Polymerase Chain Reaction Instrument Research Articles

Development of amplification system for point-of-care test of nucleic acid

Nucleic acid testing (NAT) has been widely used in many fields such as medical diagnosis, food safety testing and forensic identification. However, it can only be carried out in professional laboratory because the test process is complicated and rigorous. In this paper, a nucleic acid amplification system based on polymerase chain reaction (PCR) was developed to meet the requirements of point-of-care testing (POCT) for nucleic acids. Firstly, the mechanical structure and electronic control system were designed and constructed. Secondly, an integral separation PID algorithm for temperature control and an intelligent temperature compensation method based on support vector regression (SVR) were proposed. Finally, temperature measurement and biological experiments were performed to prove the stability and availability of the nucleic acid amplification system. The results showed that the system achieved a rapid temperature change velocity of 4.5 °C/s, and the steady-state error was within ± 0.5 °C. The nucleic acids in samples of different concentrations were well amplified, the system can be used for quantitative detection of nucleic acid with the help of a fluorescence detection system, and has higher sensitivity than Tianlong PCR instrument.

Dried Blood Spot Screening System for Spinal Muscular Atrophy with Allele-Specific Polymerase Chain Reaction and Melting Peak Analysis

Background and Aim: Spinal muscular atrophy (SMA) is a lower motor neuron disease with autosomal recessive inheritance caused by homozygous SMN1 deletions. Although SMA has been considered as incurable, newly developed drugs improve life prognoses and motor functions of patients. To maximize the efficacy of the drugs, SMA patients should be treated before symptoms become apparent. Thus, newborn screening for SMA is strongly recommended. In this study, we aim to establish a new simple screening system based on DNA melting peak analysis. Materials and Methods: A total of 124 dried blood spot (DBS) on FTA® ELUTE cards (51 SMN1-deleted patients with SMA, 20 carriers, and 53 controls) were punched and subjected to direct amplification of SMN1 and CFTR (reference gene). Melting peak analyses were performed to detect SMN1 deletions from DBS samples. Results: A combination of allele-specific polymerase chain reaction (PCR) and melting peak analyses clearly distinguished the DBS samples with and without SMN1. Compared with the results of fresh blood samples, our new system yielded 100% sensitivity and specificity. The advantages of our system include (1) biosafe collection, transfer, and storage for DBS samples, (2) obviating the need for DNA extraction from DBS preventing contamination, (3) preclusion of fluorescent probes leading to low PCR cost, and (4) fast and high-throughput screening for SMN1 deletions. Conclusion: We demonstrate that our system would be applicable to a real-world newborn screening program for SMA, because our new technology is efficient for use in routine clinical laboratories that do not have highly advanced PCR instruments.

Application of comparative genomics in the development of DNA probes to detect Bacillus cereus and Bacillus subtilis

Primer-probe sets to detect Bacillus cereus and/or B. subtilis in food products were developed based on panX (a pan-genome analysis tool). Data for 60 B. cereus strains and 131 B. subtilis strains retrieved from the NCBI RefSeq database were analyzed by panX. Primer-probe sets for B. cereus (ccpA) and B. subtilis (cotQ) were developed by comparing the core genomes of the two bacteria. The developed primer-probe sets’ sensitivity and selectivity were identified using 45 strains, including ten B. cereus, five B. subtilis, 13 non-B. cereus and non-B. subtilis strains, and 17 non-Bacillus strains using real-time polymerase chain reaction (PCR). The developed primer-probe sets displayed high sensitivity and selectivity for B. cereus and B. subtilis, validated with two different real-time PCR instruments. PCR analysis using the developed primer-probe showed high efficiency in buffer and milk samples. These results indicate that the primer-probe sets developed based on the panX analysis can be used effectively for detecting B. cereus and/or B. subtilis in food products.

