Porcine DNA Research Articles

Study of pig dna analysis methods in cosmetics: a review

Collagen is one of the components used for cosmetics. Functionally, collagen is derived from pig fat, which functions as a skin conditioning agent (Emollient), emulsion stabilizer (Emulsifier), and as ingredient to increase the viscosity of cosmetic preparations. The method that can detect pig content is the PCR method, which can confirm the presence of DNA content in pigs. In this study, an analysis of cosmetic products containing porcine DNA was carried out using the PCR method. This research was divided into two stages: the initial stage was DNA extraction, and the second stage was PCR analysis. This research is a study through literature study using the narrative review technique. This study aimed to collect information and examine the analysis method of identifying pig DNA contained in cosmetics to obtain the right and accurate way through a literature approach. From the literature study results, it can be concluded that the best extraction method for the isolation of porcine DNA in cosmetic preparations is the extraction method with the Boom Method, while the DNA analysis used to identify porcine DNA in cosmetics is RT-PCR (Real-time Polymerase Chain Reaction). Conventional PCR is because both methods have their respective advantages. The RT-PCR (Real-time Polymerase Chain Reaction) method can amplify and quantify the number of target DNA molecules. The Conventional PCR Method can form DNA bands based on the amplification value.

Detection of porcine DNA in Korean processed foods by real-time PCR.

In this study, a commercial DNA extraction kit and a real-time Polymerase Chain Reaction (PCR) kit were applied to detect porcine DNA in Korean processed foods. The specificity, sensitivity, applicability and inter-laboratory reproducibility were evaluated for analytical method validation. We observed no false-positive or false-negative results in the assay, confirming its specificity. The sensitivity of the real-time PCR was expressed as the limit of detection (LOD), which was determined to be 0.005ng in 35 cycles. In the applicability test, PCR was performed on 12 types of food matrices, and there were no inhibitor effects. An interlaboratory comparison showed no statistically significant (p > 0.05) differences between the results from two laboratories. We analysed 131 samples to determine the presence of porcine DNA for halal certification: 129 samples were negative, and porcine DNA was detected in one sample each of instant noodles and dumpling. The real-time PCR applied in this study is a reliable analytical method to detect porcine DNA in food and can be used easily, quickly and routinely in food facilities.

LAMP Coupled CRISPR-Cas12a Module for Rapid, Sensitive and Visual Detection of Porcine Circovirus 2.

Simple SummaryIn this study, we aimed to establish a visual, rapid, low-cost, sensitive, specific, and portable nucleic acid detection method for PCV2 through coupling LAMP with CRISPR/Cas12a. All the results of LAMP-CRISPR detection, including a low detectable limit of 1 copy/μL, no cross-reaction with main porcine DNA or RNA viruses, and a 100% coincidence rate with qPCR detection, demonstrated that this method was reliable. It has laid the foundation for developing a PCV2 detection kit based on this LAMP-CRISPR method.Porcine circovirus 2 (PCV2) is the main pathogen of porcine circovirus-associated disease (PCVAD), which can cause considerable economic loss to the pig industry. The diagnosis of PCVAD is complicated and requires a series of clinical, pathological, and virological methods. Therefore, a rapid, highly sensitive, on-site, and visual diagnostic approach would facilitate dealing with the spread of PCV2. In this study, we intended to establish a new and effective PCV2 detection method through combining the no specific equipment requirement advantage of loop-mediated isothermal amplification (LAMP) with the property of clustered regular interspaced short palindromic repeats (CRISPR)/Cas12a system possessing the huLbCas12a collateral cleavage activity able to cleave single-stranded DNA fluorophore quencher probe sensor (designed as LAPM-CRISPR). Following a series of optimizations of its reaction conditions, this LAMP-CRISPR-based PCV2 detection could be conducted in constant temperature equipment, with the result reflected in a direct visual readout way. This established PCV2 detection approach presented fine sensitivity, rapidity, specificity, and reliability, as demonstrated by a low detectable limit of 1 copy/μL, completed within an hour, no cross-reaction with main porcine DNA or RNA viruses like PCV1, PCV3, and PEDV, and a 100% coincidence rate with that of the quantitative PCR (qPCR) method in the evaluation of 30 clinical blood samples, respectively. Therefore, this novel method makes rapid, on-site, visual, highly sensitive, and specific detection of PCV2 possible, facilitating the prevention of this pathogen in the field.

