Polymorphic Sites Research Articles

Low cycle number multiplex PCR: A novel strategy for the construction of amplicon libraries for next-generation sequencing.

Multiplex PCR is a critical step when preparing amplicon library for next-generation sequencing. However, there are several challenges related to multiplex PCR including poor uniformity, nonspecific amplification, and primer-dimers. To address these issues, we propose a novel solution strategy that involves using a low cycle number (<10 cycles) in multiplex PCR and then employing carrier DNAs and magnetic beads for the selection of targeted products. This technique improves the amplicon uniformity while also reducing primer-dimers and PCR artifacts. To evaluate our technique, we initially utilized 120 DNA fragments from mouse genome containing single nucleotide polymorphism (SNP) sites. Sequencing results demonstrated that with only 7 cycles of multiplex PCR, 95.8% of the targeted SNP sites were mapped, with a coverage of at least 1×. The average sequencing depth of all amplicons was 1705.79±1205.30×; 87% of them reached a coverage depth that exceeded 0.2-fold of the average sequencing depth. Our method had a greater uniformity (87%) when compared to Hi-Plex PCR (53.3%). Furthermore, we validated our strategy by randomly selecting 90 primer pairs twice from the initial set of 120 primer-pairs. Next, we used the same protocol to prepare amplicon libraries. The two groups had an average sequencing depth of 1013.30±585.57× and 219.10±158.27×, respectively; over 84% of the amplicons had a sequencing depth that exceeded 0.2-fold of average depth. These results suggest that the use of a low cycle number in multiplex PCR is a cost-effective and efficient approach for the preparation of amplicon libraries.

Genetic characteristics of Blastocystis sp. in cattle from Hebei Province, China

Blastocystis sp. is a protozoan parasite that infects the intestines of humans and animals, causing chronic diseases such as skin rashes, abdominal pain, and irritable bowel syndrome. A survey was conducted to determine the prevalence and genetic diversity of Blastocystis sp. infection in cattle, in Hebei Province, China. 2746 cattle fecal samples were collected from 11 cities in Hebei Province and analyzed using polymerase chain reaction targeting the Blastocystis sp. barcoding gene. MEGA, PhyloSuite, and PopART were used to analyze the subtype, sequence signature, pairwise genetic distance, and genetic diversity indices. The results showed that the Blastocystis sp. detection rate was 12.60% (346/2746). The infection rate in different herds was affected by region, age, breeding mode, and variety; that is, the infection rates in areas of southern Hebei, cattle under one year old, intensive raising, and dairy cattle were higher than the infection rates in northern Hebei, cattle over one year old, scatter feeding, and beef cattle. Seven Blastocystis subtypes were identified, namely, ST1, ST2, ST5, ST10, ST14, ST21, and ST26; ST10 was the dominant subtype, and ST14 was the second most common subtype. A total of 374 polymorphic and conserved sites were obtained, including 273 invariable (monomorphic) sites and 101 variable (polymorphic) sites, accounting for 27.01% of all nucleotides. The nucleotide diversity index (Pi) was 0.07749, and the haplotype (gene) diversity index (Hd) was 0.946. This study provides the first comprehensive information on the epidemiological situation of Blastocystis sp. infection in cattle from Hebei Province, China, and revealed rich genetic diversity of Blastocystis sp.