Determining the feasibility of constructing a real-time polymerase chain reaction instrument locally: The cost of intellectual property rights and research and development

BACKGROUND: Real-time polymerase chain reaction (PCR) machines have advanced the field of microbiology by introducing a robust method for high-throughput detection of nucleic acid targets. Unfortunately, these instruments are quite expensive to purchase and maintain, despite containing hardware parts that are relatively inexpensive. AIMS AND OBJECTIVES: We believe that it may be possible to mitigate costs in low- and middleincome countries (LMICs) by building such a PCR instrument from assembled parts. However, the major hindrance is the cost of intellectual property rights (IPRs), associated with research and development (R and D). The aim of this project was to understand the hardware costs, IPR royalties, profit margins, and the cost of R and D associated with PCR instrument manufacturing. MATERIALS AND METHODS: We conducted a review of two PCR machines to examine the differences in their technical and hardware specifications and quantify the cost of assembled parts alone. We also ran a parallel assay using the two machines to understand how the differences in technologies affected assay results. RESULTS AND CONCLUSION: Based on our analysis, we found that assembling a PCR machine using assembled parts can make these instruments more affordable in LMICs. There is a need to have collaboration and agreement between machine licensing, patent, and copyright holders to facilitate this process in LMICs.

Multiplex Real-Time Reverse-Transcription Polymerase Chain Reaction Assays for Diagnostic Testing of Severe Acute Respiratory Syndrome Coronavirus 2 and Seasonal Influenza Viruses: A Challenge of the Phase 3 Pandemic Setting.

BackgroundPandemic coronavirus disease 2019 (COVID-19) disease represents a challenge for healthcare structures. The molecular confirmation of samples from infected individuals is crucial and therefore guides public health decision making. Clusters and possibly increased diffuse transmission could occur in the context of the next influenza season. For this reason, a diagnostic test able to discriminate severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) from influenza viruses is urgently needed.MethodsA multiplex real-time reverse-transcription polymerase chain reaction (PCR) assay was assessed using 1 laboratory protocol with different real-time PCR instruments. Overall, 1000 clinical samples (600 from samples SARS-CoV-2–infected patients, 200 samples from influenza-infected patients, and 200 negative samples) were analyzed.ResultsThe assay developed was able to detect and discriminate each virus target and to intercept coinfections. The limit of quantification of each assay ranged between 5 and 10 genomic copy numbers, with a cutoff value of 37.7 and 37.8 for influenza and SARS-CoV-2 viruses, respectively. Only 2 influenza coinfections were detected in COVID-19 samples.ConclusionsThis study suggests that multiplex assay is a rapid, valid, and accurate method for the detection of SARS-CoV-2 and influenza viruses in clinical samples. The test may be an important diagnostic tool for both diagnostic and surveillance purposes during the seasonal influenza activity period.

Battery-Powered Portable Rotary Real-Time Fluorescent qPCR with Low Energy Consumption, Low Cost, and High Throughput.

The traditional qPCR instrument is bulky, expensive, and inconvenient to carry, so we report a portable rotary real-time fluorescent PCR (polymerase chain reaction) that completes the PCR amplification of DNA in the field, and the reaction can be observed in real-time. Through the analysis of a target gene, namely pGEM-3Zf (+), the gradient amplification and melting curves are compared to commercial devices. The results confirm the stability of our device. This is the first use of a mechanical rotary structure to achieve gradient amplification curves and melting curves comparable to commercial instruments. The average power consumption of our system is about 7.6 W, which is the lowest energy consumption for real-time fluorescence quantification in shunting PCR and enables the use of our device in the field thanks to its self-contained power supply based on a lithium battery. In addition, all of the equipment costs only about 710 dollars, which is far lower than the cost of a commercial PCR instrument because the control system through mechanical displacement replaces the traditional TEC (thermoelectric cooler) temperature control. Moreover, the equipment has a low technical barrier, which can suit the needs of non-professional settings, with strong repeatability.

Microfluidic Array Chip for Parallel Detection of Waterborne Bacteria.

