Polymerase Chain Reaction Products Research Articles

Genetic Diversity within Scorpio Genus (Scorpion: Scorpionidae) from Iran: Preliminary Evidence based on 16srRNA Sequence

The yellow digger scorpion, Scorpio maurus, is a medically important scorpion for which little is known about its genetic diversity. Polymerase chain reaction products of 16srRNA gene fragments were generated from scorpion specimens named SmKh1 and SmKh2. These sequences showed high similarity with the only partial sequence of S. maurus isolate SCA1 large subunit ribosomal RNA gene available in the Genbank database. The drawing of the phylogeny tree showed two clusters, A and B. The two specimens (SmKh1 and SmKh2), which are placed in sub-cluster A2, were provided from Behbahan, Iran, and they have the closest relationship with the only sequence of S. maurus (MW281771), which is also collected from Behbahan. It is noteworthy that the two sequences obtained from S. maurus scorpions recorded from Miandoab (MK170444) and Mahabad (KU705354), which are in sub-cluster A1, are more similar to the scorpions isolated from the Mediterranean basin than those collected from Behbahan. This issue is probably due to the fact that patterns of genetic diversity are a reflection of variation in gene flow, which is also influenced by factors such as territorial barriers and geographical distances. We conclude that the scorpions of this study accompanied by similar scorpions in the Mediterranean basin, belong to the same species despite the insignificant differences.

Full-length circular RNA profiling by nanopore sequencing with CIRI-long.

Circular RNAs (circRNAs) have important roles in regulating developmental processes and disease progression. As most circRNA sequences are highly similar to their cognate linear transcripts, the current short-read sequencing-based methods rely on the back-spliced junction signal for distinguishing circular and linear reads, which does not allow circRNAs' full-length structure to be effectively reconstructed. Here we describe a long-read sequencing-based protocol, CIRI-long, for the detection of full-length circular RNAs. The CIRI-long protocol combines rolling circular reverse transcription and nanopore sequencing to capture full-length circRNA sequences. After poly(A) tailing, RNase R treatment, and size selection of polymerase chain reaction products, CIRI-long achieves an increased percentage (6%) of circular reads in the constructed library, which is 20-fold higher compared with previous Illumina-based strategies. This method can be applied in cell lines or tissue samples, enabling accurate detection of full-length circRNAs in the range of 100-3,000 bp. The entire protocol can be completed in 1 d, and can be scaled up for large-scale analysis using the nanopore barcoding kit and PromethION sequencing device. CIRI-long can serve as an effective and user-friendly protocol for characterizing full-length circRNAs, generating direct and convincing evidence for the existence of detected circRNAs. The analytical pipeline offers convenient functions for identification of full-length circRNA isoforms and integration of multiple datasets. The assembled full-length transcripts and their splicing patterns provide indispensable information to explore the biological function of circRNAs.

Development of a surface plasmon resonance (SPR) assay for rapid detection of Aeromonas hydrophila

Aquaculture plays an increasingly important if not critical role in the current and future world food supply. Aeromonas hydrophila, a heterotrophic, Gram-negative, bacterium found in fresh or brackish water in warm climates poses a serious threat to the aquaculture industry in many areas, causing significant economic losses. Rapid, portable detection methods of A. hydrophila are needed for its effective control and mitigation. We have developed a surface plasmon resonance (SPR) technique to detect PCR (polymerase chain reaction) products that can replace agarose gel electrophoresis, or otherwise provide an alternative to costlier and more complicated real-time, fluorescence-based detection. The SPR method provides sensitivity comparable to gel electrophoresis, while reducing labor, cross-contamination, and test time, and employs simpler instrumentation with lower cost than real-time PCR.

Isolation of Cystic Echinococcosis Causative Agents of Echinococcus equinus and Echinococcus ortleppi Species from Humans in the Central Anatolia Region of Türkiye

