelleri obtained from Salawati Island and Kaimana, Papua. Cloacina woworae sp. nov. differs from all congeners by having postero-lateral and medio-lateral rays not fused and the esophagus wider anterior to the nerve ring. Compared to its congeners, C. beveridgei sp. nov. resembles C. caballeroi Mawson, 1977, C. cretheis Beveridge, 2002, C. erigone Beveridge, 2002, and C. syphax Beveridge Speare, 1999 in the morphology of the dorsal ray. However, C. beveridgei has distal segments of sub-median papillae longer than the proximal segments. This character differentiates it from C. caballeroi, C. cretheis, and C. erigone, which have the distal segment of the sub-median papilla shorter than the proximal. Furthermore, this new species can be distinguished with C. syphax in having a shorter vagina vera and in the shape of the anterior region of the vagina. Cervonemella kaimanaensis sp. nov. differs from Ce. reardoni, the sole species in the genus Cervonemella, in the shape and longer vagina, shorter and slender tail, shorter position of vulva from posterior end and longer spicules.

New and known species of Nothotylenchus Thorne, 1941 (Nematoda: Anguinidae) from Iran with an updated list of species.

During a survey conducted during 2013-2017, five known and two new species of Nothotylenchus Thorne, 1941 were collected from the southern provinces of Iran. N. brzeskii n. sp. is characterised by a body length of 774-922 µm, lateral fields with four incisures, delicate, short stylet (7-8 µm) with small rounded knobs, pyriform, offset or slightly overlapping basal pharyngeal bulb, posterior vulva position (V = 83.4-84.4), short PUS (5-10 µm), spicules 20.5-23 µm long, and thick tail with rounded to dull terminus. N. siddiqi n. sp. is characterised by a body length of 573-645 µm, six to nine incisures in lateral fields, delicate, short stylet (6.5-7.5 µm) with rounded knobs, pyriform or slightly elongate and offset basal pharyngeal bulb, V = 79.3-81.0, PUS = 26.5-40 µm, short spicules = 14.5-16.5 µm, and tail with rounded terminus. Morphometric data of the studied species are presented and intraspecific variation of their morphometrics and morphological characters is discussed. The list of world Nothotylenchus species is updated, and a dichotomous identification key and an updated tabular compendium for 41 valid species are provided.

New sheath nematode, Hemicycliophora paraconida n. sp. (Rhabditida: Hemicycliophoridae) from Northern forest in Iran

Hemicycliophora paraconida n. sp. from the Tilekenar forest in northern Iran, is described and illustrated. The new species is characterized by having female body length of 907–1197 µm, 286–341 body annuli and a 96–115 µm long stylet. Lateral fields with three longitudinal lines forming two rows of blocks with breaks and anastomosis of transverse striae; each annulus in lateral field with four subcuticular ovate markings. Tail elongated uniformly conoid, with distinct annuli and narrowly rounded to acute terminus. Male possess robust and semi-circular spicules and a well-developed penial tube. Based on molecular and morphological compari-sons, the new species comes close to seven species of the genus namely: H. conida, H. iwia, H. ovata, H. hellenica, H. poranga, H. ornamenta and H. halophila, but it differs from them by the body size, R related indices, stylet length, lateral field structure, vulva position and tail shape. Molecular analyses based on sequences of D2-D3 expansion segments of 28S rRNA gene supported its morphological status as a new species and revealed that the new species is closest to the H. conida clade in the dendrogram inferred using 28S D2-D3 gene.

Morphological and molecular data of two species of the rare genera Thada Thorne, 1941 and Tenunemellus Siddiqi, 1986 (Nematoda: Tylenchidae) from Iran.

Thada populus n. sp. was found in the rhizosphere of Populus euphratica in the city of Dezful, south-western Iran. The new species is characterized by its 365-453 μm body length, cuticle with transverse annuli 0.9-1.2 μm wide, lateral fields with four lines, lip region low with one or two annuli, 7.0-8.5 μm wide at base, longitudinal or slightly sigmoid amphidial slit, delicate stylet 8.4-9.8 μm long with posteriorly directed knobs, dorsal pharyngeal gland opening at 1.0-1.5 μm posterior to the stylet knobs, non-muscular and valve-less median bulb, pyriform and offset basal bulb, almost oval spermatheca, posterior position of vulva (V = 75-79%) without lateral membrane, short post-vulval uterine sac and conical tail with finely to broadly rounded terminus. Morphological differences of the new species with those of the type species, Thada striata, are discussed. Molecular phylogenetic studies of the new species using partial sequences of small subunit ribosomal DNA revealed that the new species formed a clade with Malenchus spp., Filenchus facultativus, F. fungivorus and Filenchus sp. in Bayesian inference. Morphological and molecular phylogenetic studies were also performed on Tenunemellus indicus, the second recovered species, the latter analysis using partial sequences of large subunit ribosomal DNA. In the inferred Bayesian tree, T. indicus formed a clade with Labrys fuzhouensis, Lelenchus leptosoma from the Netherlands, Malenchus spp. and Filenchus discrepans.

Light and Scanning Electron Microscopy on Cucullanus aliyaii Akhtar and Mujib (2012) (Nematoda: Cuculanidae) From the Rabbitfish Siganus canaliculatus of The Red Sea, Egypt

In the present study, new host and locality records of Cucullanus aliyaii Akhtar and Mujib (2012), a cuculanid nematode isolated from the intestine of the rabbitfish, Siganus canaliculatus collected from the Red Sea, coasts of Hurghada city, Egypt during the period from January to September 2017. Fifteen out of 55 (27.3%) of the examined fish were infected. Worms were recorded by naked eyes on the flesh, stomach, intestines, as well as body cavities of the infected fish. Light and scanning electron microscopy revealed that the isolated worms possessed the important criteria characteristic for members of family Cuculanidae: dimensions of oesophagus, spicules, mucron, size of pseudobuccal capsule, eggs, the position of deirids, excretory pore and vulva, numbers and arrangement of caudal papillae, host groups and zoogeographical regions. The recorded parasite was whitish and small-sized, female worms were 9.40±2 (7.4-10.3) x 2.5±0.2 (2.00-2.60) mm while male worms were 6.30±0.02 (6.00-8.30) mm x 1.60±0.02 (1.59-1.73) mm. Oral aperture was dorsoventrally elongate, slit-like, surrounded by distinct collarette, beared one row of small denticles on its inner surface; four submedian cephalic papillae and a pair of prominent lateral amphids present. Oesophagus was of two distinct portions: anterior pseudobuccal capsule measured 0.50±0.02 (0.47-0.053) mm in length, narrowing immediately below nerve ring; and posterior with a club-shaped muscular structure measured 0.45±0.02 (0.41-0.49) mm in length

First report of Longidorus mindanaoensis Coomans, De Ley, Jimenez and De Ley, 2012 (Nematoda: Longidoridae) From a Mangrove Forest in Vietnam.

Longidorus mindanaoensis was recovered from a mangrove forest in Vietnam. The recovered population is in general morphological agreement with the type population, and the characters of pharyngeal bulb, i.e. the same unique pattern of pharyngeal glands nuclei as well as the lip region morphology, amphidial fovea shape and size and position of vulva corroborated its identity. Molecular studies of the recovered population using D2–D3 expansion segments of large subunit ribosomal DNA (LSU rDNA D2–D3) revealed the D2–D3 sequence of recovered population is 99.6% similar to the sequence of the type population. A new morphometric range for body size was recorded for the species based upon present Vietnamese population, and present study emphasized the diversity of Longidorus spp. in Vietnam could be higher than previously assumed.