The polymerase chain reaction (PCR) is a robust technique used to make multiple copies of a segment of DNA. However, the available PCR platforms require elaborate and time-consuming operations or costly instruments, hindering their application. Herein, we introduce a sandwiched glass–polydimethylsiloxane (PDMS)–glass microchip containing an array of reactors for the real-time PCR-based detection of multiple waterborne bacteria. The PCR solution was loaded into the array of reactors in a single step utilising capillary filling, eliminating the need for pumps, valves, and liquid handling instruments. Issues of generating and trapping bubbles during the loading chip step were addressed by creating smooth internal reactor surfaces. Triton X-100 was used to enhance PCR compatibility in the chip by minimising the nonspecific adsorption of enzymes. A custom-made real-time PCR instrument was also fabricated to provide thermal cycling to the array chip. The microfluidic device was successfully demonstrated for microbial faecal source tracking (MST) in water.

Polymerization retardation isothermal amplification (PRIA): a strategy enables sensitively quantify genome-wide 5-methylcytosine oxides rapidly on handy instruments with nanoscale sample input.

The current methods for quantifying genome-wide 5-methylcytosine (5mC) oxides are still scarce, mostly restricted with two limitations: assay sensitivity is seriously compromised with cost, assay time and sample input; epigenetic information is irreproducible during polymerase chain reaction (PCR) amplification without bisulfite pretreatment. Here, we propose a novel Polymerization Retardation Isothermal Amplification (PRIA) strategy to directly amplify the minute differences between epigenetic bases and others by arranging DNA polymerase to repetitively pass large electron-withdrawing groups tagged 5mC-oxides. We demonstrate that low abundant 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxycytosine (5caC) in genomic DNA can be accurately quantified within 10 h with 100 ng sample input on a laboratory real-time quantitative PCR instrument, and even multiple samples can be analyzed simultaneously in microplates. The global levels of 5hmC and 5fC in mouse and human brain tissues, rat hippocampal neuronal tissue, mouse kidney tissue and mouse embryonic stem cells were quantified and the observations not only confirm the widespread presence of 5hmC and 5fC but also indicate their significant variation in different tissues and cells. The strategy is easily performed in almost all research and medical laboratories, and would provide the potential capability to other candidate modifications in nucleotides.

Copy number alternations of the 17q23-rs6504950 locus are associated with advanced breast cancers in Taiwanese women.

Objective:Breast cancer is one of the most common malignancies and a leading cause of cancer-related death in women worldwide. Both hormone-related factors and genetic aberrations could cause breast cancer. We investigated copy number alternations (CNAs) on four breast cancer-susceptible loci, namely 2q35-rs13387042, 3p24-rs4973768, 17q23-rs6504950, and fibroblast growth factor receptor 2 (FGFR2)-rs2981578, in Taiwanese women.Patients and Methods:Breast cancer tissues and blood samples from 66 patients and their clinical data were collected from a human biobank. The copy numbers of the germline samples (from blood) and cancer tissues from each patient on the susceptible loci – 2q35, 3p24, 17q23, and FGFR2 – were obtained using TaqMan probes in the Applied Biosystems Inc., (ABI) StepOnePlus Real-Time Polymerase Chain Reaction instrument and CopyCaller® Software v1.0 (ABI, CA, USA).Results:The mean copy numbers output by CopyCaller® Software v1.0 of the cancer tissues on these susceptible loci (2q35, 3p24, 17q23, and FGFR2) from the 66 patients were higher than those of the blood samples (2.0 vs. 1.9); however, significantly higher copy numbers for cancer tissues compared with germline samples were discovered only on 2q35-rs13387042 (P = 0.035). In addition, patients with advanced breast cancers had relatively many CNAs between their cancer tissues and germline samples on 17q23-rs6504950 (P = 0.008). Multivariate analysis revealed that the risk factor for patients with advanced breast cancers was CNAs between cancer tissues and germline samples on 17q23-rs6504950 (odds ratio = 13.337, 95% confidence interval: 1.525–122.468).Conclusions:CNAs on 17q23-rs6504950 between cancer tissues and germline samples could affect cancer progression in Taiwanese women with breast cancer. Further investigations regarding the role of CNAs on 17q23-rs6504950 in cancer progression are necessary to elucidate the pathogenesis of breast cancer.