Abstract 3898: SJPedPanel: A pan-cancer gene panel for childhood malignancies

Abstract Background: Extensive efforts in the past decade have revolutionized our understanding of the genetic underpinnings of childhood malignancies and identified numerous driver alterations that can provide potential targets for novel therapy and are excellent biomarkers for disease monitoring. For these purposes, a whole genome or exome sequencing approach can be resource prohibitive. Numerous gene panels are developed for adult cancers to address these challenges. Due to the dramatic differences in driver gene landscapes between pediatric and adult cancers, a gene panel for childhood cancers is needed. Results: Here, we have developed a gene panel dedicated to childhood cancers. This panel (2.8 Mbp) covers 5275 coding exons of 357 driver genes, 297 introns frequently involved in rearrangements that generate fusion oncoproteins, commonly deleted regions, such as CDKN2A and PAX5 (for B-/T-ALL) and SMARCB1 (for ATRT), and 7,590 polymorphism sites to detect copy number alterations for interrogating tumors with aneuploidy, such as hyperdiploid and hypodiploid B-ALL or 17q gain neuroblastoma. We used driver alterations reported from an established real-time clinical genomics cohort (n=253) to investigate the effectiveness of this gene panel. Among the 485 pathogenic variants reported, our panel covered 417 variants (86%). For 90 rearrangements responsible for oncogenic fusions, our panel covered 74 events (82%). We re-sequenced 113 previously characterized clinical specimens at an average depth of 2,500X using SJPedPanel and recovered 355 (90%) of the 396 reported pathogenic variants. Among the 30 unique genes of the 41 missed alterations, 29 genes are mutated in pediatric cancers with a low frequency (&amp;lt;0.21%) and hence not covered in the panel. We then investigated the power of this panel in detecting mutations from specimens with low tumor content (as low as 0.1%) using cell line-based dilution experiments and discovered that this gene panel enabled us to detect ~80% variants with allele fraction of 0.2%, while the detection rate decreases to ~50% when the allele fraction is 0.1%. We finally demonstrate its utility in disease monitoring on clinical specimens collected from AML patients in morphologic remission. Conclusion: Overall, our gene panel enables the detection of clinically relevant genetic alterations including rearrangements responsible for subtype-defining fusions for childhood cancers by targeted sequencing of ~0.15% of human genome. Our panel will significantly enhance the analysis of specimens with low tumor burdens for cancer monitoring and early detection. Citation Format: Pandurang Kolekar, Vidya Balagopal, Li Dong, Yanling Liu, Scott Foy, Quang Tran, Heather Mulder, Anna LW Huskey, Emily Plyler, Zhikai Liang, Jingqun Ma, Joy Nakitandwe, Jiali Gu, Jamie Maciaszek, Debbie Payne-Turner, Saradhi Mallampati, Lu Wang, John Easton, Jeffery M. Klco, Xiaotu Ma. SJPedPanel: A pan-cancer gene panel for childhood malignancies [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 3898.

Exploring Genetic Diversity and Phylogenetic Relationships in Camellia reticulata Cultivars Using Novel Low-Copy Nuclear Gene Markers

This study delves into the exploration of genetic diversity and phylogenetic relationships within Camellia reticulata cultivars, providing a vital reference for horticultural research on this hetero-hexaploid species. Utilizing available transcriptome data from C. reticulata, novel low-copy nuclear gene sequences were successfully identified. With tailored primer design, these genes were amplified and sequenced from 100 C. reticulata cultivars originating from Kunming, Chuxiong, Dali, and Tengchong in China. Five distinct low-copy nuclear gene sequences were found to collectively span 3481 bp, showcasing 71 polymorphic mutation sites (Pi = 0.0077) and 91 haplotypes (Hd = 0.9974). The genetic diversity among cultivars from the four provenances ranked Tengchong &gt; Dali &gt; Kunming &gt; Chuxiong. AMOVA analysis revealed that 96.50% of the genetic variation exists within the provenances. Low genetic distance and differentiation (Fst= 0.0199) were observed among cultivars from the four provenances. Ninety-nine cultivars were clustered into four clades, corresponding to the three ancestors of C. reticulata (diploid C. reticulata, C. pitardii, and C. saluenensis). The novel low-copy nuclear gene sequence markers developed in this study provide an effective tool for analyzing genetic diversity, phylogenetic relationships, and origination of C. reticulata cultivars.

Karyotype evolutionary diversification in marine fishes. First classical and molecular cytogenetic data on four Atlantic species

ABSTRACT Fishes present an exceptional level of diversification among vertebrates, whose adaptive instructions contained in their genome are physically organised in their chromosomes. Although cytogenetic data are useful to help understand the evolutionary processes, they are restricted or unavailable for many fish families. Cytogenetic characteristics of one Atlantic member of the Kyphosidae, Cirrhitidae, Pempheridae and Bythitidae families – about which little or no prior data is known – are described here. Conventional chromosomal analysis and the mapping of the 18S and 5S ribosomal DNA sequences revealed substantial variations in the diploid number (2n = 38–48) and structure of the chromosomes (FN = 48–84; i.e. number of chromosome arms), as well as in the rDNA distribution (simple, multiple and polymorphic sites). The findings extend the cytogenetic data for reef fish groups across a wider phylogenetic range and reveal the various ways in which karyotype evolution has taken place in the marine environment.