Detergent-Free Decellularization of Notochordal Cell-Derived Matrix Yields a Regenerative, Injectable, and Swellable Biomaterial

Porcine notochordal cell-derived matrix (NCM) has anti-inflammatory and regenerative effects on degenerated intervertebral discs. For its clinical use, safety must be assured. The porcine DNA is concerning because of (1) the transmission of endogenous retroviruses and (2) the inflammatory potential of cell-free DNA. Here, we present a simple, detergent-free protocol: tissue lyophilization lyses cells, and matrix integrity is preserved by limiting swelling during decellularization. DNA is digested quickly by a high nuclease concentration, followed by a short washout. Ninety-four percent of DNA was removed, and there was no loss of glycosaminoglycans or collagen. Forty-three percent of the total proteins remained in the decellularized NCM (dNCM). dNCM stimulated as much GAG production as NCM in nucleus pulposus cells but lost some anti-inflammatory effects. Reconstituted pulverized dNCM yielded a soft, shear-thinning biomaterial with a swelling ratio of 350% that also acted as an injectable cell carrier (cell viability >70%). dNCM can therefore be used as the basis for future biomaterials aimed at disc regeneration on a biological level and may restore joint mechanics by creating swelling pressure within the intervertebral disc.

Detection of Porcine DNA in Commercially Processed Meat Products Sold in Sarawak

Porcine DNA authentication in commercial products is critical due to improper or non-certified Halal logo on its packaging. This study detected the presence of porcine DNA in particularly processed meat products sold in Sarawak. A total of 75 samples were collected, consisting of poultry, beef, and seafood products. DNA was isolated and amplified in a polymerase chain reaction that targeted cytochrome B (cytb) and mitochondrial D-loop. PCR products were analysed via gel electrophoresis and viewed through gel documentation. The positive result was observed in 5 samples: 3 from poultry and 2 from beef. The DNA band were detected at an amplicon size of 174 base pairs for poultry products whereas 100 base pairs for beef products. Porcine DNA was absent in seafood products. Positive samples were validated through DNA sequencing. Nucleotide sequences from DNA sequencing were compared with the database using the Basic Local Alignment Search Tool (BLAST). BLAST analysis indicated percentages ranging from 96.83% to 100%, demonstrating high similarity with porcine DNA; one of the samples was labelled with a foreign Halal logo. In summary, this study provides the groundwork for further inspection of the Halal status in commercially processed meat products available in Sarawak.

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.

One-Pot Visual Detection of African Swine Fever Virus Using CRISPR-Cas12a.

African swine fever virus (ASFV) is a leading cause of worldwide agricultural loss. ASFV is a highly contagious and lethal disease for both domestic and wild pigs, which has brought enormous economic losses to a number of countries. Conventional methods, such as general polymerase chain reaction and isothermal amplification, are time-consuming, instrument-dependent, and unsatisfactorily accurate. Therefore, rapid, sensitive, and field-deployable detection of ASFV is important for disease surveillance and control. Herein, we created a one-pot visual detection system for ASFV with CRISPR/Cas12a technology combined with LAMP or RPA. A mineral oil sealing strategy was adopted to mitigate sample cross-contamination between parallel vials during high-throughput testing. Furthermore, the blue fluorescence signal produced by ssDNA reporter could be observed by the naked eye without any dedicated instrument. For CRISPR-RPA system, detection could be completed within 40 min with advantageous sensitivity. While CRISPR-LAMP system could complete it within 60 min with a high sensitivity of 5.8 × 102 copies/μl. Furthermore, we verified such detection platforms display no cross-reactivity with other porcine DNA or RNA viruses. Both CRISPR-RPA and CRISPR-LAMP systems permit highly rapid, sensitive, specific, and low-cost Cas12a-mediated visual diagnostic of ASFV for point-of-care testing (POCT) applications.

Attenuated Total Reflectance-Fourier Transform Infrared (ATR-FTIR) Spectroscopy Coupled with Principal Component Analysis and Polymerase Chain Reaction (PCR) Assay for the Detection of Porcine and Bovine Gelatins in Dental Materials.