Cystic Echinococcosis (CE) caused by Echinococcus granulosus sensu strico is neglected in Türkiye despite being one of the common diseases due to agriculture being at the forefront, low socioeconomic status and unhygienic animal slaughter. Considering the morbidity, mortality, and difficulties in treatment, more studies and precautions are needed regarding this disease. In this study, it was aimed to genotype Echinococcus isolated from CE patients in the Central Anatolia region. DNA isolation from tissue samples taken from 60 CE patients was performed using the QIAamp DNA FFPE tissue kit. Cytochrome c oxidase subunit gene region of Echinococcus was targeted and JB3/JB4.5 primers were used for genotyping. Polymerase chain reaction (PCR) products were purified according to the instructions for use of the QIAquick PCR purification kit. PCR products were prepared using the ABI Prism BigDye Terminator V3.1 Cycle sequencing kit and the nucleotide sequences in the samples were evaluated with the ABI 3100 sequencing device. The nucleotide sequences obtained in the study were analyzed using MetaPIGA2, MRBAYES v.3.1.2, phyogenetic analysis using parsimony, Unigen programs, maximum likelihood, Bayesian and parsimony methods. It has been found that 88.4% (53/60) of Echinococcus isolates were E.granulosus s.s. in this study. It has been genotyped as 41.7% (25/60) G1, 30.0% (18/60) G3 and 16.7% (10/60) G2 genotype. It has been determined that 6.6% (4/60) of the other Echinococcus isolates were E.equinus and 5.5% (3/60) were E.ortleppi. It was observed that E.equinus and E.ortleppi were isolated from atypically located cysts and from those living in rural areas. The E.equinus and E.ortleppi species were not found in CE patients living in urban areas. CE cases are common in the Central Anatolia region due to dog and cattle breeding, and the disease agent Echinococcus species vary. Genotyping of Echinococcus species is effective in the development of CE treatment and control strategies. Study results can play an active role in the fight against CE, which has formed the basis of the "one health" approach in the world and in Türkiye in recent years.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

Molecular study and DNA sequence analysis of Theileria annulata in cattle in Al-Hilla, Iraq

The current work was conducted to unveil the current situation for the infection by Theileria annulata in cattle in Al-Hilla City, Iraq. A total of 225 blood samples (200 from suspected infected animals and 25 from clinically healthy animals as a control group) were collected. These samples were subjected to a direct slide-smearing for detection using a microscope and DNA sequencing, targeting the cytochrome b (Cyt b) gene of 10 polymerase chain reaction (PCR) products. The thin smear findings of the 200 suspected cases revealed that 63 (31.5%) were infected with Theileria spp., while 115 (57.5%) cases had no Theileria but other blood parasites; however, only 22 (11%) suspected cases showed no presence of any parasites. Unsurprisingly, the 25 blood samples from the control group demonstrated no presence of any blood parasite. Moreover, the DNA sequencing demonstrated that the Theileria spp. belonged to T. annulata species, and these sequences were nucleotide-based similar to Gene-Bank isolates from Tunisia (ON035604, ON035605, ON035606, ON035607, ON035608, ON035609, ON035610, ON035611, ON035612, and ON035613). The present study outcomes indicate that theileriosis is the dominant parasitic infection in cattle in Al-Hilla City and is highly caused by Theileria annulata.

Complete Genome Sequencing of an Embryonated Chicken Egg-Adapted Duck atadenovirus A.

Egg drop syndrome (EDS) is prevalent in industrial poultry globally. This disease is caused by Duck atadenovirus A or EDS virus (EDSV), a member of the genus Atadenovirus under the family Adenoviridae. The disease is attributed to significant economic losses in the poultry industry worldwide due to a drop in egg production, reduction in egg quality, and failure to reach maximum egg production. Oil-adjuvant inactivated vaccines, which are widely used in the poultry industry, provide good protection for immunized chickens against EDS. This study aimed to genetically and phylogenetically analyze the full-length genome of an embryonated chicken egg-adapted EDSV strain 127. After extraction of viral DNA from the allantoic fluid, overlapping fragments of the viral genome sequence were generated by polymerase chain reaction (PCR) using 25 pairs of primers. Purified PCR products were subjected to complete genome sequencing by the next-generation sequencing (NGS) approach. The nucleotide homology observed between genomes of the studied strain and that of the original strain 127 (NC_001813) of laying chickens was 99.9%. Its genome was 33,213 bp in length, with a G + C content of 43.01%. A comparison of the genome sequence of the egg-adapted virus with strain 127 revealed only three non-synonymous single-nucleotide polymorphisms (SNPs) between these viral genome sequences. Two mutations of S320G and I62K out of these SNPs were found within the coding regions of fiber and hypothetical proteins which may play a role in the adaptation of EDSV in the embryonated chicken eggs. The full genome sequencing of EDSV using NGS techniques provides insights into the discovery of genetic variants. Moreover, the genome sequence information of the EDSV provides valuable data for vaccine development in near future.