Small-Size Polymerase Chain Reaction Device with Improved Heat Transfer and Combined Feedforward/Feedback Control Strategy

We report improvements on the heat transfer and on the control strategy of a thermal cycler implemented on a novel device for performing a fast polymerase chain reaction (PCR). The reduction of the thermal mass of the sample holder and the direct contact with the sample allow for a significant reduction of the transition times, while the hybrid feedforward/feedback controller can rely on inexpensive components (actuators, sensors, processor) and still achieve minimal over/undershooting and good temperature stability. The design of the device has been improved by performing transient heat conduction analysis on the highly heat-conductive sample holder and on the solid metal body of the device which rapidly dissipates the excess heat produced during the thermal cycling. In the current setup, the sample holder hosts nine 1 μL samples covered with mineral oil, which can be simultaneously read in real time by the detection module designed in-house and installed on the device. An increase in speed of the PCR amplification was achieved with a reduction of the transition time of 63.8% when compared against a commercial real-time PCR machine. Our work shows that a complete, stand-alone, and ready-to-use quantitative PCR instrument can be fabricated from inexpensive and easily available components and it can achieve fast thermal cycling thanks to a hybrid control strategy.

Implementation and evaluation of the Presto combined qualitative real-time assay for Chlamydia trachomatis and Neisseria gonorrhoeae in Rwanda.

BackgroundThe Presto combined qualitative real-time assay for Chlamydia trachomatis and Neisseria gonorrhoeae (Presto CT/NG PCR assay) is appealing for developing countries, because it can be used with multiple DNA extraction methods and polymerase chain reaction (PCR) platforms.ObjectivesThe objective of the study was to implement and evaluate the Presto CT/NG PCR assay at the National Reference Laboratory (NRL) in Kigali, Rwanda, where no real-time PCR assays for the detection of C. trachomatis or N. gonorrhoeae were available.MethodsThe Presto CT/NG PCR assay was first evaluated at the Institute of Tropical Medicine (ITM) in Antwerp, Belgium. Next, NRL laboratory technicians were trained to use the assay on their ABI PRISM 7500 real-time PCR instrument and their competencies were assessed prior to trial initiation. During the trial, endocervical swabs were tested at the NRL, with bi-monthly external quality control testing monitored by the ITM. The final NRL results were evaluated against extended gold standard testing at the ITM, consisting of the Abbott m2000 RealTime System with confirmation of positive results by an in-house real-time PCR assay for C. trachomatis or N. gonorrhoeae.ResultsOf the 192 samples analysed using the Presto assay at the NRL, 16 samples tested positive for C. trachomatis and 17 tested positive for N. gonorrhoeae; four of these were infected with both. The sensitivity and specificity of the Presto assay were 93.3% (95% confidence interval [CI]: 68.1% – 99.8%) and 99.4% (95% CI: 96.8% – 100%) for C. trachomatis and 100% (95% CI: 76.8% – 100%) and 98.8% (95% CI: 95.8% – 99.9%) for N. gonorrhoeae.ConclusionC. trachomatis and N. gonorrhoeae testing with the Presto assay was feasible in Kigali, Rwanda, and good performance was achieved.KeywordsqPCR; Chlamydia trachomatis; Neisseria gonorrhoeae.

Determination of dopamine receptor D2 gene rs1800497 polymorphism using real-time polymerase chain reaction

