Polish Potato Research Articles

Organic system vs. conventional – a Bayesian analysis of Polish potato post-registration trials

AbstractInterest in organic agriculture worldwide is growing and is mainly supported by a strong consumer interest. In the literature, a lot of attention has been paid to comparing organic and conventional systems, on studying the yield gap between the two systems and, how to reduce it. In the present work, based on the results from Polish organic and conventional series of field trials carried out in 2019–2021, organic and conventional systems were compared in terms of potato tuber yield. Moreover, we propose a Bayesian approach to the variety × environment × system data set and describe Bayesian counterparts of two stability measures. Using this methodology, we identify the most stable and highest tuber yielding varieties in the Polish potato organic and conventional series of field trials. It is shown that the tuber yield in the organic system was approx. 44% lower than the tuber yield in the conventional system. Moreover, varieties Tajfun and Otolia were the most stable and highest yielding varieties in the organic system, whereas in the conventional system, the variety Jurek was the most stable and highest yielding variety among the tested varieties. In the present work, the use of the Bayesian approach allowed us to calculate the probability that the mean of a given variety in given system exceeds the mean of control varieties in that system.

Tuber Flesh Colour, Enzymatic Discolouration, Dormancy and Late Blight Resistance of 29 Tuber-Bearing Accessions of Solanum spp.

Potato relatives adapted to many different habitats are promising sources of desirable agricultural traits for potato breeding. Wild potato relatives are preserved in different collections around the world, and their detailed description is key to their exploitation in practice. We described 29 seed accessions of 26 Solanum species originating from the VIR potato collection (Institute of Plant Industry – VIR, Saint Petersburg, Russia) and preserved in Poland. The description included resistance to Phytophthora infestans, tuber flesh colour, enzymatic discolouration and tuber dormancy (sprouting). Up to 13 genotypes were evaluated per accession. The evaluation was repeated in three years for each trait. Two P. infestans isolates were used in late blight resistance tests. Amongst all the tested accessions, five were resistant to both P. infestans isolates, including genotype 13_A2. Twenty-one accessions had white tuber flesh, and 13 accessions showed a lack of or weak enzymatic discolouration. Additionally, we found accessions that were whiter than the standard white-fleshed Polish potato cultivar Irys. In our material, we observed a large variation in the length of the sprouts after storage, indicating differences in the dormancy period length. Four accessions showed a lack of sprouting after 28 weeks of storage at 5–6 °C. The tested material is preserved as in vitro plants in the National Centre for Plant Genetic Resources: Polish Genebank (IHAR-PIB, Radzików, Poland), which will facilitate their use in breeding programs.

Reaction of three potato cultivars to potato virus S and alteration of miRNAs and mRNA targets in the resistant genotypes

AbstractReactions of three Polish potato cultivars to potato virus S (PVS) were investigated at 22°C. Cultivars Tajfun and Tonacja exhibited partial resistance with systemic infection detected in some inoculated plants; cultivar Bryza was susceptible to PVS with systemic infection detected in all inoculated plants. The virus was not detectable by ELISA at 23 days postinoculation (dpi) but was detected after 40 dpi. Infection rate and viral accumulation were significantly lower in Tonacja and Tajfun than in Bryza, but no statistically significant difference between Tajfun and Tonacja was detected. Both susceptible and resistant genotypes displayed various, either common or cultivar‐specific, symptoms. Delayed systemic infection at 56 dpi was observed in some cases in Tonacja and Tajfun. Resistance‐related alteration of a set of miRNAs and mRNA targets in the tested cultivars in response to PVS at 22°C exhibited inter‐ and intracultivar variability. The majority of tested genes were altered only in the partially resistant Tajfun and Tonacja but not in the susceptible Bryza. Enhanced expression of AGO1‐2, DCL1, stu‐miR482 and its target Gpa2 was observed in Tonacja and plants of Tajfun in which PVS was detected, with the highest induction of Gpa2 in Tajfun (30.2‐fold). However, their expression remained unchanged or decreased in plants of Tajfun in which PVS was undetected. Increased expression of stu‐miR168a and stu‐miR172e was observed in Tonacja and the PVS‐undetected plants of Tajfun, respectively, but not in the PVS‐detected plants of Tajfun. This is the first report on cultivar‐specific alteration of miRNA in a potato–PVS resistance interaction.