Development of a New Rapid Identification Method for <i>Bifidobacterium globosum</i> and <i>B. pseudolongum</i>Using Published Genome Data

Bifidobacterium globosum is expected to be applied to foods as a probiotic, and a method to rapidly distinguish it from the related Bifidobacterium pseudolongum is necessary for product development and quality control. In this study, we evaluated existing methods of bacterial species classification for B. globosum/pseudolongum with the published whole-genomes. The results showed that the Polymerase Chain Reaction (PCR) - Restriction Fragment Length Polymorphism (RFLP) method by the restriction enzyme HaeIII for hsp60 genes and the sequence analysis of hsp60 and rpoB gene sequences could not accurately distinguish B. globosum/pseudolongum, and both species could be accurately distinguished by the sequence analysis of clpC gene sequences. The clpC gene sequence similarity was at least 97.9% in the same species and no more than 95.4% in different species. Therefore, we developed a novel method of RFLP by restriction enzyme BspT104I on PCR products of clpC genes to identify B. globosum/pseudolongum. This method was considered to be faster and more accurate than previously proposed methods for identification of B. globosum/pseudolongum. Thus, the method presented in this study enables efficient species classification and it is very useful in utilization of B. globosum/pseudolongum for foods.

Application of polyphasic approach for identification of epiphytic fungi isolated from wheat grains

In this study, epiphytic fungi were isolated from wheat seeds (Triticum aestivum L) and a polyphasic approach for their identification was applied. The initial morphological characterisation was done on selected twenty-tree strains and continued with their identification based on the carbon utilisation pattern according to the Biolog OmniLog system protocol (Hayward, CA, USA). Throughout the isolated strains, the Biolog data indicated predominance of the genera Aspergillus, Penicillium and Fusarium. The carbon utilisation pattern of five strains assigned them to several different from aforementioned genera and due to their scarcity they were not included in the current study. The indicated by the Biolog genus designation of the strains was used as a guideline for the further molecular identification of seventeen strains from the predominant genera. Molecular identification was based on a polymerase chain reaction (PCR) with universal primers, which targeted the internal transcribed spacer (ITS) region of rDNA gene. The PCR fragments were sequenced and after applying a BLAST algorithm, a high percentage of similarity was found for eleven strains. At the species level, the Biolog and molecular technique showed a discrepancy in the identification of two strains. The procedure of identification was unsuccessful for six strains either due to insufficient quantity of the PCR product or the lack of sufficient similarity of the fragments to the GenBank database. Current study showed that the unbiased identification of epiphytic fungi requires a polyphasic approach, which applies morphological, physiological and molecular techniques.

Prevalence and molecular analysis of Cryptosporidium spp. collected from surface water.

Cryptosporidium is an obligate intracellular parasite reported from all over the world. This protozoan infects a wide range of animals as well as humans. Cryptosporidium parvum and Cryptosporidium hominis are the most prevalent infecting species with mild and self-limiting infection in healthy people. The protozoan oocyst is resistant to common water purifiers. Based on emerging evidence, Cryptosporidium is one of waterborne parasites considered a major public health problem in developing and developed countries. In this study, 42 samples were collected from 14 rivers in the catchment area of Lake Urmia in northwest of Iran. Moreover, amplification of SSU rRNA gene was performed, and polymerase chain reaction products were sequenced. The results of sequencing and comparing the sequences with those in the GenBank revealed that all the 17 positive samples were C. parvum, a zoonotic species and one of the most frequent human-infecting species. Considering these data, it is highly important to inhibit the spread of this protozoan by treating livestock and preventing human and animal effluents from entering the water.