Introduction. After analyzing a specific nucleotide sequence, located near the dopamine receptor D2 gene, rs1800497 polymorphism was detected, that affects dopamine D2 receptor expression, its density and affinity. This polymorphism is associated with many disorders such as: aggressive behavior, response to stress, sensation seeking, impulsivity, extraversion, anger, random memory, impaired cognitive function, brain glucose metabolism, obesity, pathologic gambling, substance addiction, depression, schizophrenia, that are related to modified gene expression, receptor density and affinity. Due to this association, a considerable interest in detecting a reliable dopamine receptor D2 gene allele was developed. The aim of this paper is optimization of real-time polymerase chain reaction in genotyping dopamine receptor D2 gene rs1800497 polymorphism. Material and Methods. Deoxyribonucleic acid was extracted from the blood of ten healthy individuals. Deoxyribonucleic acid samples were genotyped for dopamine receptor D2 gene rs1800497 (context sequence part containing targeted single nucleotide polymorphism CACAGCCATCCTCAAAGTGCTGGTC[A/G]AG?GCAGGCGCCCAGCTGGACGTCCA) by polymerase chain reaction. The TaqMan assays were used to determine single-nucleotide polymorphisms. The products of amplification were analyzed using Applied Biosystems 7500 fast real-time polymerase chain reaction instrument. Results. After a successful polymerase chain reaction, two alleles that differed in one nucleotide were detected in our samples. Conclusion. Even though it is financially more demanding, real-time polymerase chain reaction method is recommended for dopamine receptor D2 gene genotyping in routine diagnostics because it is simple, accurate, and fast.

Systematic evaluation of the early access applied biosystems precision ID Globalfiler mixture ID and Globalfiler NGS STR panels for the ion S5 system

Systematic evaluation of the early access applied biosystems precision ID Globalfiler mixture ID and Globalfiler NGS STR panels for the ion S5 system

Miniaturized thermocycler based on thermoelectric heating for diagnosis of sexually transmitted disease by DNA amplification.

Sexually transmitted disease (STD) is among the most common infectious diseases; therefore, it is necessary to develop sensitive early diagnostic techniques. As the gold standard, polymerase chain reaction (PCR) has been most widely employed for STD diagnosis; however, PCR requires large and expensive instruments. In this study, miniaturized thermal cycler using Peltier modules was developed for the PCR analysis. In comparison with the conventional PCR instrument, the Peltier-based micro-PCR (P-mPCR) device developed in this study enables one to amplify and successfully distinguish between DNA of different sizes. Furthermore, by using the clinical vaginal sample collected with the vaginal swab and tampon, different kinds of STD bacteria could be detected with high accuracy (∼94.19%) and high sensitivity (∼95.6%). Therefore, the P-mPCR device will be applicable in STD diagnosis as well as the detection of other bacteria/viruses using DNA amplification in regions including those with limited resources.

Pharmacogenetic testing revisited: 5' nuclease real-time polymerase chain reaction test panels for genotyping CYP2D6 and CYP2C19.

Due to their involvement in the metabolization of commonly prescribed psychopharmaceutical drugs, the cytochrome oxidase genes CYP2D6 and CYP2C19 are extensive targets for pharmacogenetic testing. The existence of common allelic variants allows the prediction of a metabolic phenotype based on a genotype result, hereby supplying a clinical tool for optimizing prescription and minimizing adverse effects. In this study, we present the development of two 5′ nuclease real-time polymerase chain reaction (PCR) test panels, capable of detecting eight of the most clinically relevant alleles of the CYP2D6 gene (*2, *3, *4, *6, *9, *10, 17, *41) and the three most common nonfunctional alleles of CYP2C19 (*2, *3, *4). The assays have been thoroughly validated using a large collection of reference samples, by parallel testing and by DNA sequencing. The reanalysis of reference samples provided the calculation of the frequency of the CYP2D6*4K allele in a population, not previously reported. Furthermore, original test results from CYP2D6*41, generated based on the presence of the 2850T and the lack of the −1584G single-nucleotide polymorphism (SNP), were compared with genotyping based on the current acknowledged founder SNP 2988G of this allele. These results indicate that up to 17.7% of the patients originally tested as carriers of the CYP2D6*41 allele may have had an incorrect phenotypic result assigned. The two 5′ nuclease real-time PCR test panels have subsequently been optimized for use in the clinical laboratory, using a standard real-time PCR instrument and software.

PCR-Based Detection Methods for Single-Nucleotide Polymorphism or Mutation: Real-Time PCR and Its Substantial Contribution Toward Technological Refinement.