Muslims are prohibited from consuming products that contain pig products and their derivatives, including porcine gelatin. Medical and dental products are not exempt from the use of gelatin in their formulation. This study employs attenuated total reflectance-Fourier transform infrared spectroscopy (ATR-FTIR) coupled with principal component analysis (PCA) to detect and distinguish between porcine and bovine gelatins in dental materials. The results were further verified by polymerase chain reaction (PCR) assay. Species-specific primers targeting the 212 bp porcine cytochrome b and 271 bp bovine cytochrome b genes were used to amplify DNA in nine dental material samples. Detection and distinction of gelatin standards (bovine and porcine) against gelatin present in the dental materials was achieved using ATR-FTIR combined with PCA within wavenumber 1756 cm−1–1584 cm−1 (Amide I and Amide II). The detection limit for DNA was 0.001 ng/μL and 0.0001 ng/μL for bovine and porcine gelatins, respectively. Using PCR, one sample, BDM 01, was found to contain both porcine and bovine DNA, while one sample (BDM 14) was found to be positive for bovine DNA. The findings suggest that ATR-FTIR combined with PCA and conventional PCR are applicable for the identification of porcine and bovine gelatin in dental materials.

Detection of porcine species DNA on meat processed food samples (shredded meat) using Real-Time PCR

DNA detection of porcine species in processed meat samples (shredded meat) was carried out as an effort to enrich the literature and reference alternative testing methods in the control of halal products circulating in Indonesia. The purpose of this study was to detect the DNA of porcine species in samples using real-time PCR. The research method used is a qualitative technique. This technique analyzes the CT value of the sample compared to the positive control by looking at the formation of the sigmoid curve if amplification occurs. The controls used consisted of negative control, positive control, other DNA control, and LOD control. The extraction technique used is the column centrifuge technique. The extraction results were then measured using a nano photometer to see the purity and concentration of the extracted DNA. Based on the research, it is known that the extraction results read on a nanophotometer at a wavelength of A260 / A280 show a concentration of 24,350 with a purity value of 21,164. For sample testing, the results of real-time PCR analysis showed the sample was detected at CT 39.77, positive control at CT 31.66, and LOD at 28.32. for negative control and specificity using other DNA was not detected. The conclusion of this research is that the sample used can be detected by the presence of porcine DNA.

Optimization of Zeesan SARS-COV-2 Test Kit for Porcine DNA Detection Tests on Processed Meat Products and Complex Processed Product

Various brands of covid 19 RNA detection kits are widely used by covid 19 testing laboratories. One of these kits is the Zeesan SARS COV-2 Test Kit. The Zeesan kit cannot be used to detect porcine DNA. There has been no official research on the use of optimized covid 19 detection kits for porcine DNA detection, thus the optimization of the Zeesan SARS COV-2 Test Kit used to detect porcine DNA is a new innovation in molecular testing. The purpose of this study was to find the right combination between the Zeesan SARS COV-2 Test Kit detection kit and the porcine primer-probe. Then look for the appropriate temperature setting for the amplification process for porcine DNA testing. Analysis using Liferiver brand real-time PCR with hydrolysis probe method. The study was conducted by running 3 types of positive porcine samples with 3 different concentrations. The research sample used sausage, ham, and noodles. The results showed that the combination detection kit of Zeesan SARS COV-2 Test Kit-primary probe porcine successfully detected porcine DNA in 3 positive samples of porcine with a concentration of 10 ng and 5 ng. Meanwhile, at a concentration of 1 ng, it could only be detected in 2 positive samples. In addition, this study showed a relatively faster detection time of porcine DNA than several previous studies.

An Eva Green Real-Time PCR Assay for Porcine DNA Analysis in Raw and Processed Foods

Abstract The prevalence of the inclusion or substitution of porcine and its derivatives in foods by imprudent food manufacturers accentuated the need for a sensitive and specific method to detect porcine DNA. This work aimed to develop and validate an EvaGreen dye-based quantitative real-time (qPCR) assay for porcine DNA analysis. The primer set used in this work targets a 95-bp fragment of the porcine cytochrome b gene. Application of the assay to dilutions of porcine genomic DNA showed that the assay is sensitive down to 10 pg/μL of porcine DNA and the detection limit, under binary admixture conditions, was 0.001%. A correlation coefficient (R2) of 0.998 and PCR efficiency of 101.6% over the dynamic range from 10 to 10000 pg/μL indicated that the assay has high linearity and efficiency. The method’s specificity towards porcine was revealed by the amplification profile, which only displayed an amplification signal for porcine DNA. These findings suggest that the developed assay is sensitive, specific, and rapid. In conclusion, the assay can be used as an alternative method to detect and quantify porcine DNA in raw and processed food products.