Over 50 Years of Potato Parental Line Breeding Programme at the Plant Breeding and Acclimatization Institute in Poland

The paper describes the potato parental line breeding programme developed in Poland from the 1960s. The aim of the programme was to create parental forms useful for speeding up the breeding of new potato varieties and getting higher efficiency in directed selection for desired traits. The programme introduced new sources of resistance and quality traits into the Polish breeding pool by conducting research and breeding of tetraploid and diploid parental lines. The programme had significant impact on potato breeding, with 72 Polish potato varieties originating from crossings involving parental lines. These varieties show higher levels of resistance to major pathogens of potato crops, including resistance to Potato virus Y and late blight in starch group. Besides the direct impact on potato breeding, the programme was the stimulus for developing studies focused on potato genotype.

Yielding stability of early maturing potato varieties: Bayesian analysis

AbstractField trials conducted in multiple years across several locations play an essential role in plant breeding and variety testing. Usually, the analysis of the series of field trials is performed using a two-stage approach, where each combination of year and site is treated as environment. In variety testing based on the results from the analysis, the best varieties are recommended for cultivation. Under a Bayesian approach, the variety recommendation process can be treated as a formal decision theoretic problem. In the present study, we describe Bayesian counterparts of two stability measures and compare the varieties in terms of the posterior expected utility. Using the described methodology, we identify the most stable and highest tuber yielding varieties in the Polish potato series of field trials conducted from 2016 to 2018. It is shown that variety Arielle was the highest yielding, the third most stable variety and was the second best variety in terms of the posterior expected utility. In the present work, application of the Bayesian approach allowed us to incorporate the prior knowledge about the tested varieties and offered a possibility of treating the variety recommendation process as a formal decision process.

The effect of different production systems on the content of micronutrients and trace elements in potato tubers

ABSTRACTThe aim of this study was to determine the effect of different production systems (conventional, integrated and organic) on the content of micronutrients and trace elements in the tubers of very early, early and medium-early maturing potato cultivars. Five Polish potato cultivars were grown in three production systems under field conditions. In plant material selected microelements (chemical elements essential for living organisms) were analysed: boron (B), copper (Cu), iron (Fe), manganese (Mn) and zinc (Zn) as well as some trace elements (not regarded as essential element for living organisms): chromium (Cr), nickel, (Ni) and lead (Pb). The content of micronutrients and trace elements in potato tubers was modified by production system, genotype and weather conditions during the growing season. Organically grown potatoes had a higher content of B (8.6–8.9 mg kg−1) and Cu (2.8–3.1 mg kg−1), and a lower content of Fe (47.0–47.1 mg kg−1), Mn (6.0–6.4 mg kg−1) and Zn (11.9–12.2 mg kg−1), than potatoes grown in conventional and integrated systems. Potatoes grown in the conventional system had the highest Pb content. Organic cultivation can assure better alimentation of potato tubers with B and Cu, which are important microelements often deficient in the soils. On the contrary, when cultivating potato in conventional system, one should supply this element with fertilisers.

POLISH FOREIGN TRADE OF POTATOES AND POTATO PRODUCTS IN THE PERIOD 2000-2015

Analysis of potatoes and potato products foreign trade was conducted in changing market and trading conditioning before and after the Polish accession to the EU and in last years, when adaptation processes in the Polish potato sector practically were already finished. In spite of the biggest decrease in last years, Poland still remains one of the bigger producers of potatoes in Europe and in the world. The export of potatoes to the direct consumption is low, however the sale to of potato products to foreign markets systematically grows, mainly of fries and chips, what is possible thanks systematically increasing their domestic production. After the Polish accession to the EU and for abolishing tariff barriers an import of potatoes and potato products considerably increased. Poland has a positive balance in potato products foreign trade, however from the accession to the EU remains the net importer of potatoes.