Expression, Polymorphism, and Potential Functional Sites of the BMPR1A Gene in the Sheep Horn.

Sheep horns are composed of bone and sheaths, and the BMPR1A gene is required for cartilage and osteogenic differentiation. Therefore, the BMPR1A gene may have a function related to the sheep horn, but its relationship with the sheep horn remains unclear. In this study, we first utilized RNA sequencing (RNA-seq) data to investigate the expression of the BMPR1A gene in different tissues and breeds of sheep. Second, whole-genome sequencing (WGS) data were used to explore the functional sites of the BMPR1A gene. Lastly, the allele-specific expression of the BMPR1A gene was explored. Our results indicate that BMPR1A gene expression is significantly higher in the normal horn groups than in the scurred groups. Importantly, this trend is consistent across several sheep breeds. Therefore, this finding suggests that the BMPR1A gene may be related to horn type. A total of 43 Single-Nucleotide Polymorphisms (SNPs) (F-statistics > 0.15) and 10 allele-specific expressions (ASEs) exhibited difference between the large and small horn populations. It is probable that these sites significantly impact the size of sheep horns. Compared to other polled species, we discovered ten amino acid sites that could influence horn presence. By combining RNA-seq and WGS functional loci results, we identified a functional site at position 40574836 on chromosome 25 that is both an SNP and exhibits allele-specific expression. In conclusion, we demonstrated that the BMPR1A gene is associated with horn type and identified some important functional sites which can be used as molecular markers in the breeding of sheep horns.

Symbiotic efficiency of Rhizobium leguminosarum sv. trifolii strains originating from the subpolar and temperate climate regions

Red clover (Trifolium pratense L.) is a forage legume cultivated worldwide. This plant is capable of establishing a nitrogen-fixing symbiosis with Rhizobium leguminosarum symbiovar trifolii strains. To date, no comparative analysis of the symbiotic properties and heterogeneity of T. pratense microsymbionts derived from two distinct geographic regions has been performed. In this study, the symbiotic properties of strains originating from the subpolar and temperate climate zones in a wide range of temperatures (10–25 °C) have been characterized. Our results indicate that all the studied T. pratense microsymbionts from two geographic regions were highly efficient in host plant nodulation and nitrogen fixation in a wide range of temperatures. However, some differences between the populations and between the strains within the individual population examined were observed. Based on the nodC and nifH sequences, the symbiotic diversity of the strains was estimated. In general, 13 alleles for nodC and for nifH were identified. Moreover, 21 and 61 polymorphic sites in the nodC and nifH sequences were found, respectively, indicating that the latter gene shows higher heterogeneity than the former one. Among the nodC and nifH alleles, three genotypes (I–III) were the most frequent, whereas the other alleles (IV–XIII) proved to be unique for the individual strains. Based on the nodC and nifH allele types, 20 nodC-nifH genotypes were identified. Among them, the most frequent were three genotypes marked as A (6 strains), B (5 strains), and C (3 strains). Type A was exclusively found in the temperate strains, whereas types B and C were identified in the subpolar strains. The remaining 17 genotypes were found in single strains. In conclusion, our data indicate that R. leguminosarum sv. trifolii strains derived from two climatic zones show a high diversity with respect to the symbiotic efficiency and heterogeneity. However, some of the R. leguminosarum sv. trifolii strains exhibit very good symbiotic potential in the wide range of the temperatures tested; hence, they may be used in the future for improvement of legume crop production.