Single-nucleotide polymorphisms (SNPs) and single-nucleotide mutations result from the substitution of only a single base. The SNP or mutation can be relevant to disease susceptibility, pathogenesis of disease, and efficacy of specific drugs. It is important to detect SNPs or mutations clinically. Methods to distinguish/detect SNPs or mutations should be highly specific and sensitive. In this regard, polymerase chain reaction (PCR) has provided the necessary analytical performance for many molecular analyses. PCR-based methods for SNP/mutation detection are broadly categorized into two types-(1) polymorphic or mutant allele-directed specific analysis using primers matched with substituted nucleotide or using oligonucleotides to block or clamp the nontargeted template, and (2) melting curve analysis, which is combined with the real-time PCR techniques using hydrolysis probes, hybridization probes, or double-stranded DNA-binding fluorescent dyes. Innovative and novel approaches as well as technical improvements have made SNP- or mutation-detection methods increasingly more sophisticated. These advances include DNA/RNA preparation and subsequent amplification steps, and miniaturization of PCR instruments such that testing may be performed with relative ease in clinical laboratories or as a point-of-care test in clinical settings.

Comparison of a new commercial real-time PCR assay (RealCycler PJIR kit, Progenie Molecular) to an in-house real-time PCR assay for the diagnosis of Pneumocystis jirovecii infections

The atypical fungus Pneumocystis jirovecii ( P. jirovecii ) is the causative agent of a life threatening pneumonia [ Pneumocystis pneumonia (PCP)] in immunosuppressed patients. PCP diagnosis is essentially based on the detection of the fungus in pulmonary specimens using microscopic examination and polymerase chain reaction (PCR). For the past 20 years, the use of PCR assays has improved the sensitivity of P. jirovecii detection. The main objective of the present study was to compare the efficiency of the RealCycler PJIR kit (Progenie Molecular; pmPCR), to an in-house PCR assay (ihPCR), both assays targeting the mitochondrial large subunit ribosomal rRNA gene. Thirty-four patients were retrospectively enrolled in the study. Fourteen patients were initially diagnosed with PCP, 15 were considered to be pulmonary colonized by the fungus, and five were negative for P. jirovecii detection (negative control group). Archival DNA specimens (extracted from the patient's pulmonary specimens) were examined with ihPCR and pmPCR on the same day using the same real-time PCR instrument (Applied Biosystems 7500 Real-Time PCR system). The ihPCR assay was performed as described elsewhere by Meliani et al. and Totet et al. [1,2] . The pmPCR assay was performed according to the manufacturer's recommendations. Concordant results were obtained with the two PCR assays for all DNA specimens but one (33/34). Thus, the concordance rate between the two methods was evaluated at 97% (Cohen's kappa, 0.905). The discrepant result concerned one specimen from a colonized patient previously known to have a cycle threshold (Ct) value ≥ 35 using ihPCR. This specimen was confirmed to be positive with ihPCR and was negative with pmPCR. Taking into account Ct values for positive samples, the correlation factor between the two PCR methods has been evaluated at 0.97 ( R 2 = 0.9481). Taking into account the Cohen's kappa > 0.8, the RealCycler PJIR kit (Progenie Molecular) appears to be an efficient technique to detect P. jirovecii in patients with PCP and in patients colonized by P. jirovecii .

The iron chelator deferasirox affects redox signalling in haematopoietic stem/progenitor cells.

The iron chelator deferasirox (DFX) prevents complications related to transfusional iron overload in several haematological disorders characterized by marrow failure. It is also able to induce haematological responses in a percentage of treated patients, particularly in those affected by myelodysplastic syndromes. The underlying mechanisms responsible for this feature, however, are still poorly understood. In this study, we investigated the effect of DFX-treatment in human haematopoietic/progenitor stem cells, focussing on its impact on the redox balance, which proved to control the interplay between stemness maintenance, self-renewal and differentiation priming. Here we show, for the first time, that DFX treatment induces a significant diphenyleneiodonium-sensitive reactive oxygen species (ROS) production that leads to the activation of POU5F1 (OCT4), SOX2 and SOX17 gene expression, relevant in reprogramming processes, and the reduction of the haematopoietic regulatory proteins CTNNB1 (β-Catenin) and BMI1. These DFX-mediated events were accompanied by decreased CD34 expression, increased mitochondrial mass and up-regulation of the erythropoietic marker CD71 (TFRC) and were compound-specific, dissimilar to deferoxamine. Our findings would suggest a novel mechanism by which DFX, probably independently on its iron-chelating property but through ROS signalling activation, may influence key factors involved in self-renewal/differentiation of haematopoietic stem cells.

