Plant Mini Kit Research Articles

FIRST REPORT OF FIG MOSAIC VIRUS, FIG LEAF MOTTLE- ASSOCIATED VIRUS 1 AND FIG MILD MOTTLE-ASSOCIATED VIRUS INFECTING FIG (Ficus carica) IN MONTENEGRO

In Montenegro more than 200 000 fig trees are registered with an annual production of about 4000 t. A survey was conducted on fig trees of different varieties, located in a commercial orchard in Podgorica and a germplasm collection located in Bar, Montenegro, to assess the presence of five fig viruses i.e. Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 and 2 (FLMaV-1 and -2), Fig latent virus 1 (FLV-1) and Fig mild mottle-associated virus (FMMaV). In May 2015, leaf samples were taken from 21 fig trees showing leaf discolorations, vein clearing, ring spots, leaf distortion and mosaic symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (QIAGEN) and tested by RT-PCR using virus-specific primers (Elbeaino et al., 2006, 2009, 2010). RT-PCR results showed infections with FMV (9 of 21 samples tested), FLMaV-1 (18 of 21) and FMMaV (2 of 21), whereas FLMaV-2 and FLV-1 were not detected. FMMaV was identified only in samples from Bar in mixed infection with FMV and FLMaV-1. Nucleotides sequence analyses of PCR amplicons obtained (GenBank accession Nos. KU198374-KU198377, KU198383-KU198389) revealed that at the nucleotide level, FMV, FLMaV-1 and FMMaV isolates from Montenegro shared 86-95%, 93-95% and 84- 95% identity, respectively with homologues in the GenBank. To our knowledge, this is the first report of FMV, FLMaV-1 and FMMaV in fig trees in Montenegro. In the future, an extensive survey on more samples could allow a better evaluation of the sanitary status of this crop in the country.

FIRST REPORT OF GARLIC COMMON LATENT VIRUS IN GARLIC FROM NIGERIA

Garlic (Allium sativum L.) is one of the oldest known horticultural crops of the world. Several viruses belonging to the genera Potyvirus, Carlavirus, and Allexivirus are known to infect garlic and reduce their yield worldwide (Dijk, 1994; Walkey and Antill, 1989). This study was undertaken to investigate the status of viral infection in Nigerian garlic. Ten garlic bulbs collected in March of 2015 from two fields in Kano and Sokoto region of Nigeria were tested by direct antigen coated (DAC)-ELISA with antisera to Garlic common latent virus (GarCLV) (Bioreba, Reinach, Switzerland). All the samples were positive for GarCLV. To confirm the presence of GarCLV, reverse transcription (RT)-PCR was performed using primers published earlier (Majumder and Baranwal, 2014) and total RNA extracted from 100 mg of leaves with the RNeasy Plant Mini kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer's instructions. Expected amplicons of ca. 450 bp were obtained from all the samples tested. Direct sequencing of the PCR products from one sample produced a 418-bp long nucleotide sequence. It showed 95% identity with a garlic isolate from The Netherlands (GenBank accession No. AB004804). To our knowledge, this is the first report of GarCLV on garlic in Nigeria.

FIRST REPORT OF PAPAYA RINGSPOT VIRUS INFECTING CARICA PAPAYA IN ARGENTINA

Fil: Cabrera Mederos, Dariel. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Instituto de Patologia Vegetal; Argentina. Consejo Nacional de Investigaciones Cientificas y Tecnicas; Argentina

PM 7/128 (1) Xanthomonas axonopodis pv. allii

Specific scopeThis Standard describes a diagnostic protocol for Xanthomonas axonopodis pv. allii.This Standard should be used in conjunction with PM 7/76 Use of EPPO diagnostic protocols.Specific approval and amendmentFirst approved in 2016‐09.