Genetic characterization of minor carp (Labeo gonius) from Indian rivers revealed through mitochondrial ATPase 6/8 and D-loop region analysis: implications for conservation and management

India is the habitat of many freshwater fish species that make a significant contribution to endemism. However, the native species population is declining at a very fast rate due to pollution, habitat loss or degradation, new species introduction, hydrologic alterations, and overfishing. The minor carp, Labeo gonius, is one of the important fish species in the Indian river systems and holds enormous potential in culture fisheries. Therefore, the precise status of population structure is a prerequisite for the management of the species. In the present study, we assessed the potential of mtDNA ATPase 6/8 and D-loop regions as markers to determine the genetic diversity and phylogeography of L. gonius from Indian rivers. We have selected five major Indian rivers for investigation which could represent geographically distant populations of the studied fish. A total of 210 ATPase 6/8 sequences (842 bp) and 203 D-loop region sequences (683 bp) of L. gonius from the five major Indian rivers were submitted to NCBI. Results revealed that ATPase 6/8 has 17 haplotypes and 70 polymorphic sites with an overall haplotype diversity of 0.560 ± 0.036 and nucleotide diversity of 0.00347 ± 0.00. Furthermore, D-loop analysis revealed 58 haplotypes, 67 polymorphic sites, 0.954 ± 0.006 overall haplotype diversity, and 0.01914 ± 0.00 nucleotide diversity. The hierarchical AMOVA analysis indicated that a high proportion of the genetic variation (76.46% and 70.22% for the D-loop and ATPase 6/8 regions, respectively) was attributed to among-population variation under gene pool-1 (considering all the stocks from Ganga, Brahmaputra, Teesta, Narmada, and Mahanadi as a single pool). Furthermore, in gene pool-2, samples were divided into two groups: group 1 (Himalayan rivers)—Ganga, Brahmaputra, and Teesta; and group 2 (peninsular rivers)—Narmada and Mahanadi. Genetic variations in the D-loop and ATPase 6/8 regions were found among populations within groups at 70.65% and 53.48%, respectively. Haplotype network analysis revealed that there were significant differences in distributions and frequencies. The observed unique haplotypes might be useful for differentiating the stocks. In brief, the present study suggested that the D-loop and ATPase 6/8 regions are potential markers and represent a significant contribution to the genetic characterization of the minor carp L. gonius from major Indian rivers. Moreover, the L. gonius population along the east coast especially in the Himalayan rivers (Ganga, Brahmaputra, and Teesta river basin) is found to be genetically more diverse. The results would provide a scientific basis for the assessment of fisheries resources and management of this important species.

Hepatitis B virus preCore/Core region variability in pregnant women in the Republic of Guinea

Introduction. The vertical route of hepatitis B virus (HBV) transmission is a significant problem in African countries, which is characterized by late diagnosis of the disease and high mortality. The high prevalence of hepatocellular carcinoma (HCC) in Africa may be due to variability in the HBV preCore/Core region, mutations in which contribute to disease progression. Molecular genetic characterization of strains circulating among pregnant women may reflect the overall mutational profile of the pathogen in the population.&#x0D; The objective of this study was to analyze the variability of the HBV preCore/Core region circulating among pregnant women in the Republic of Guinea.&#x0D; Materials and methods. The study material included 480 plasma samples obtained from HBV-positive pregnant women from the Republic of Guinea. For all samples, the nucleotide sequences of the preCore/Core region of the HBV genome were sequenced and analyzed.&#x0D; Results. Amino acid variability in the preCore region was determined in 211 (43.96%), and in the Core region in 473 (98.54%) patients. 12 polymorphic sites of the preCore region were identified in which amino acid substitutions occurred, including 8, 2 and 5 positions identified for genotypes E, A and D, respectively. In the Core region, 67 substitution positions were identified, including 46 in samples of genotype E, 23 in HBV genotype A and 26 in genotype D. It was shown that the distribution of substitutions in the preCore and Core regions in HBV genotypes E, A and D differs significantly with a predominance in mutations among HBV genotype E — p 0.0001. Individual characteristic mutations have been identified for each genotype. The most common clinically significant mutations in the preCore/Core region in the study group were identified, including pc-H5D (27,08%), pc-W28* (35,21%), c-E64D (33,54%), c-L116I/V/G (91,46 %), c-T146N (73,13%). The double mutation A1762T/G1764A in the basal core promoter was shown in 74 samples of HBV genotype E, which accounted for 15.42% of the total group and 16.59% of patients with HBV genotype E.&#x0D; Conclusion. The frequency of clinically significant preCore/Core mutations among pregnant women in the Republic of Guinea was determined. The data obtained reflect their prevalence in the general population and can be used to predict the progression of chronic HBV among the region's population.