Genetic diversity and relationship among Indonesian local sheep breeds on Java Island based on mitochondrial cytochrome b gene sequences

BackgroundThe cytochrome b (Cyt b) gene is one of the most studied mitochondrial DNA (mtDNA) genes to determine sheep’s genetic profile. This study aimed to determine the genetic diversity and relationships of several Indonesian local sheep populations on Java Island, Indonesia, based on the mtDNA Cyt b gene sequences. Blood samples were collected from forty-one individual sheep in seven populations of Indonesia local sheep breeds on Java Island (Priangan = 6, Garut = 6, Batur = 7, Wonosobo = 5, Javanese Thin-Tailed/JTT = 7, Javanese Fat-Tailed/JFT = 5, and Sapudi = 5). DNA extraction was performed on blood samples, and the mtDNA Cyt b gene was amplified using specific primers (Alek-CBF: 5’-CAACCCCACCACTTACAA-3’ and Alek-CBR: 5’-CCTTGAGTCTTAGGGAGGTT-3’). The polymerase chain reaction (PCR) products were then sequenced, and data were analyzed using the MEGA version 7.0, DNA SP version 6.0, and NTSYS-pc version 2.11 software. ResultsA total of 1140 bp complete mtDNA Cyt b gene sequences in this study obtained 1134 monomorphic sites (I), six polymorphic sites (V), one segregation site (S), and five parsimony informative sites (P) with a nucleotide diversity (Pi), the average number of nucleotide differences (K), and sequence conservation (SC) were 0.00119, 1.35610, and 0.9947, respectively. There were six haplotypes consisting of two unique haplotypes and four shared haplotypes with a haplotype diversity (Hd) of 0.5415. The genetic distance within and between populations ranged from 0.0000 to 0.0016 and 0.0000 to 0.0020, respectively. Wonosobo, JFT, and Sapudi sheep have the closest relationship, and then these three breeds were close to JTT sheep, followed by Batur, Priangan, and Garut sheep. Two haplogroups have been found based on the Ovine haplogroup clustering. All Wonosobo, JTT, JFT, Sapudi sheep, and most Batur sheep were clustered into haplogroup B. In contrast, Garut sheep were mostly clustered into haplogroup A, while Priangan sheep were clustered into both haplogroups with the same percentage. ConclusionSeven Indonesian local sheep breeds on Java Island have a close relationship clustered into two haplogroups, namely haplogroups A and B. Most Indonesian local sheep breeds on Java Island in this study were clustered into haplogroup B, except for Garut and Priangan sheep.

Development of a new multiplex PCR to detect fecal coccidian parasite.

Cryptosporidium spp., Cystoisospora belli and Cyclospora cayetanensis are common intestinal coccidian parasites causing gastroenteritis. The clinical presentation caused by each parasite is indistinguishable from eachother. Uniplex polymerase chain reaction (PCR) for these three groups of intestinal coccidian parasites was developed by us in our laboratory. Thereafter, we planned to develop a single-run multiplex polymerase chain reaction (mPCR) assay to detect Cryptosporidium spp., C. belli and C. cayetanensis simultaneously from a stool sample and described it here as coccidian mPCR. New primers for C. belli and C. cayetanensis were designed and uniplex PCRs were standardized. The coccidian mPCR was standardized with known positive DNA control isolates. It was validated with 58 known positive and 58 known negative stool samples, which were previously identified by uniplex PCR. The coccidian mPCR was standardized with earlier primers designed by us for Cryptosporidium spp. and C. cayetanensis, and a newly designed primer for the internal transcribed spacer-1 (ITS-1) gene for C. belli. The coccidian mPCR was 92.1% sensitive for Cryptosporidium spp., and 100% sensitive for C. belli and C. cayetanensis each, when tested on 116 known samples. It was 100% specific for all intestinal coccidian parasites. Two representative PCR products of the newly designed ITS-1 primer for C. belli were sequenced and submitted to the GenBank, which best match with the sequences of C. belli. A highly sensitive, specific, cost-effective, indigenous, single-run coccidian mPCR has been developed, which can simultaneously detect Cryptosporidium spp., C. belli and C. cayetanensis.

Follicle-stimulating hormone receptor gene exploration as possible markers for prolific trait of local goat in Indonesia

The objective of this study was to discover and identify the effect of SNP of follicle-stimulating hormone receptor (FSHR) gen on prolific traits in Kejobong (KJ) and Etawah grade (EG) doe. A total of 15 blood samples were taken from 11 KJ and 4 EG with various parity and type of birth. The FSHR gene was amplified from the DNA template by Polymerase Chain Reaction (PCR); the PCR products were then sequenced to determine Single Nucleotide Polymorphisms (SNP). Results showed that 3 SNPs were identified, and those SNPs altered amino acid sequence formed 6 haplotypes and divided the doe based on the type of birth. In conclusion, SNPs identified in this study are associated with a prolific trait that can be used as a genetic marker and haplotype 3, 4, and 5 showed the highest prolific on KJ and EG doe.