FIRST REPORT OF 'CANDIDATUS LIBERIBACTER SOLANACEARUM' IN COMMERCIAL CARROT SEEDS IN ITALY

‘Candidatus Liberibacter solanacearum’ (CaLsol) is an emerging bacterium, which is seed-borne in carrot (Bertolini et al., 2015). Exclusion of infected seeds is mandatory to prevent the introduction and the establishment of CaLsol in new areas, such as Italy. Here, we tested carrot seeds, sold in Italy during 2015, for CaLsol by analyzing three lots of ‘Berlicum’ (#1, #9 and #17) and one each of ‘Nantese’ (#6), ‘Flakkee’ (#11), ‘Bolero’ (#3) and ‘Mezza Lunga Nantese’ (#15). DNA was extracted using the QIAGEN DNeasy® Plant mini kit on 0.5 g of seeds ground in CTAB buffer. All samples were analyzed by real-time PCR of the 16S rDNA (Li et al., 2009) and conventional PCR of ISR16/23S (Ravindran et al., 2011) and 50S (Munyaneza et al., 2009) rDNAs. CaLsol DNA was detected, regardless of the method utilized, in all seed lots except ‘Bolero’. Sequence analysis identified two homogeneous groups of CaLsol isolates: I) lots #1, #9, #15 (GenBank accession Nos. KU041863 for ISR16/23S and KU041865 for 50SrDNA), and II) lots #6, #11, #17 (KT984852 for ISR16/23S and KU041864 for 50SrDNA). The single-nucleotide polymorphism analysis revealed that the first group was closely related to the CaLsol haplotype-E (except for having A at nucleotides 1620 and 1632 of ISR16/23S), while the second to the haplotype-D (except for having A at nucleotide 1648 of ISR16/23S, and T at nucleotides 920 and 1068 of 50SrDNA). The detection of CaLsol in different carrot seed cultivars commercialized in Italy highlights the requirement of harmonized and coordinated preventive measures to limit its spread.

DETECTION OF FIG MOSAIC VIRUS, FIG LEAF MOTTLE-ASSOCIATED VIRUS 1 AND FIG MILD MOTTLE-ASSOCIATED VIRUS IN BOSNIA AND HERZEGOVINA

During May 2015, a small scale survey was conducted on 27 fig trees situated in three locations (Mostar, Trebinje and Ljubuski) in Bosnia and Herzegovina, to investigate the presence of Fig mosaic virus (FMV), Fig leaf mottle-associated virus 1 (FLMaV-1), Fig leaf mottle-associated virus 2 (FLMaV- 2) and Fig mild mottle-associated virus (FMMaV). Samples consisted of leaves singularly taken from trees with symptoms of mosaic, vein yellowing, ring spots, necroses and leaf malformations (23 plants) and one asymptomatic tree, all situated in a fig germplasm collection plot. Additional three samples were taken from symptomatic fig plants of three outdoor gardens. Total RNAs extracted from the leaf midrib using RNeasy Plant Mini Kit (QIAGEN), were used in RT-PCR assays with specific primer pairs for each virus following protocols described in Elbeaino et al. (2006, 2009, 2010). RT-PCR results revealed 19 FMV- (70%), 25 FLMaV-1- (92%) and 4 FMMaV- (15%) positive samples. Double infections with FLMaV-1 and FMV were detected in 74% samples, while triple infections with FLMaV- 1, FMV and FMMaV affected 15% of tested figs. After cloning and bi-directional sequencing of 2 clones from random PCR amplicons for each virus, nucleotide BLASTn sequence analyses for FLMaV- 1 (350 bp) (GenBank Accession Nos. KU198378-KU198382), FMMaV (311 bp) (KU198388) and FMV (302 bp) (KU198367-KU198373) showed identity levels of 84-95%, 89-92% and 83-97%, respectively, with homologues available in GenBank. To our knowledge, this is the first report of three fig-infecting viruses (FLMaV-1, FMMaV and FMV) in Bosnia and Herzegovina and the results obtained, even if limited, reflect a precarious sanitary status of fig that needs a clean stock program in this country.

First Report of Tar Spot on Corn Caused by Phyllachora maydis in the United States