A peek into the population genetics of white teatfish (Holothuria fuscogilva) of Kenya's south coast.

The white teatfish, Holothuria fuscogilva, is widely distributed in coastal areas, including waters around coral reefs and seagrasses in the Indo-Pacific. In Kenya, the species is distributed in shallow reefs with higher landings reported from the Vanga-Shimoni-Gazi seascape on the Kenyan south coast. Despite its high exploitation for export and its vulnerable and endangered statuses under IUCN and CITES respectively, Kenya's H. fuscogilva populations and how they may have been impacted by the fishing pressure have not been studied. We estimated the genetic diversity and structure of H. fuscogilva population conveniently sampled from three sites in Kenyan south coast using the mitochondrial cytochrome oxidase subunit I (COI) gene sequences. We recorded 30 haplotypes with 43 polymorphic sites across the population. Furthermore, we estimated an overall high haplotype diversity and low nucleotide diversity of estimates of h = 0.970 ± 0.013 and π = 0.010 ± 0.001 respectively. These preliminary findings suggest several population outcomes, among them a fit population, which require confirming with more comprehensive study to inform strategies for the sustainable exploitation and management of the species.

Uganda chicken genetic resources: II. genetic diversity and population demographic history inferred from mitochondrial DNA D-loop sequences.

The genetic diversity of indigenous chickens, which comprise over 80% of the chicken resources in Uganda, is largely not well-characterized for their genetic contribution. This study assessed the genetic diversity and population structure of the indigenous chicken population in Uganda to serve as an essential component for improvement and conservation strategies. A set of 344 mitochondrial DNA (mtDNA) D-loop sequences among 12 Ugandan chicken populations was evaluated. Twenty-eight polymorphic sites, accounting for 4.26% of the total analyzed loci of 658bp, defined 32 haplotypes. The haplotype diversity (Hd) was 0.437, with a nucleotide diversity (π) of 0.0169, while the average number of nucleotide differences (k) was 0.576, indicating a population that is moderately genetically diverse. Analysis of molecular variance found 98.39% (ρ < 0.01) of the total sequence variation among the chicken haplotypes within populations, 1.08% (ρ < 0.05) among populations, and 0.75% (ρ > 0.05) among populations within regions. This revealed subtle genetic differentiation among the populations, which appeared to be influenced by population fragmentation, probably due to neutral mutation, random genetic drift, and/or balancing selection. All the haplotypes showed affinity exclusively to the haplogroup-E mtDNA phylogeny, with haplotype UGA01 signaling an ancestral haplotype in Uganda. Neutrality tests Tajima's D (-2.320) and Fu's Fs (-51.369), augmented with mismatch distribution to measure signatures of recent historical demographic events, supported a population expansion across the chicken populations. The results show one matrilineal ancestry of Ugandan chickens from a lineage widespread throughout the world that began in the Indian subcontinent. The lack of phylogeographic signals is consistent with recent expansion events with extensive within-country genetic intermixing among haplotypes. Thus, the findings in this study hold the potential to guide conservation strategies and breeding programs in Uganda, given that higher genetic diversity comes from within the chicken population.

Identification of Cervi Cornu (Cervus elaphus) and its formula granules based on PCR-RFLP