Correlation of rs35753505 polymorphism in Neuregulin 1 gene with psychopathology and intelligence of people with schizophrenia

Background and aimSchizophrenia is one of the most severe psychiatric disorders. About 0.5 to 1% of the world's population suffers from this non-Mendelian disorder. Environmental and genetic factors seem to be involved in this disorder. In this article, we investigate the alleles and genotypic correlation of mononucleotide rs35753505 polymorphism of Neuregulin 1 (NRG1), one of the selected genes of schizophrenia, with psychopathology and intelligence. Materials and methods102 independent and 98 healthy patients participated in this study. DNA was extracted by the salting out method and the polymorphism (rs35753505) were amplified by polymerase chain reaction (PCR). Sanger sequencing was performed on PCR products. Allele frequency analysis was performed using COCAPHASE software, and genotype analysis was performed using Clump22 software. ResultsAccording to our study's statistical findings, all case samples from the three categories of men, women, and overall participants significantly differed from the control group in terms of the prevalence of allele C and the CC risk genotype. The rs35753505 polymorphism significantly raised Positive and Negative Syndrome Scale (PANSS) test results, according to a correlation analysis between the two variables. However, this polymorphism led to a significant decrease in overall intelligence in case samples compared to control samples. ConclusionIn this study, it seems that the rs35753505 polymorphism of NRG1 gene has a significant role in the sample of patients with schizophrenia in Iran and also in psychopathology and intelligence disorders.

Liver Fluke Species Identification Isolated From Humans and Animals Using PCR-RFLP and DNA Sequencing

Fasciola species are a member of flatworms belonging to the trematodes (flukes), commonly known as liver fluke, they are extremely pathogenic parasites that affect the liver of humans and animals, nowadays, most laboratories and research facilities use molecular-based techniques for identifying and describing Fasciola species. The molecular diagnostic markers such as polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), and PCR-RFLP methods are accurate and more specific than the immunological and microscopical methods. The identification of the species of liver flukes will give a new clue for the treatment and control of fascioliasis. The aim, of this study, is to find the molecular characterization of Fasciola spp. isolated from humans and animals in Sulaimani city. The flukes were isolated from humans using endoscopic techniques and from slaughtered livestock at the new slaughterhouse of Sulaimani, 48 liver flukes were collected from different hosts; human (n = 3), cattle (n = 20), sheep (n = 20), and goats (n = 5) from October 2021 to April 2022. The uinversal primers ribosomal Deoxy Ribo Nuclic Acid (rDNA) were used, then the PCR products were subjected to restriction fragment polymorphism (RFLP) assay and The PCR Product was digested with restriction enzymes DraII, also the DNA sequencing was used for the PCR product of the primer Cytochrome Oxidase subuint 1 (COX1). The results of the PCR-RFLP of the 28s rDNA show the genetic polymorphisms among the flukes and two patterns of RFLP were observed F. hepatica, and F. gigantica, also the sequence analysis of the partial gene of the COX1 showed the isolated flukes belonged to F. hepatica and F. gigantica with some genetic variation, and the result of the sequences was deposited in the Gene Bank under the following Accession numbers; F. gigantica (OP718780 and OP718781) and F. hepatica (OP718782, OP718783, and OP718784). The present study concludes thatF. hepatica and F. gigantica are both responsible for human and animal Fasciolasis in Kurdistan-Iraq, Therefore, RFLP techniques and DNA sequencing are a reliable, and differential method for species and genotyping identification of liver fluke.

Vitamin D Receptor Polymorphisms Among the Turkish Population are Associated with Multiple Sclerosis.