HomePlant DiseaseVol. 100, No. 7First Report of Tar Spot on Corn Caused by Phyllachora maydis in the United States PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Tar Spot on Corn Caused by Phyllachora maydis in the United StatesG. Ruhl, M. K. Romberg, S. Bissonnette, D. Plewa, T. Creswell, and K. A. WiseG. RuhlSearch for more papers by this author, M. K. RombergSearch for more papers by this author, S. BissonnetteSearch for more papers by this author, D. PlewaSearch for more papers by this author, T. CreswellSearch for more papers by this author, and K. A. WiseSearch for more papers by this authorAffiliationsAuthors and Affiliations G. Ruhl , Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47905 M. K. Romberg , Department of Agriculture-Animal Plant Health Inspection Service, Beltsville, MD 20705 S. Bissonnette D. Plewa , Department of Crop Sciences, University of Illinois, Urbana 61801 T. Creswell K. A. Wise , Department of Botany and Plant Pathology, Purdue University, West Lafayette, IN 47905. Published Online:1 Apr 2016https://doi.org/10.1094/PDIS-12-15-1506-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat In early September 2015, the Purdue Plant and Pest Diagnostic Lab (PPDL) received leaves of hybrid corn (Zea mays L.) from Carroll and Cass counties, Indiana, and Bureau, Dekalb, and LaSalle counties, Illinois, showing small (0.5 to 1.5 mm), black, circular, raised structures on the epidermis of leaves. The black structures were observed on both healthy and necrotic tissue and were surrounded by narrow tan halos. Disease severity varied across samples from a variety of commercial hybrids, ranging from 1 to 80% of leaf tissue affected. Microscopic observation revealed single and clustered ascomata within a clypeus, containing cylindrical unitunicate asci with ellipsoid, hyaline, uniserate, aseptate ascospores 6 to 8.5 × 11 to 14 µm (n = 25), and abundant filiform paraphyses. Based on these characters, the fungus was identified as Phyllachora maydis Maubl., cause of tar spot (Parbery 1967). Samples were sent to the USDA-APHIS in Beltsville, MD, for official confirmation, since the disease had not previously been reported in the United States. The fungus on samples from Indiana and Illinois was identified morphologically and officially confirmed on 9 September and 18 September 2015, respectively. These samples have been accessioned at the U.S. National Fungus Collections (BPI) in Beltsville, MD. DNA was extracted directly from ascomata on leaves using a Qiagen Plant Mini kit (Qiagen, Valencia, CA). Amplicons of the internal transcribed spacer regions were generated using standard methods with primers ITS4 and ITS5 for four samples of P. maydis; two from Indiana and two from Illinois. The sequence of the ITS region from the Carroll County sample (BPI 893231) was submitted to GenBank (Accession No. KU184459). Phyllachora maydis is classified as an obligate biotroph and is considered to be nonculturable (Muller and Samuels 1984). Multiple attempts to culture the fungus were unsuccessful. No P. maydis accessions previously existed in GenBank, and since Phyllachora spp. have primarily been identified by morphology, very few sequences of any species on any host exist in GenBank for comparison. To ensure the submitted P. maydis sequence is indeed a representative sequence of this fungus, it was compared and determined to be identical across the length sequenced to the sequence from a completely different P. maydis sample. After the initial confirmation, the disease was reported in five additional counties in Indiana, and 10 additional counties in Illinois. Tar spot is prevalent in Mexico and areas of Central and South America (Hock et al. 1992). Phyllachora maydis alone is not known to cause economic damage in these areas, but the presence of P. maydis with another fungus, Monographella maydis, can result in severe disease (Hock et al. 1995). Monographella maydis was not detected morphologically in any of the U.S. samples, and no associated yield loss was observed in fields in Indiana and Illinois with the disease. The economic importance of the disease in the United States is still unknown at this time since symptoms were observed too late in the season to affect yield. Phyllachora maydis is not known to infect seed. It is suspected that inoculum may have been transported to the United States via weather events originating in Central America or Mexico.

First report of ‘Candidatus Phytoplasma trifolii’ (16SrVI group) in Nagpur mandarin (Citrus reticulata) showing huanglongbing symptoms in central India