Meatball model of porcine DNA detection by TaqMan probe real-time PCR

Food adulteration has attracted a great deal of public concern as it affects consumers of different religious beliefs, social backgrounds and economic perspectives. Meat adulteration usually occurs through the substitution of beef with pork due to its lower price and manufacturer’s profit motivation. This study was conducted to detect porcine DNA in a spiked meatball model using real-time quantitative polymerase chain reaction (qPCR) targeting the cytochrome B gene through the designing of specific primers and probe sequences. In this study, the amplification efficiency of the designed primers and probe was 95%, with a correlation coefficient (R2 ) of 0.997, following amplification with a series of 10-fold serial dilutions of porcine DNA. The specificity of the probe was evidenced by the absence of amplification from DNA of eight different meat species, including chicken, cow, duck, quail, buffalo, rabbit, deer and mutton. Conversely, pork DNA was detected at a threshold cycle of 13.47±0.31, following amplification of 10 ng/ µL DNA. In addition, the assay detected a level of pork DNA as low as 0.01 ng/µL in raw spiked beef meatball models and 0.1 ng/µL in heat-treated spiked chicken and beef meatball models. This study is critical, mainly for the Muslim and Jewish communities and individuals who are allergic to pork.

Detection of porcine DNA in food using direct asymmetric PCR and catalyzed hairpin assembly fluorescent biosensor: A novel assay for halal food analysis

Adulteration of halal-certified food with pork are often reported. Using direct PCR results in cost- and time-saving benefits, and allows flexibility in amplicon detection. Here, we aimed to develop and validate a novel, direct asymmetric PCR and catalyzed hairpin assembly fluorescent biosensor (daPCR-CHA-FB) with a portable LED lightbox for naked eye detection of porcine DNA in raw and processed food. We tested the assay's reproducibility, specificity, sensitivity, real-world applicability, and single-blind performance. Using only 1 mm3 samples, reproducibility test with 38 raw pork samples showed 2.6% false negative rate and 0.0% false positive rate. The lowest detection limits were 0.01 ng for porcine DNA and 0.1% for binary pork-and-beef mixture. No cross-reaction with 16 other species was observed. One-hundred market samples showed no false negative for pork-listed samples, while two samples declared as non-pork showed a positive reaction. The assay was simple, sensitive, specific, safe, and robust. It could be used by law enforcement agencies and small-scale laboratories to investigate contamination and adulteration of halal foods.

Comparison of real time PCR and conventional PCR by identifying genomic DNA of bovine and porcine

Bovine and porcine are poultry meat that consumed worldwide particularly in Southeast Asia.Both of them are prone to food counterfeit owing to several factors such as price, appetite and Halal status. Sensitive and selective analytical methods are required to control meat products that distributed to markets. This paper studied the sensitivity between real – time and conventional PCR or known as qPCR and cPCR, respectively. Bovine and porcine were samples used to verify the sensitivity of them. Nevertheless, those instruments did not show a specific difference during DNA analysis of bovine and porcine. In conventional PCR, two pairs of DNA primers targeted cytochrome b (Cyt b) was analyzed, resulting of 120 and 131 amplicons, respectively. While qPCR applied to analyze porcine and bovine DNA. The detection limit of qPCR after porcine and bovine analysis were at 0.004 and 0.007 µg/µL, respectively. Results demonstrated the qPCR was reliable for verifying porcine and bovine DNA compared to conventional PCR. Furthermore, the study concluded that the developed assay can be easily employed for the identification of porcine and bovine tissue in food products in low resource areas.

Novel primer targeting the mitochondrial NADH dehydrogenase subunit 4 (ND4) and NADH dehydrogenase subunit 5 (ND5) for detection of porcine (Sus scrofa) DNA fragments in food products for halal authentication

In this research, a pair primer targeting NADH dehydrogenase subunit 4 (ND4) gene of porcine (Sus scrofa) mt-DNA was designed and tested for its specificity. The ND4 primer was compared for its robustness against an established primer pair designed to amplify the NADH dehydrogenase subunit 5 (ND5) gene. The samples include non-halal meat animals (dog, porcine, and rat) and halal meat animals (chicken, cow, and horse). DNA from raw meat was isolated by modified Chloroform Isoamyl-Alcohol method and then was analyzed quantitatively with NanoDrop™ spectrophotometer followed by amplification using PCR technique. The amplification results proved that the two pairs of primers were specific, resulting in amplification of 120 bp DNA target for ND4 and 227 bp for ND5. It can be concluded that the two primers can differentiate between halal and non-halal animals. However, to determine the sensitivity of each primer, further research is needed.