Evaluation of selected Polish potato cultivars and breeding lines regarding their resistance against Phytophthora infestans and usefulness for organic farming

The presented studies concern an evaluation of 10 potato cultivars (5 starch and 5 table) and 9 selected potato breeding lines re-garding their resistance against Phytophthora infestans as well as other traits such as length of vegetation period, yield, tuber size, regularity of tuber shape, depth of eyes. The aim of these studies was to evaluate of the potential usefulness of tested potato cultivars/clones for organic farming. The obtained results indicate that none of the tested table cultivars should be recommended for organic farming, due to their low resistance to P. infestans. The examined starch cultivars show high resistance to P. infestans, but their cultivation in organic farming seems to be restricted due to other features’ for example very long vegetation period. On the cont-rary, the group of tested potato breeding lines seems to be very useful for organic farming since they are high yielding and display relatively short vegetation period and high resistance to P. infestans. Moreover, these clones produce tubers with an attractive tuber appearance that is indispensable for table potatoes. Przedstawione badania dotyczą oceny 10 odmian (5 jadalnych i 5 skrobiowych) oraz 9 klonów hodowlanych ziemniaka pod względem poziomu odporności na Phytophthora infestans oraz wybranych cech użytkowych (długość wegetacji, wysokość plonu, wielkość bulwy, regularność zarysu, głębokość oczek). Badania te miały na celu określenie ewentualnej przydatności badanych form do upraw ekologicznych. Wyniki badań wskazują, że żadna z badanych odmian jadalnych nie powinna być rekomendowana do upraw ekologicznych ze względu na bardzo niski poziom odporności na P. infestans. Badane odmiany skrobiowe posiadają wysoki poziom odporności na P. infestans, bardzo pożądany w uprawach ekologicznych. Jednakże ich wykorzystanie w tym celu może być ograniczone przez niedobory innych cech użytkowych (np. bardzo długą wegetację). Natomiast grupa badanych klonów hodowlanych charakteryzowała się bardzo wysokim poziomem odporności na P. infestans, skróconym okresem wegetacji, wysokim plonem oraz atrakcyjnym wyglądem bulw.

Single-nucleotide polymorphisms and reading frame shifts in RNA2 recombinant regions of tobacco rattle virus isolates Slu24 and Deb57.

Two previously sequenced tobacco rattle virus (TRV) isolates, Slu24 and Deb57, from Polish potato fields have recombinant RNA2 species. The 3'-proximal region of the Slu24 RNA2 is derived from the 3' terminus of its supporting RNA1, while that of the Deb57 RNA2 is derived from the 3' terminus of the unrelated RNA1 from the isolate SYM or PpK20. Gene structure annotation revealed open reading frames encoding truncated 16-kDa proteins in the recombinant regions of the RNA2 of Deb57 and Slu24. Reading frame shifts, single nucleotide substitutions and deletions occurred during recombination, including shifts from a stop codon or replacements of an internal stop codon. In the recombinant region of the Deb57 RNA2, the first reading frameshift event starts from the AUG start codon of the truncated 16-kDa protein. The second frameshift event, caused by a single nucleotide deletion upstream of the stop codon, leads to the splitting of the stop codon into two amino acid codons and the continuation of translation. In addition, a U-to-A substitution changes a potential internal stop codon UAA, which is caused by recombination-related frame shifts, into the codon AAA, encoding lysine. The replacement of this internal stop codon with an amino acid codon prevented the premature translation termination of the truncated 16-kDa protein. These recombination-related reading frame shifts are the driving force underlying the major differences in the translated amino acids, consequently leading to their translation into distinct polypeptides. Conversely, single nucleotide substitutions in the recombinant regions of the RNA2 of Deb57 or Slu24 resulted in only minor changes in the translated amino acids.

High Stability of a Mitochondrial Genetic Marker mtCOII in Polish Colorado Potato Beetle Populations

Colorado potato beetle (CPB) (Leptinotarsa decemlineata (Say in Journal of the Academy of Natural Sciences of Philadelphia 3: 298–331, 1824)) (Coleoptera: Chrysomelidae) is one of the most serious potato pests. It has been reported worldwide, from North America to Europe and Asia. In this study we analyzed the genetic diversity of a mitochondrial DNA marker – a second subunit of cytochrome oxidase (mtCOII) in Polish CPB populations to assess the possible changes of this gene sequence over time and over the country, influencing the intra-specific variability of CPB. During a three-year survey in Polish potato fields the beetles were collected from 20 evenly spaced locations of varying climatic and geographic conditions, and the nucleotide sequence of this marker was analyzed. Our research revealed that in spite of three years of sampling the mitochondrial haplotype in all individuals was fixed, and no single nucleotide change was found in any individual, indicating a high stability of this maternally inherited marker in L. decemlineata. This finding about the level of biodiversity is of importance for plant protection strategies.