Cervi Cornu is the ossified antler, or the base antler that falls off in the spring of the following year after the pilose antler is sawn off from Cervus elaphus or C. nippon, as a precious traditional Chinese medicine, has been recognized for its medicinal value and widely used in clinical practice. However, the origins of Cervi Cornu are miscellaneous, and Cervi Cornu is even mixed with adulterants in the market. Currently, there is a shortage of ways to identify Cervi Cornu and no standard to control the quality of Cervi Cornu. So it is valuable to develop a way to effectively identify Cervi Cornu from the adulterants. In this study, the differences in the mitochondrial barcode cytochrome b(Cytb) gene sequences of C. elaphus, C. nippon and their related species were compared and the specific single nucleotide polymorphism(SNP) sites on the Cytb sequences of Cervi Cornu were screened out. According to the screened SNPs, Cervi Cornu-specific primers dishmy-F and dishmy-R were designed. The PCR system was established and optimized, and the tolerance and feasibility of Taq polymerases and PCR systems affecting the repeatability of the PCR method were investigated. The amplification products of C. elaphus and C. nippon were digested using the restriction enzyme MseⅠ. The results showed that after electrophoresis of the product from PCR with the annealing temperature of 56 ℃ and 35 cycles, a single specific band at about 100 bp was observed for C. elaphus samples, and the product of C. elaphus samples was 60 bp shorter than that of C. nippon samples. There was no band for adulterants from other similar species such as Alces alces, Rangifer tarandus, Odocoileus virginianus, O. hemionus, Cap-reolus pygargus, Przewalskium albirostis and negative controls. The polymerase chain reaction-restriction fragment length polymorphism(PCR-RFLP) method established in this study can quickly and accurately identify Cervi Cornu originated from C. elaphus in crude drugs, standard decoctions, and formula granules, and distinguish the origins of Cervi Cornu products, i.e., C. nippon and similar species. This study can be a reference for other studies on the quality standard of other formula granules of traditional Chinese medicines.

Genome-Wide Association Analysis of Cowpea Mild Mottle Virus Resistance in Soybean Germplasms from Northeast China

Cowpea mild mottle virus (CpMMV) is an important viral pathogen that seriously influences the yield and seed quality of soybeans worldwide. Resistance breeding is one of the most effective, economical, and environmentally safe strategies for controlling the disease caused by CpMMV. However, only few resistance genes have been identified in soybeans. In this study, the resistance of 169 soybean germplasms from Northeast China to a CpMMV strain isolated from soybean in China was evaluated, and a genome-wide association study (GWAS) was then performed to find possible resistance genes in these soybean germplasms. Nine resistant soybean germplasms were identified and two single nucleotide polymorphism sites (SNPs) were found to be closely associated with CpMMV resistance. A total number of 51 and 25 candidate genes neighboring the resistance-associated SNPs on chromosomes 6 and 12, respectively, were identified, among which one receptor-like kinase (RLK) on chromosome 6 and 2 toll-interleukin-1 receptor nucleotide-binding leucine-rich repeat receptors (TNLs) on chromosome 12 were recognized as the most probable resistance genes, respectively. Together, these data provide new insights on the resistance resources of soybeans to CpMMV, which will benefit the breeding of CpMMV-resistant soybean cultivars.

Research on the Correlation Between rs2110385 Polymorphisms of the Visfatin Gene and Nonproliferative Diabetic Retinopathy

Objective: To investigate the association between rs2110385 polymorphisms of the visfatin gene and the risk of type 2 diabetic retinopathy (DR). Methods: 172 Han subjects were selected from Xi’an Shaanxi Province；140 patients with type 2 diabetes mellitus (T2DM) and 32 normal controls (NC) were selected from our hospital. Patients with diabetes were divided into a non-DR group (T2DM) (n = 69) and a nonproliferative diabetic retinopathy Group (DR) (n =71) after dilated fundus photography and fundus fluorescein angiography. rs2110385/Alu Ⅰ genotypes were detected by standardized polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), and the differences in the detection rates of different genotypes in the above populations were compared. Results: 1) The visfatin level in the DR Group was significantly higher than that in the NC and T2DM groups (P &lt; 0.05). 2) The frequency of GG genotype and G allele of rs2110385 in the DR Group were higher than those in the T2DM and NC groups (80.3, 69.6, 50.0, 86.6, 79, 65.6, P &lt; 0.05). 3) There were significant differences in allele frequency and genotype frequency distribution of rs2110385 between the DR Group and the NC group (P &lt; 0.01). Conclusion: Visfatin increased in the nonproliferative diabetic retinopathy group and could be a potential indicator for the clinical prediction of DR. The G allele of the rs2110385 polymorphic site may be related to the risk of DR.