REAL-TIME PCR TO IDENTIFY PORCINE DNA IN PROSTHODONTIC MATERIALS

Objectives: This study aimed to identify porcine DNA in prosthodontic materials using Real-Time PCR. Materials and methods: Eighteen prosthodontic materials: three irreversible hydrocolloids, three elastomers, three denture adhesives, three soft denture linings, three temporary crowns, and three denture bases materials were used as the samples. It was conducted in two stages. First, extraction of dental material’s DNA and the second was Real-Time PCR analysis based on amplification curve and Ct score in yellow and green channel. Results: The sample analysis based on green channel demonstrated that all materials did not contain porcine DNA, however, 11 of 18 samples (DA-01, DA-02, DA-03, SDL-02, DB-01, DB-02, TC-03, IH-02, EM-01, EM-02, and EM-03) contained vertebrate DNA. Conclusions: All prosthodontic materials tested were not containing porcine. The halal statues of the materials were still unclear.

LAMP assay coupled with CRISPR/Cas12a system for portable detection of African swine fever virus.

African swine fever (ASF) is one of the most severe infectious diseases of pigs. In this study, a loop-mediated isothermal amplification (LAMP) assay coupled with the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas12a system was established in one tube for the detection of the African swine fever virus (ASFV) p72 gene. The single-stranded DNA-fluorophore quencher reporter and CRISPR-derived RNA were screened and selected for the CRISPR detection system. In combination with LAMP amplification assay, the detection limit for the LAMP-CRISPR assay can reach 7 copies/μl of p72 gene per reaction. Furthermore, this method displays no cross-reactivity with other porcine DNA or RNA viruses. The performance of the LAMP-CRISPR assay was compared with real-time qPCR tests for clinical samples; a good consistency between the LAMP-CRISPR assay and real-time qPCR was observed. The method shed a light on the convenient, portable, low cost, highly sensitive and specific detection of ASFV, demonstrating a great application potential for monitoring on-site ASFV in the field.

The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Hexaferrocenium tri[hexa(isothiocyanato)iron(III)] trihydroxonium complex as a new DNA intercalator for electrochemical DNA biosensor

Ferrocene or ferrocenium has been widely studied in the field of organometallic complexes because of its stable thermodynamic, kinetic and redox properties. Novel hexaferrocenium tri[hexa(isothiocyanato)iron(III)]trihydroxonium (HexaFc) complex was the product from the reaction of ferrocene, maleic acid and ammonium thiocyanate and was confirmed by elemental analysis CHNS, FTIR and single crystal X-ray crystallography. In this study, HexaFc was used for the first time as an electroactive indicator for porcine DNA biosensor. The UV–Vis DNA titrations with this compound showed hypochromism and redshift at 250 nm with increasing DNA concentrations. The binding constant (Kb) for HexaFc complex towards CT-DNA (calf-thymus DNA) was 3.1 × 104 M−1, indicated intercalator behaviour of the complex. To test the usefulness of this complex for DNA biosensor application, a porcine DNA biosensor was constructed. The recognition probes were covalently immobilised onto silica nanospheres (SiNSs) via glutaraldehyde linker on a screen-printed electrode (SPE). After intercalation with the HexaFc complex, the response of the biosensor to the complementary porcine DNA was measured using differential pulse voltammetry. The DNA biosensor demonstrated a linear response range to the complementary porcine DNA from 1 × 10−6 to 1 × 10−3 µM (R2 = 0.9642) with a limit detection of 4.83 × 10−8 µM and the response was stable up to 23 days of storage at 4 °C with 86% of its initial response. The results indicated that HexaFc complex is a feasible indicator for the DNA hybridisation without the use of a chemical label for the detection of porcine DNA.

Development of a new and sensitive method for the detection of pork adulteration in gelatin and other highly processed food products

ABSTRACT Porcine adulteration has become a major concern amongst communities including Muslims and Jews. Reliable detection of the presence of porcine DNA in gelatin and highly processed food samples is essential for Halal and kosher food control. In this study, a forensic approach involving DNA isolation and real-time polymerase chain reaction (PCR) was performed to detect the presence of porcine DNA in commercial gelatin and processed foods containing porcine by-products. The method was compared with commercially sensitive porcine DNA detection kits (Biotecon and R-Biopharm) which are commonly used in food control laboratories for Halal and kosher authentication. The results indicated that a newly developed method called TübiGel was at least 10 times more sensitive for porcine DNA detection. The TübiGel method was found to have a detection limit of 0.01% porcine gelatin, whilst the Biotecon method had 0.1% and R-Biopharm method detected >5% porcine gelatin. The forensic DNA isolation approach of the TübiGel method was found to be a critical step. In addition, real-time PCR of TübiGel method was also found to detect porcine DNA better than real-time PCR of commercial kits.