The genomic RNA1 and RNA2 sequences of the tobacco rattle virus isolates found in Polish potato fields

Four tobacco rattle virus (TRV) isolates were identified from tobacco bait seedlings planted in soil samples from Polish potato fields. Sequence analysis of the genomic RNA1 of the isolates revealed significant similarity to the isolates Ho and AL recently found in Germany. Multiple sequence alignments of the genomic RNA2 indicated that the two isolates from northern Poland (Deb57 and Slu24) are in a cluster with the isolates PSG and PLB found in the Netherlands. The remaining two isolates, from central Poland (11r21 and Mlo7), are in a distinct group with the unique isolate SYM found in England. The RNA2 sequences of the studied isolates range from 1998 nt to 2739 nt in length, and all carry deletions of the 2b and/or 2c genes. The isolate Mlo7 has an atypical RNA2 structure, having its cp gene located in its central region.

Biological Stability of Resistance to Phytophthora infestans (Mont.) de Bary in 22 Polish Potato Cultivars Evaluation in Field Experiments

In this study, genotype by environment (G × E) interaction and biological stability of resistance to Phytophthora infestans were analyzed for 22 potato cultivars, using multidimensional statistical methods. Sergen 3 computer program, based on multiplicative model was applied to analyze the G × E interaction and regression analysis. The potato cultivars were tested in four experiments in Central and South-eastern Poland over a 4 year period. The analysis of variance of rAUDPC values indicated significant (P < 0.01) influence of genotype (=cultivar) (G), year (Y), environment (E) and G × E interaction. The applying multidimensional statistical methods revealed that the most stable resistance is expressed by highly resistant cultivars Bzura, Wawrzyn, Meduza and moderately resistant ones Klepa, Jasia, Nimfy, Ania, Hinga, Vistula. For these cultivars all tested interactions (with year, location and environment) were insignificant. Such cultivars can be recommended for cultivation across all environments in Poland. In the group of unstable cultivars, two subgroups were separated: unstable and unpredictable (12 cvs.) and unstable and regular (1 cv). A different response of potato cultivars to environmental factors suggests that there is a need to select potato cultivars which are stable in terms of late blight resistance expression at various locations and years.

Physicochemical properties of starches obtained from Polish potato cultivars

AbstractSelected physicochemical, thermal, and rheological properties of starches isolated from new Polish potato varieties were determined. The starches contained 25.7–30.0 g/100 g d.m. of amylose and 59.5–90.2 mg/100 g d.m. of phosphorus. Gelatinization temperatures were 62.6–64.0, 68.9–69.9, and 73.6–77.0°C for TO, TP, and TE, respectively, whilst enthalpy of gelatinization amounted to 11.1–15.3 J/g. The retrogradation degree of starch was from 52.90 to 78.53%. Pasting curves showed significant differences between the starches. Peak viscosity and final viscosity ranges were 2035–4458 and 1931–2985 mPa · s, respectively. Starch pastes exhibited non‐Newtonian, shear thinning, and thixotropic behavior. After cooling they demonstrated diversified viscoelastic properties, however, all of them were classified as weak gels. Significant linear correlations among selected rheological parameters and amylose and phosphorus content were found. Results of principal component analysis demonstrated an ability to differentiate the starches isolated from different potato varieties.

First Report of Potato mop-top virus on Potato in Poland.

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production.

History and Mythology of Polish Vodka: 1270-2007

Today, vodka is an important element in Polish national identity. The distillation of wine was known to a small number of Polish physicians and scholars by the end of the 13th century, but widespread popularity of distillates as beverages did not come earlier than the end of the 16th century. Grain vodkas, in particular rye vodkas, have been an important part of Polish culture since at least the early 17th century. Polish potato vodkas arose in the late 18th century and dominated production in the 19th and early 20th centuries, but then fell to minimal levels.