Multiple sclerosis (MS) is an inflammatory disease characterized by demyelination and axonal degeneration affecting the central nervous system. Among the genetic factors suggested to be associated with this disease are polymorphisms to the vitamin D receptor (VDR) gene. We tested the hypothesis that polymorphisms in the vitamin D receptor (VDR) gene are associated with MS. The aim of the study was to investigate the relationship of MS with the VDR gene Fok-I, Bsm-I and Taq-I polymorphisms among the Turkish population. This study contains 271 MS patients and 203 healthy controls. Genomic DNA was isolated from the samples and the VDR gene Fok-I, Bsm-I and Taq-I polymorphism regions were amplified by polymerase chain reaction (PCR). The PCR products were digested, and the genotypes were determined based on size of digested PCR products. Our results demonstrate associations between MS and the distribution of the VDR gene Fok-I T/T polymorphism genotype in a dominant model, VDR gene Fok-I T allele frequency, distribution of VDR gene Taq-I C/C polymorphism genotype in a dominant model and VDR gene Taq-I C allele frequency (Pearson test, p<0.05). However, there was no association between MS and the VDR gene Bsm-I polymorphisms for the genotype distribution (Pearson test, p>0.05) or allele frequency (Pearson test, p>0.05). Fok-I and Taq-I VDR gene polymorphisms are significantly associated with MS in dominant, homozygote and heterozygote inheritance models among the Turkish population.

Frequency and molecular basis of CD36 deficiency among platelet donors in Kunming, China

CD36 is a multifunctional receptor expressed on the surface of many cell types. Among healthy individuals, CD36 may be absent on platelets and monocytes (type I deficiency) or platelets alone (type II deficiency). However, the exact molecular mechanisms underlying CD36 deficiency remain unclear. In this study, we aimed to identify individuals with CD36 deficiency and investigate the molecular basis underlying it. Blood samples were collected from platelet donors at Kunming Blood Center. Platelets and monocytes were isolated and CD36-expression levels were analyzed using flow cytometry. DNA from whole blood and mRNA isolated from monocytes and platelets of individuals with CD36 deficiency were analyzed using polymerase chain reaction (PCR) testing. The PCR products were cloned and sequenced. Among the 418 blood donors,7 (1.68%) were CD36 deficient: 1 (0.24%) with type I deficiency and 6(1.44%) with type II deficiency. Six heterozygous mutations occurred, including c.268C>T (in type I individuals), c.120 + 1 G>T, c.268C>T, c.329_330del/AC, c.1156 C>T, c.1163A>C, and c.1228_1239del/ATTGTGCCTATT (in type II individuals). Mutations were not detected in one type II individual . At the cDNA level, only mutant, but not wild-type, transcripts were detected in the platelets and monocytes of type I individual. In type II individuals, only mutant transcripts were found in platelets, whereas monocytes possessed wild-type and mutant transcripts. Interestingly, only alternative splicing transcripts were observed in the individual without mutation. We report the incidence rates of type I and II CD36 deficiencies among platelet donors in Kunming. Molecular genetic analyses of DNA and cDNA demonstrated that homozygous mutations on the cDNA level in platelets and monocytes or platelets alone identified type I and II deficiencies, respectively. Furthermore, alternatively spliced products also potentially contribute to the mechanism of CD36 deficiency.

Association of MT-ATP6 gene mutations with the pathogenesis of chronic kidney disease in human

BackgroundChronic kidney disease (CKD) is one of the major global health problems. CKD patients are at increased risk of cardiovascular diseases, anemia, mineral, and bone disorders, decreased quality of life, and early death. Involvement of mitochondria is increasingly recognized in genetic and acquired CKD. Mitochondrial dysfunctions are caused by many pathogenic mutations localized in the mitochondrial gene (MT-ATP6) that encodes the subunit ‘a’ of ATP synthase. ObjectivesThe aim of this study was to identify the MT-ATP6 gene mutations in patients with CKD and assess the relationship between MT-ATP6 gene mutation with CKD. Materials and methodsIn this study, blood samples of 18 CKD patients and 21 healthy controls were analyzed. Genomic DNA was extracted from the collected blood samples; the MT-ATP6 region was amplified by polymerase chain reaction (PCR); PCR products was purified; and direct sequencing was performed. In addition, sequencing data was further analyzed with various in silico tools. ResultsIn this study it was found that the serum creatinine concentration of CKD patients was approximately 7.5 folds higher than that of healthy controls. According to the criteria based on the estimated glomerular filtration rate (eGFR), it was determined that 78% of the patients were in stage-5 (eGFR <15 mL/min/1.73 m2) and the rest of the patients were in stage-4 (eGFR between 15 and 29 mL/min/1.73 m2) of CKD. Analyzing MT-ATP6 gene sequences of CKD patients, eight novel mutations (m.8732C>G, m.8800_8801insG, m.8804C>G, m.8947C>G, m.8983C>G, m.8999T>G, m.9059C>G, and m.9129C>G) along with 11 reported mutations were identified. In the case of CKD patients, 14 nonsynonymous mutations in the MT-ATP6 gene were detected and 8 of them were damaging and disease-causing based on in silico analyses with five different tools. On the other hand, only 3 nonsynonymous mutations were identified in healthy individuals, which were all neutral and tolerating mutations according to in silico analyses. In this study, a significant correlation between non-synonymous MT-ATP6 gene mutations and occurrence of CKD (p-value <0.0001) was also observed. ConclusionsThe results revealed that there is a link between MT-ATP6 gene mutation and the development of CKD. It can be concluded that mutations in the MT-ATP6 gene may have a role in CKD development.