Modeling of PCR-RFLP genotyping of cattle by polymorphic markers of iNOS gene

Relevance. The study of the Bos taurus iNOS gene polymorphism and its association with resistance to bovine leukemia, as well as with breeding value in terms of milk productivity, is a topical subject of genetic selection research.The purpose of this study was to identify and map polymorphic restriction sites in 4 SNP markers (AH13-1, AH13-2, AH13-3, AH13-4) of the Bos taurus iNOS gene, followed by PCR-RFLP profiling of the encountered genotypes and modeling of the method of gene testing of cattle by the listed polymorphic markers of the analyzed locus.Methods. An effective tool for visualizing the result of computer simulation of the experiment, which contributed to predicting the applicability of the developed method of gene testing, was in silico modeling of the generated PCR-RFLP profiles of the encountered genotypes of polymorphic markers of the Bos taurus iNOS gene. At the same time, the very result of mapping the identified polymorphic restriction sites and subsequent profiling of the encountered genotypes indicated the technical feasibility of detecting polymorphic positions of 4 SNP markers of the Bos taurus iNOS gene by PCR-RFLP analysis. This, in turn, initiated the modeling of the method of gene testing of cattle by the listed polymorphic markers with the provision of successive stages of DNA isolation from whole preserved blood of cattle, PCR with oligonucleotide primers iNOS-F and iNOS-R, RFLP with selected restriction endonucleases (HinfI, Sau96I (AspS9I isoschizomer), HpyAV and MluCI (Sse9I isoschizomer), as well as performing gel electrophoresis detection with visualization of the obtained electrophoregrams in a UV transilluminator.

Retroviral Insertion Polymorphism (RIP) of Porcine Endogenous Retroviruses (PERVs) in Pig Genomes.

Endogenous retroviruses (ERVs) are one of the superfamilies of long terminal repeat retrotransposons (LTRs) in mice and humans. Approximately 8% of the pig genome is composed of sequences derived from LTRs. While the majority of ERVs in pigs have decayed, a small number of full-length copies can still mobilize within the genome. This study investigated the unexplored retroviral insertion polymorphisms (RIPs) generated by the mobilization of full-length ERVs (Fl-ERVs), and evaluated their impact on phenotypic variation to gain insights into the biological role of Fl-ERVs in pigs. Overall, 39 RIPs (insertions or deletions relative to the pig reference genome) generated by Fl-ERVs were predicted by comparative genomic analysis, and 18 of them were confirmed by PCR detection. Four RIP sites (D5, D14, D15, and D18) were further evaluated by population analysis, and all of them displayed polymorphisms in multiple breeds. The RIP site of ERV-D14, which is a Fl-ERV inserted in the STAB2-like gene, was further confirmed by sequencing. Population analysis of the polymorphic site of ERV-D14 reveals that it presents moderate polymorphism information in the Large White pig breed, and the association analysis reveals that the RIP of ERV-D14 is associated with age variations at 30 kg body weight (p < 0.05) and 100 kg body weight (p < 0.01) in the population of Large White pigs (N = 480). Furthermore, the ERV-D14 RIP is associated with changes in the expression of the target gene STAB2-like in the liver, backfat, and leaf fat in Sushan pigs. These data suggest that some Fl-ERVs are still mobilizing in the pig's genome, and contribute to genomic and phenotypic variations.

Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling

Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity &gt;98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.

Genetic diversity and connectivity of Red Snapper Lutjanus gibbus in the Papua Waters, Indonesia