Potato production and protection in Poland in the 1990s1

Potato is an important crop for Polish agriculture, now grown on an area of 1.8 million ha, with an annual production of about 35 million t. The crop is used for fodder (pork production), human consumption and as a raw material for various branches of industry. High quantity and quality are essential for proper utilization. The main limiting factors in Polish potato production are: water (shortage or excess), seed potato quality, cultivation practices, and damage by pests, diseases and weeds. Improving the economics of potato production depends on decreasing the acreage and increasing the extent of proper protection. The major constraint is late blight (Phytophthora infestans) which causes yield losses estimated at 22.8%. Blight control is indispensable. The level of resistance among Polish cultivars, both in haulm and tuber, is not satisfactory, so more intensive resistance breeding is needed. Chemical control has increased in popularity, but improper use of phenylamides has created new problems. Further progress will depend on cost‐effective methods of control and reliable use of fungicides.

Early generation selection methods used in Polish potato breeding

Polish potato breeding involves two stages: development of parental lines and their use in the development of new cultivars. In the breeding of new cultivars, early generation selection is based mainly on visual discrimination of superior genotypes. Careful evaluation of clones is done in later generations. In parental line breeding the whole selection procedure is completed in early generations. Experience gained in early generation selection for virus resistance, yield, and dry matter content has been summarized. Evidence has also been presented that evaluation of individual tubers makes possible an inexpensive selection of numerous genotypes for several important characters.

Storage and reconditioning of tubers of Polish potato varieties and strains. 2. Changes in sugar level in potato tubers of different varieties and strains during reconditioning of cold-stored potatoes

Sugar disappearance during reconditioning of cold-stored (1,2 and 6°C) Polish potato varieties and strains was investigated. A high sugar level usually increased the rate of sugar loss during subsequent reconditioning, though there were some exceptions. Comparison of two reconditioning temperatures (20 and 30°C) showed that the higher temperature did not increase the rate of sugar loss and because of higher total losses it is not recommended for practical use.

Storage and reconditioning of tubers of Polish potato varieties and strains. 1. influence of storage temperature on sugar level in potato tubers of different varieties and strains

Potato tubers of several Polish varieties and strains were stored at low temperature (1, 2 and 6°C) and examined for sugar accumulation. The amount of accumulated sugar depended on the variety (strain) and was negligible at 6°C, greater at 2°C and the greatest at 1°C. The reducing sugar usually predominated and fructose was accumulated faster than glucose. There were two exceptions (R-42431 and R-38319), which accumulated a high percentage of sucrose with an accompanying low percentage of reducing sugars.

Physiological Behavior of Enzymes and Carbohydrate Transformations in After-Ripening of the Potato Tuber

Previous articleNext article FreePhysiological Behavior of Enzymes and Carbohydrate Transformations in After-Ripening of the Potato TuberCharles O. ApplemanCharles O. Appleman Search for more articles by this author PDFPDF PLUS Add to favoritesDownload CitationTrack CitationsPermissionsReprints Share onFacebookTwitterLinkedInRedditEmail SectionsMoreDetailsFiguresReferencesCited by Volume 52, Number 4Oct., 1911 Article DOIhttps://doi.org/10.1086/330637 Views: 167Total views on this site Citations: 4Citations are reported from Crossref Journal History This article was published in the Botanical Gazette (1876-1991), which is continued by International Journal of Plant Sciences (1992-present). PDF download Crossref reports the following articles citing this article:B. Samotus, M. Niedźwiedź, Z. Kolodziej, M. Leja, B. Czajkowska Storage and reconditioning of tubers of Polish potato varieties and strains. 1. influence of storage temperature on sugar level in potato tubers of different varieties and strains, Potato Research 17, no.11 (Mar 1974): 64–81.https://doi.org/10.1007/BF02361870Howard W. Hruschka, Wilson L. Smith, James E. Baker Reducing chilling injury of potatoes by intermittent warming, American Potato Journal 46, no.22 (Feb 1969): 38–53.https://doi.org/10.1007/BF02868692D. A. van Schreven On the physiology of tuber formation in potatoes, Plant and Soil 8, no.11 (Aug 1956): 56–74.https://doi.org/10.1007/BF01394196 Sophia Eckerson A Physiological and Chemical Study of After-Ripening, Botanical Gazette 55, no.44 (Sep 2015): 286–299.https://doi.org/10.1086/331050