Huanglongbing (HLB) or citrus greening disease causes decline and/or death of millions of citrus trees in production areas worldwide, including India. Although the disease is primarily attributed to ‘Candidatus Liberibacter asiaticus’, an unculturable α-proteobacterium, phytoplasmas belonging to the groups 16SrIX in Brazil (Texeira et al., 6), 16SrII in China (Lou et al., 5), and 16SrI in China (Chen et al., 2) and Mexico (Arratia-Castro et al., 1) have been associated with HLB. The present study examined whether in addition to ‘Ca. L. asiaticus’, phytoplasmas were also associated with HLB-like symptoms in Indian citrus groves. Nagpur mandarin (Citrus reticulata), a commercially important citrus cultivar, is grown on around 200,000 hectares in central India. Leaf samples of Nagpur mandarin trees showing HLB-like yellow shoot (Fig. 1) and blotchy mottle symptoms (Fig. 2) were collected from Nagpur district (Kalmeshwar, Katol and Saoner localities) of Maharashtra state, central India between October 2015 and March 2016. Total genomic DNA was isolated from 150 mg of 15 symptomatic and five asymptomatic samples (leaf midribs) using a Qiagen DNeasy Plant Mini Kit. The presence of ‘Ca. Liberibacter asiaticus’ was tested by real-time PCR (ABI 7300, Applied Biosystems, USA) using specific16S rDNA-based TaqMan primer-probe sets (HLBasr/HLBp) (Li et al., 4). To ascertain the association of phytoplasma, PCR was performed using P1/P7 universal primers specific to the 16S rRNA gene of phytoplasmas, followed by a nested PCR from a 1:30 dilution of the P1/P7 PCR products using primer sets R16F2n/R16R2 (Gundersen & Lee, 3) and Fu5/Ru3 (Lou et al., 5). Out of the 15 HLB-symptomatic mandarin plants, all were positive for ‘Ca. L. asiaticus’ (real time PCR Ct values ranged from 19.2 to 26.7) and three were positive for phytoplasma (nested PCR amplicons of the expected sizes, ~1.25 Kb for R16F2n/R16R2 and ~0.88 Kb for Fu5/Ru3 primers were obtained). The five symptomless samples were negative both for ‘Ca. L. asiaticus’ and phytoplasma. The three R16F2n/R16R2 amplicons were purified and directly sequenced (Eurofins, Bangalore, India) and showed 100% sequence identity to each other. The consensus sequence of Nagpur mandarin (NM)-HLB phytoplasma was deposited in GenBank (Accession No. KX588712). A BLAST search showed that the NM-HLB phytoplasma had 99% sequence identity with those of members of the 16SrVI (‘Ca. Phytoplasma trifolii’) group. Phylogenetic analysis (MEGA software version 6.0, using the neighbour joining method with 1000 times bootstrapping) of 16S rRNA sequences confirmed the NM-HLB phytoplasma as a 'Ca. Phytoplasma trifolii'-related strain (Fig. 3). Computer-simulated restriction analysis of R16F2n/R16R2 sequence with 17 restriction endonucleases (AluI, BamHI, BfaI, BstUI, DraI, EcoRI, HaeIII, HhaI, HinfI, HpaI, HpaII, KpnI, Sau3AI, MseI, RsaI, SspI and TaqI) using the iPhyclassifier online tool (http://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi) revealed that the virtual RFLP pattern of the NMHLB phytoplasma was identical (similarity coefficient 1.00) to the reference pattern of 16Sr group VI, subgroup D (X83431). To our knowledge, this is the first report of the association of a ‘Ca. Phytoplasma trifolii’ (16SrVI)- related strain with HLB in India. This is also the first time this phytoplasma has been detected in citrus which underlines the need to expand the current HLB management strategy. The authors would like to thank Dr. M. S. Ladaniya, Director, ICAR-CCRI for his kind help and encouragement.

FIRST REPORT OF FIG MOSAIC VIRUS AND FIG BADNAVIRUS 1 ON COMMON FIG TREES IN CROATIA

Common fig (Ficus carica L.) is one of the most common fruit trees in the Croatian coastal region. Fig mosaic symp- toms, first reported more than a half century ago (Perisic , 1952) are found on most cultivars. In 2014, leaf samples were taken from 30 autochthonous fig trees from two locations of the Istrian peninsula for laboratory analyses. Twenty six trees exhibited typical symptoms of foliar mosaic, one tree exhibited also fasciations, while the remaining four trees were asymptomatic. Extraction of total RNA was done us- ing an RNeasy plant mini kit (Qiagen, Germany) and ex- traction of DNA using a GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, USA). Plants were tested by PCR for the presence of Fig mosaic virus (FMV) and Fig badnavirus 1 (FBV-1), applying previously described condi- tions and diagnostic primers (Elbeaino et al., 2009; Laney et al., 2012). A symptomless fig tree was used as negative control. The infection with FMV was confirmed in 26 symp- tomatic out of 30 sampled trees (87%), while all 30 plants were positive for FBV-1. One amplicon each of FMV and FBV-1 (isolates FMV-Cro-19S and FBV-1-Cro-17S, respec- tively), were sequenced in both directions (GenBank acces- sion Nos KT312843 and KT312844). A BLASTN program search showed 97% identity at the nucleotide level of the FMV-Cro-19S RdRp gene with the comparable sequence of FMV SB2-2 isolate from Serbia (AB697838), while the poly- protein gene from FBV-1-Cro-17S had a sequence identical to that of several FBV-1 isolates from the USA (JN050864, JN050875, JN112365). To the best of our knowledge, this is the first report of FMV and FBV-1 in Croatia.