The Surveillance of Borrelia Species in Camelus dromedarius and Associated Ticks: The First Detection of Borrelia miyamotoi in Egypt

A total of 133 blood samples and 1596 adult hard ticks were collected from Camelus dromedaries at Cairo and Giza slaughterhouses in Egypt. Tick species were identified by examining their morphology and sequencing the cytochrome C oxidase subunit 1 (cox1) gene. Borrelia spp. was detected using nested PCR on the IGS (16S-23S) gene, and positive samples were genotyped using 16S rRNA and glpQ spp. genes specific for Borrelia burgdorferi and Borrelia miyamotoi, respectively. The positive PCR products were sequenced and analyzed by phylogenetic tree. Analysis of the cox1 gene sequence revealed that the adult ticks belonged to three genera; Hyalomma (H), Amblyomma (Am), and Rhipicephalus (R), as well as 12 species, including H. dromedarii, H. marginatum, H. excavatum, H. anatolicum, R. annulatus, R. pulchellus, Am. testudinarium, Am. hebraeum, Am. lipidium, Am. variegatum, Am. cohaerens and Am. gemma. Borrelia spp. was found in 8.3% (11/133) of the camel blood samples and 1.3% (21/1596) of the ticks, respectively. Sequencing of the IGS (16S-23S) gene found that B. afzelii, detected from H. dromedarii and H. marginatum, and B. crocidurae, which belongs to the RF group, was detected from one blood sample. B. burgdorferi and B. miyamotoi were discovered in the blood samples and tick species. Phylogenetic analysis of the glpQ gene showed that the B. miyamotoi in this study was of the Asian and European types. These results suggest that the camels can be infected by Lyme borrelia and other Borrelia bacteria species. This study also provides the first insight into the presence of Borrelia miyamotoi and B. afzelii DNA in camels and associated ticks in Egypt.

Genetic screening of Filipinos suspected with familial Parkinson's disease: A pilot study

IntroductionAlthough genetic factors are known to play a role in the pathogenesis of Parkinson's disease (PD), true prevalence of familial PD is unknown. We conducted this pilot study to identify genes implicated in familial Parkinson's disease among Filipinos. MethodsEighteen Filipino patients belonging to 11 families with personal and family history of PD underwent thorough evaluation by movement disorders specialists. Samples were analyzed in Juntendo University, Tokyo, Japan. Sanger sequencing of polymerase chain reaction products was performed. Each sample was screened for 23 genes (SNCA, PARK 2, UCHL1, PINK 1, DJ-1, LRRK2, ATP13A2, GIGYF2, HTRA2, PLA266, FBX07, VPS35, EIF461, DNAJC13, CHCHD2, GCH1, MAPT, NR4A2, VPS13c, PSEN1, and GRN). ResultsOut of 18 patients, six harbored Parkinson-related gene mutations. Five individuals from three families were positive for PINK1 c.10140T > C(p.L347P) mutation while one had heterozygous variant PRKN c.136G>T(p.A465) gene mutation. Three families displayed autosomal recessive pattern while one family with PINK1 mutation showed autosomal dominant mode of inheritance. Bradykinesia and tremor were predominant symptoms. Mean age at onset of symptoms was 40.4 years among those with PINK1 mutations. ConclusionIn this study, we presented the clinical profiles and identified two genetic mutations among a small group of Filipino patients with familial PD. They were congruent with most studies showing these mutations as the most common causes of autosomal recessive early-onset PD. Preliminary data from this pilot study will guide planning for larger scale studies, such as collaborative projects including The Global Parkinson's Genetics Program (GP2).