Overrepresentation of the COL3A1 AA genotype in Polish skiers with anterior cruciate ligament injury.

Although various intrinsic and extrinsic risk factors for anterior cruciate ligament (ACL) rupture have been identified, the exact aetiology of the injury is not yet fully understood. Type III collagen is an important factor in the repair of connective tissue, and certain gene polymorphisms may impair the tensile strength. The aim of this study was to examine the association of the COL3A1 rs1800255 polymorphism with ACL rupture in Polish male recreational skiers. A total of 321 male Polish recreational skiers were recruited for this study; 138 had surgically diagnosed primary ACL ruptures (ACL-injured group) and 183 were apparently healthy male skiers (control group – CON) who had no self-reported history of ligament or tendon injury. Both groups had a comparable level of exposure to ACL injury. Genomic DNA was extracted from the oral epithelial cells. All samples were genotyped on a real-time polymerase chain reaction instrument. The genotype distribution in the ACL-injured group was significantly different than in CON (respectively: AA=10.1 vs 2.2%, AG=22.5 vs 36.1, GG=67.4 vs 61.8%; p=0.0087). The AA vs AG+GG genotype of COL3A1 (odds ratio (OR)=5.05; 95% confidence interval (CI), 1.62-15.71, p=0.003) was significantly overrepresented in the ACL-injured group compared with CON. The frequency of the A allele was higher in the ACL-injured group (21.4%) compared with CON (20.2%), but the difference was not statistically significant (p=0.72). This study revealed an association between the COL3A1 rs1800255 polymorphism and ACL ruptures in Polish skiers.

Analysis of Multiple Cytokine Polymorphisms in Individuals with Untreated Deep Carious Lesions Reveals IL1B (rs1143643) as a Susceptibility Factor for Periapical Lesion Development

IntroductionIt has been proposed that individual genetic predisposition may contribute to persistent apical periodontitis. Cytokines are associated with levels of inflammation and are involved in caries, pulpal, and periapical tissue destruction. We hypothesized that polymorphisms in cytokine genes may contribute to an individual's increased susceptibility to apical tissue destruction in response to deep carious lesions. MethodsSubjects with deep carious lesions with or without periapical lesions (≥3 mm) were recruited at the University of Pittsburgh, Pittsburgh, PA, and the University of Texas at Houston, Houston, TX. Genomic DNA samples of 316 patients were sorted into 2 groups: 136 cases with deep carious lesions and periapical lesions (cases) and 180 cases with deep carious lesions but no periapical lesions (controls). Nine single-nucleotide polymorphisms in IL1B, IL6, TNF, RANK, RANKL, and OPG genes were selected for genotyping. Genotypes were generated by end point analysis using TaqMan chemistry (Invitrogen, Carlsbad, CA) in a real-time polymerase chain reaction instrument. Allele and genotype frequencies were compared among cases and controls using the PLINK program (http://pngu.mgh.harvard.edu/purcell/plink/). Ninety-three human periapical granulomas and 24 healthy periodontal ligament tissues collected postoperatively were used for messenger RNA expression analyses of IL1B. ResultsA single-nucleotide polymorphism in IL1B (rs1143643) showed allelic (P = .02) and genotypic (P = .004) association with cases of deep caries and periapical lesions. We also observed altered transmission of IL1B marker haplotypes (P = .02) in these individuals. IL1B was highly expressed in granulomas (P < .001). ConclusionsVariations in IL1B may be associated with periapical lesion formation in individuals with untreated deep carious lesions. Future studies could help predict host susceptibility to developing periapical lesions.