First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

First Report of Banana mild mosaic virus Infecting Banana in India

Viruses are important constraints to the movement and propagation of plant germplasm, especially for vegetatively propagated crops such as banana and plantain. Leaf samples showing mild chlorotic streak symptoms were collected during surveys in 2013-2015 inTamil Nadu, Kerala, Goa and the research fields of ICAR-National Research Centre for Banana, Tiruchirapalli India. Based on the symptoms observed (Gambley and Thomas, 2001), infection by Banana mild mosaic virus (BanMMV, family Flexiviridae) was suspected. Electron microscopy of symptomatic tissue extracts revealed the presence of filamentous virus like particles approximately 800 nm long. RT-PCR using total RNA was isolated from leaf tissue by the RNeasy Plant Mini Kit (Qiagen). Primer BanCP1 (5'-GGATCCCGGGTTTTTTTTTTTTTTTTT-3'), which is an oligo (dT) with additional cloning sites at its 5' end, was used for the reverse transcription step (Teycheney et al. 2005). Virus specific primers, BanMMVCPFP: 5'ATGGCAACDGGGGAAAAGAAGG3' and BanMMVCPRP: 5' TTAATTATTCAATTTGAGGCTCA 3' were used for PCR amplification. The coat protein (CP) gene of the BanMMV isolate consisted of 717 nucleotides. The CP gene of the Indian BanMMV isolates were compared with the CP of the published isolates. Sequence of the Indian isolate shared 74.4 to 91.7% nucleotides and 87.3 to 95.7% deduced amino acid similarities with other BanMMV isolates. Nucleic acid spot hybridization performed using specific probe has also confirmed the presence of the virus in the infected banana leaf samples but not in the healthy leaf samples. To the best of our knowledge, this is the first molecular evidence for the occurrence of BanMMV in banana in India.

The Length Polymorphism of the Locus psbA-trnH is Idyllic to Detect the Adulterations of Black Pepper with Papaya Seeds and Chili

Black pepper (Piper nigrum L.) is an important spice. The adulteration of black pepper seeds and powder with papaya seeds, green chili and red chili can be seen and limited studies have been conducted to detect these adulterants. The objectives of the present study were to assess the appropriateness of morphometric methods to discriminate papaya seed and chili adulterations in black pepper and to establish a DNA based strategy to detect these adulterations. A necessary adulteration series of seeds and powders were prepared for the analyses along with commercial samples. The appearance of the seed and powder samples were slightly different but not very distinct among the pure and adulterated samples emphasizing the need of a biochemical approach to detect the adulteration. The adulterated and commercial black pepper samples received lower pungency ranks compared to that of pure samples. QIAGEN DNeasy® Plant Mini Kit was successful in extracting PCR amplifiable DNA from any sample without papaya seeds and the modified CTAB method was able to extract required PCR amenable DNA from any sample with papaya seed material. The universal DNA barcoding primer pair, psbA-trnH, was used to amplify the DNA. Black pepper DNA yielded 200 bp band, chili and papaya DNA yielded 450 bp band and DNA from adulterated samples produced both 200 bp and 450 bp bands. Therefore this strategy can be used to detect papaya / chili adulterations in black pepper.

IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF TOBACCO MILD GREEN MOSAIC VIRUS IN HUNGARY

Pepper (Capsicum annuum L.), an important crop in Hun- gary, is frequently infected by Cucumber mosaic virus (CMV), Tobacco mosaic virus (TMV) and, recently, also by Pepper mild mottle virus (PMMoV) and Tomato spotted wilt virus (TSWV). In the spring of 2015, mild mosaic symptoms were observed on cv. Ho F1. Symptoms on the fruits were more obvious, consisting of reduction in size, mottling and color changes, brown necrotic streaks and spots. To identify the putative pathogen(s), symptomatic fruits were collected and used for host range determination. Symptoms on mechani- cally inoculated Nicotiana tabacum cv. Samsun, N. tabacum cv. Xanthi-nc, Nicotiana benthamiana, Capsicum annuum cv. Albaregia (L+ gene), C. annuum cv. Feherozon (L1) and C. annuum cv. Brendon F1 (L3) suggested the presence of a tobamovirus belonging to pathotype 0 (Boukema, 1980). Moreover, total RNA was extracted from a symptomatic pepper fruit with the RNeasy plant mini kit (Qiagen, Ger- many) and used in RT-PCR using universal tobamovirus primers for the coat protein gene (Kalman et al., 2001). A products of the expected size (700 bp) was obtained, cloned into pGEM-T Easy Vector (Promega, USA) and sequenced (Biomi, Hungary). The sequence was deposited in GenBank under the accession No. KT374283. Blast analysis showed a 99% identity at nucleotide level with a Spanish isolate (P04/17, accession No. FN594859) of Tobacco mild green mosaic virus (TMGMV). To our knowledge, this is the first report of TMGMV on pepper in Hungary.