Abstract. Pranata B, Sala R, Kusuma AB, Toha AHA, Purbani DC, Mokodongan DF, Sipriyadi. 2024. Genetic diversity and connectivity of Red Snapper Lutjanus gibbus in the Papua Waters, Indonesia. Biodiversitas 25: 276-286. There is limited knowledge regarding the genetic connectivity and diversity of the Red Snapper (Lutjanus gibbus Forsskål, 1775) populations that inhabit Papua Waters, Indonesia. Thus, the current study attempted to ascertain the genetic characteristics, level of diversity and genetic connectivity of the L. gibbus population. We conducted genetic research on 38 L. gibbus specimens from five different places in Papua Waters. We analyzed the L. gibbus genetic characteristics, diversity and genetic connectivity using the Cytochrome C Oxidase subunit I (COI) gene as the genetic marker. There were 15 polymorphism sites in the COI gene sequence among L. gibbus individuals. Polymorphism occurs due to transversion and transition mutations. The COI gene fragment was translated, producing 188 amino acids composed of 19 different amino acids. A total of 13 distinct haplotypes were detected among the L. gibbus population residing in Papua Waters. The haplotype diversity (Hd=0.740) and nucleotide diversity (Pi=0.002) were relatively medium. The genetic structure study indicated that the 5 populations of L. gibbus in the Papua Waters had little genetic differentiation, as evidenced by a Fixation Index (Fst) of 0.018 (P-value 0.35386±0.01443). Based on this, the management of Red Snapper resources at these 5 locations must be carried out as a single unit.

Comparative analysis of genomic characteristics and immune response between Mycobacterium tuberculosis strains cultured continuously for 25 years and H37Rv.

Tuberculosis (TB) continues to pose a significant global health challenge, emphasizing the critical need for effective preventive measures. Although many studies have tried to develop new attenuated vaccines, there is no effective TB vaccine. In this study, we report a novel attenuated Mycobacterium tuberculosis (M. tb) strain, CHVAC-25, cultured continuously for 25 years in the laboratory. CHVAC-25 exhibited significantly reduced virulence compared to both the virulent H37Rv strain in C57BL/6J and severe combined immunodeficiency disease mice. The comparative genomic analysis identified 93 potential absent genomic segments and 65 single nucleotide polymorphic sites across 47 coding genes. Notably, the deletion mutation of ppsC (Rv2933) involved in phthiocerol dimycocerosate synthesis likely contributes to CHVAC-25 virulence attenuation. Furthermore, the comparative analysis of immune responses between H37Rv- and CHVAC-25-infected macrophages showed that CHVAC-25 triggered a robust upregulation of 173 genes, particularly cytokines crucial for combating M. tb infection. Additionally, the survival of CHVAC-25 was significantly reduced compared to H37Rv in macrophages. These findings reiterate the possibility of obtaining attenuated M. tb strains through prolonged laboratory cultivation, echoing the initial conception of H37Ra nearly a century ago. Additionally, the similarity of CHVAC-25 to genotypes associated with attenuated M. tb vaccine positions it as a promising candidate for TB vaccine development.

Mitochondrial DNA D-Loop Polymorphisms among the Galla Goats Reveals Multiple Maternal Origins with Implication on the Functional Diversity of the HSP70 Gene.

Despite much attention given to the history of goat evolution in Kenya, information on the origin, demographic history, dispersal route, and genetic diversity of Galla goats remains unclear. Here, we examined the genetic background, diversity, demographic history, and population genetic variation of Galla goats using mtDNA D-loop and HSP70 single-nucleotide polymorphism markers. The results revealed 90 segregating sites and 68 haplotypes in a 600-bp mtDNA D-loop sequence. The overall mean mitochondrial haplotype diversity was 0.993. The haplotype diversities ranged between 0.8939 ± 0.0777 and 1.0000 ± 0.0221 in all populations supporting high genetic diversity. Mitochondrial phylogenetic analysis revealed three Galla goat haplogroups (A, G, and D), supporting multiple maternal ancestries, of which haplogroup A was the most predominant. Analysis of molecular variance (AMOVA) showed considerable variation within populations at 94.39%, evidence of high genetic diversity. Bimodal mismatch distribution patterns were observed while most populations recorded negative results for Tajima and Fu's Fs neutrality tests supporting population expansion. Genetic variation among populations was also confirmed using HSP70 gene fragment sequences, where six polymorphic sites which defined 21 haplotypes were discovered. Analysis of molecular variance revealed a significant FST index value of 0.134 and a high FIS index value of 0.746, an indication of inbreeding. This information will pave the way for conservation strategies and informed breeding to improve Galla or other goat breeds for climate-smart agriculture.