First Report of Orchid fleck virus in Lilyturf (Liriope spicata) in Australia

Liriope spicata (Asparagaceae) is an evergreen ornamental plant commonly referred to as lilyturf, creeping liriope, monkey grass, or creeping lilyturf, and is widely grown as groundcover and for erosion control (Fantz 2008). In April 2015, lilyturf plants with bright yellow flecks on the leaves were observed in landscape plantings across the St. Lucia campus of the University of Queensland, Brisbane, Australia. These symptoms were reminiscent of those observed on leaves of orchid species infected by Orchid fleck virus (OFV) (Kubo et al. 2009). Symptomatic leaf samples were collected and analyzed in a JEM-1400 transmission electron microscope (JEOL Ltd., Tokyo, Japan). Leaf dips were prepared by breaking up symptomatic tissue in 1% ammonium molybdate, pH 7.0 negative stain and extracts were placed on nitrocellulose-coated copper grids. Digital micrographs were captured with an Orius digital camera (Gatan Inc., Pleasanton, CA). Typical nonenveloped, rhabdovirus-like, bacilliform particles measuring ∼45 × 95 nm were observed, similar to those of OFV from infected orchids (Kondo et al. 2006). Total RNA was extracted from symptomatic tissue using an RNeasy Plant Mini Kit (Qiagen) and subjected to RT-PCR using the Superscript III One Step RT-PCR System with Platinum Taq DNA Polymerase (Thermo Fisher) and OFV nucleoprotein (N) gene primers polydT/SP6 (5′-GATTTAGGTGACACTATAGTTTTTTTTTTTTTTTTT(A/G/C)-3′) and mN2 (5′-TGCAGGAATATAGCCGACATGTT-3′) (Blanchfield et al. 2001). Agarose gel electrophoresis showed a single amplicon of ∼800 bp, comparable to the OFV positive control. DNA from both the lilyturf (DAF Plant Virus Collection Accession No. 5216) and a cymbidium OFV control (Accession No. 703) amplicons were gel-purified and cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced using dideoxynucleotide sequencing at the Australian Genome Research Facility (Brisbane, Australia). A GenBank BLASTx search of the lilyturf virus N gene sequence of 658 nt showed 100% match to the N protein sequence of an Australian OFV isolate (Genbank Accession No. AAK09392 and e-value 1e-143). The partial N gene nucleotide sequence of the lilyturf OFV isolate #5216 was 99% identical to the cymbidium OFV isolate. Both sequences have been deposited in GenBank with Accession Nos. KT947974 and KT947975, respectively. Based on the observed symptoms, particle morphology, N gene amplicon using OFV primers, and high sequence identity with other OFV sequences, we conclude that the lilyturf plants were infected with OFV. This is the first report of OFV infecting L. spicata. This alternative host may play a possible role in OFV spread to orchids or other ornamental species that are colonized by its Brevipalpus sp. mite vector.

FIRST REPORT OF LITTLE CHERRY VIRUS 2 ON PRUNUS CERASUS var. MARASCA IN CROATIA

Little cherry virus 2 (LChV-2) is considered an important pathogen of cherries and, as such, testing of plant material is required according to the EPPO certification scheme PM 4/29 for cherries. In Croatia sour cherry Marasca is a well-known native variety with total production of 1500-1800 tons of fresh fruit per year, used mainly for production of renowned liqueurs and juices. In June 2014, 19 trees were selected and total RNA was extracted from leaves with the RNeasy plant mini kit (Qiagen, Germany). RT-PCR for LChV-2 was performed using two sets of primers: LCHV2LO2/LCHV2UP2 (Rott and Jelkmann, 2001), amplifying a 438 bp fragment of the methyltransferase (MT) gene, and LC26L/LC26R (Eastwell and Bernardy, 2001), amplifying a 409 bp fragment of the RdRp gene. Six trees were positive, four with the first primer set and two with the second. However, none of the trees tested positive by both sets, suggesting the presence of significant sequence variability among LChV-2 isolates (Theilmann et al., 2004) and the presence of at least two virus variants in Croatia. One PCR product for each primer set was sequenced from both directions and sequences were compiled using MEGA6 software. BLAST searches indicated that the part of the MT gene of Croatian isolate M-79 (GenBank accession No. KT369315) shares 88% identity with the USA6b isolate of LChV-2 (AF531505), while isolate M-75 (KT369316) was closest to Canadian strain LC5 (AF416335), sharing 96% identity with part of the RdRp gene. During the 2015 harvest period, some of the LChV-2-infected trees displayed the characteristic symptoms of uneven ripening. To the best of our knowledge this is the first report of LChV-2 in Croatia.

English

Transcriptome analysis requires a large quantity of high-quality DNase-treated RNA for poly(A)+ mRNA isolation and sequencing. This could be problematic in many oleaginous microalgal species that harbor strong cell walls and accumulate high lipid content. Using Scenedesmus obliquus, a microalga with high oil content and potential as a source of algal biofuel, we assessed the efficiency of four RNA isolation methods: direct extraction using TriPure, mechanical breakage using either freeze-thawed with bead beating or grinding in liquid nitrogen followed by TriPure, and grinding in liquid nitrogen before using Qiagen RNeasy Plant Mini Kit. Liquid nitrogen grinding with TriPure method gave the best RNA yields at 15.15 µg mg -1 cell dry weight and ~148.9 µg total RNA from 100 ml culture of S. obliquus. Despite lower yields, RNA isolation of oil accumulating cells (~22% w/w lipid content) provided ~68.1 µg total RNA with the yield of 1.70 µg mg -1 cell dry weight. Transcriptome sequencing and de novo assembly with the average contig length of 824 bp reflected high quality of RNA obtained using this method. The RNA isolation protocol was tested on six other oleaginous microalgae including Chlamydomonas reinhardtii, S. acuminatus, Chorella vulgaris, Chlorococcum humicola, Tetradesmus cumbricus and Coelastrum sp. and yielded 0.86 - 5.42 µg mg -1 cell dry weight. For large scale RNA isolation from microalgae, grinding with liquid nitrogen before TriPure provided the best yield and quality. This finding helps simplify RNA isolation for upcoming transcriptome analyses in microalgae.

FIRST REPORT OF POTATO SPINDLE TUBER VIROID IN MONTENEGRO

In summer of 2015, asymptomatic samples of Solanum jasminoides (eight samples), Brugmansia sp. (four samples), Lycianthes rantonnetii (three samples) and Datura sp. (two samples) were collected in six different municipalities of Montenegro (Bar, Kotor, Pljevlja, Bijelo Polje, Herceg Novi and Ulcinj) and tested for Potato spindle tuber viroid (PSTVd). Total RNA was extracted from leaves using the RNeasy Plant Mini kit (Qiagen, Germany) according to the manufacturer's instructions and amplified by RT-PCR according to the EPPO protocol (OEPP/EPPO, 2004). Four samples (three samples of S. jasminoides and one of Brugmansia sp) out of five samples collected in the Kotor municipality were positive for PSTVd. Samples from other municipalities were negative for PSTVd. To confirm these results, leaves of the positive samples were analyzed with a second RT-PCR (Faggioli et al., 2013). The amplified products obtained with both the first and second RT-PCR diagnostic protocols were cloned and sequenced. All the PSTVd clones showed nucleotide sequences identical among themselves (GenBank accession numbers KU323790-KU323792 for isolates from S. jasminoides and KU323793 for an isolate of Brugmansia sp.) and to a Croatian isolate of S. jasminoides (GenBank accession number KF418767.1). To our knowledge, this is the first report of PSTVd in Montenegro.

Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

Occurrence, identification and phylogenetic analysis of Fusarium proliferatum on bean seed (Phaseolus vulgaris L.) in Serbia

During the routine quality control analysis on bean seeds in 2015, Fusarium fungal infection was observed on an average of 17% of the bean seed. The objective of this paper was isolation and identification of Fusarium sp. based on the pathogen's morphological and molecular characteristics. Morphological identification of Fusarium isolates was performed on PDA and CLA. DNA of 14 Fusarium sp. isolates was extracted directly from the mycelium (~ 100 mg wet weight), with a Dneasy Plant Mini Kit (Qiagen, Hilden, Germany). Following DNA extraction, the translation elongation factor 1-alpha region was amplified by PCR with the primer pair EF1 and EF2. An amplicon of 700 bp was amplified in all tested isolates. Identification of one isolate was performed by sequencing the translation elongation factor EF-1a gene. Completed morphological and molecular characteristics of isolates, as well as the results of sequencing confirmed that Fusarium proliferatum was the causal agent of bean seed rot.

Whole Genome Sequencing of Azole-Resistant Aspergillus Fumigatus Strains from Hematopoietic Stem Cell Recipients Identifies Candidate Molecular Targets Potentially Implicated in Novel Resistance Mediating Mechanisms - First Results

IntroductionInvasive aspergillosis (IA) represents a critical complication that frequently emerges during induction chemotherapy for acute leukemia or after allogeneic hematopoietic stem cell transplantation (allo-HSCT) and is associated with high mortality rates. During the last years, routine administration of antimold prophylaxis based on triazole regimens provided a major advance in controlling fungal infections in patients at high risk for IA. However, several studies recently reported azole resistant fungal strains, which are detectable in patients at risk with rapidly increasing frequency. While mutations in the 14α-sterol demethylase (cyp51A) gene have been implicated in mediating azole resistance, in approximately 50% of resistant patient isolates the underlying genetic cause is unknown (van der Linden, Emerging Infectious Diseases, 2015). In view of a rising prevalence of azole resistance in the high risk clinical setting we performed whole genome sequencing (WGS) of azole-resistant cyp51A-wildtype Aspergillus fumigatus (Afu) specimen, the main effector of IA, with the aim to identify novel genetic alterations leading to azole resistance.MethodsAfu clinical strains were isolated from six different patients with IA undergoing intensive chemotherapy for acute leukemia or after allo-HSCT. Phenotypic resistance screening confirmed azole resistance in all samples. Moreover, Sanger sequencing revealed characteristic resistance associated cyp51A mutations ("TR46/Y121F/T289A") in four of the six specimen, while two samples harbored cyp51A wildtype sequences. High molecular weight genomic DNA (gDNA) was isolated using a modified DNeasy Plant Mini Kit protocol (Qiagen). WGS sequencing libraries were prepared utilizing the transposome fragmentation based Nextera XT DNA Library Prep Kit (Illumina) and sequenced on a MiSeq next generation sequencing (NGS) system (Illumina) with V2 sequencing chemistry (2x250bp). Raw paired reads were mapped to the NCBI Af293 (ASM265v1) reference genome using BWA followed by calibration with GATK. Subsequently, genomic variants were identified by GATK Haplotypecaller module and ANNOVAR software was used for functional variant annotation.ResultsWGS of four cyp51A mutated and two cyp51A wildtype samples resulted in an average genomic coverage of 26x (range 21.2x - 30.1x) allowing robust detection of genomic sequence variants. Of note, the presence or absence of cyp51A "TR46/Y121F/T289A" mutational genotype was reliably validated by WGS data using both our variant calling pipeline and manual screening of mapped reads with the IGV browser. In an attempt to screen for novel, previously undocumented candidate genes that are mechanistically involved in azole resistance we first identified all mutations that are exclusively present in the cyp51A wildtype samples and undetectable in the cyp51A mutated cohort. Next, we excluded all variants that have previously been reported as being polymorphic in WGS data from 22 different Afu strains sequenced by the J. Craig Venter Institute. Using this strategy we identified a core candidate cluster of 112 nucleotide variants in 62 genes that were exclusively found in the cyp51A wildtype group and predicted to have an impact on the amino acid sequence of the corresponding translational products. In particular, exemplary identified mutations affected genes coding for glycosyl hydrolase family 31 proteinimplicated in carbohydrate metabolic processes and 3-oxo-5-alpha-steroid 4-dehydrogenase family protein, which is, similar to cyp51A, involved in steroid metabolism.ConclusionThe rapid increase in detection of triazole resistant fungal strains in clinical contexts represents a critical problem, particularly for immunocompromised patients at high risk for IA, and highlights the need to explore the underlying molecular causes. Pending further validation in a larger cohort, our NGS-based approach for sequencing the genomes of azole resistant Afu strains identified several candidate genomic alterations that might pinpoint alternative pathways to acquisition of resistance, independent of the previously described cyp51A mutations. Ultimately, our approach for discovery of previously undescribed resistance pathways in fungal strains might aid in exploration of novel therapeutic targets and identify suitable biomarkers for effective clinical and epidemiological surveillance. DisclosuresBuchheidt:Gilead: Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Pfizer: Other: travel grant, Research Funding, Speakers Bureau; Astellas: Other: travel grant, Speakers Bureau; Merck Sharp & Dohme: Other: travel grant, Speakers Bureau.