Placenta Membranes Research Articles

Expression and localization of the omega-3 fatty acid receptor GPR120 in human term placenta

Fatty acids can function as signaling molecules, acting through receptors in the cytosol or on the cell surface. G-Protein Receptor (GPR)120 is a membrane-bound receptor mediating anti-inflammatory and insulin-sensitizing effects of the omega-3 fatty acid docohexaenoic acid (DHA). GPR120 dysfunction is associated with obesity in humans. Cellular localization of GPR120 and the influence of maternal obesity on GPR120 protein expression in the placenta are unknown. Herein we demonstrate that GPR120 is predominantly expressed in the microvillous membrane (MVM) of human placenta and that the expression level of this receptor in MVM is not altered by maternal body mass index (BMI).

Human placenta-derived neurospheres are susceptible to transformation after extensive in vitro expansion.

IntroductionThe cancer stem cell model links neoplastic cells with normal stem cell biology, but little is known on how normal stem cells are transformed into cancer stem cells.MethodsTo investigate the processes underlying the transformation of normal stem cells we developed in vitro a cancer stem cell model from human amniotic and chorionic placenta membranes. In this model we studied the expression of specific stem cell molecules by flow cytometry, and genes, by real time RT-PCR. Microscopy immunfluorescence was employed to investigate the proliferative and differentiation patterns. Fluorescence microscopy and FACS were employed to investigate the proliferative and differentiation patterns. To evaluate the tumorigenic potential of our model we injected the cells into NOD.CB17-Prkdcscid/NCrHsd mice.ResultsNormal human stem cells from amniotic and chorionic placenta membranes were converted into neural cell lineages, under specific conditions, to form secondary neurospheres with a capacity for self-renewal. After extensive in vitro culture, these cells underwent spontaneous transformations and acquired a neuroblastoma (NB)-like phenotype with an elevated proliferative potential that is comparable to established neuroblastoma cell lines. The ability of these cells to transform their phenotype was evidenced by increased clonogenic ability in vitro; by augmented expression level of certain proliferation- and transformation-related genes (e.g., CCNA2, MYCN, ENPP2, GRIA3, and KIT); by the presence of multinucleated and hyperdiploid cells. We further demonstrated that the transformed phenotype is an NB by measuring the expression of NB-specific markers, disialoganglioside GD2 and N-Myc proteins.ConclusionsWe have developed a cancer stem cell model starting from normal human stem cells derived from amniotic and chorionic placenta membranes. These cells are able to differentiate into neural cell lineages and to undergo spontaneous transformations and acquire an NB-like phenotype.

Mechanism of HLA-G participation in inhibiting lymphocyte proliferation by amniotic mesenchymal stem cells

This study was aimed to investigate the inhibitory mechanism of human amniotic mesenchymal stem cells (HAMSC) on lymphocyte proliferation and to validate the participation of the nonclassic human leukocyte antigen (HLA) class I molecule (HLA-G) in immunosuppressive action of HAMSC. HAMSC were isolated from fetal membranes of human placentas, and were cultured and expanded. The phenotypes of HAMSC were identified by flow cytometry, at same time the HLA-G levels on membrane surface and in cytoplasm were detected by flow cytometry. The soluble HLA-G (sHLA-G) level in HAMSC supernatants was determined by ELISA, MTT assay was used to examine the effect of mixed cultured HAMSC on proliferation of lymphocytes. The results showed that both surface and cytoplasm of HAMSC expressed HLA-G, the average rates of HLA-G expression on surface and in cytoplasm were (16.75 ± 3.871)% and (39.14 ± 4.274)%, respectively. The sHLA-G level in cell culture supernatant was 5.2 ng/ml. After HAMSC and culture supernatants were added in the MLR, the inhibitory rate on lymphocyte proliferation increased obviously, meanwhile the inhibitory rate on lymphocyte proliferation decreased when the HLA-G antibody was added in MLR. It is concluded that the surface and cytoplasm of HAMSC express HAL-G, at same time HAMSC secrete the HLA-G to supernatants of culture. The HLA-G is one of critical factors inhibiting immuno-function of HAMSC. This study contributes to improve the clinical therapeutic trails for using the HAMSC to prevent rejection.

The effect of honey-impregnated human placenta membrane on burn wound healing in rat

Burn is a severe form of thermal injury. Placenta membrane has been introduced as a rapid physiological wound healer; honey has been known for its antibacterial activity and silver sulfadiazine (SSD) as one of the most commonly used topical treatment for partial thickness burns. Present study has been performed to compare the placenta membrane, honey-impregnated placenta membrane, and SSD-impregnated placenta membrane in the healing of burn wounds in rat. For this study, 64 male Wistar rats were randomly divided into four groups: control, placenta membrane, honey-impregnated placenta membrane, and SSD-impregnated placenta membrane groups. For all animals, under the general anesthesia, deep partial thickness burn was created. At the end of the first, second, third and fourth weeks of treatments, biopsies were taken from burn and adjacent normal areas. In the prepared slides, the number of polymorphonuclear (PMN) leukocytes, vascular channels, and fibroblasts were examined. In the third group treated by honey-impregnated placenta membranes, PMN leukocyte count was significantly lower than that of the other three groups (P < 0.05). The amount of granulation tissue formation and the number of fibroblasts in this group were greater than those of the other three groups (P < 0.05). The organization of granulation tissue in the abovementioned group was significantly better (P < 0.05). The reepithelialization, containing horny layer, in the second and third groups was completely formed. The honey-impregnated placenta membrane was an ideal tissue for temporary wound coverage and repair surface injuries after partial thickness burns.

The Osteogenic Capacity of Human Amniotic Membrane Mesenchymal Stem Cell (hAMSC) and Potential for Application in Maxillofacial Bone Reconstruction &amp;lt;i&amp;gt;in Vitro&amp;lt;/i&amp;gt; Study

Amniotic membrane of human placenta is a source of abundant mesenchymal stem cell (hAMSC) which makes it a potential source of allogeneic multipotent cell for bone healing. However, much has to be explored about its isolation procedure and the osteogenic differentiation potential. The aims of this study are to establish the procurement procedure of human amniotic membrane, the isolation and culture of hAMSC, the MSC phenotypic characterization, and the in vitro osteogenic differentiation of hAMSC. Results of the study are as follows. The quality of human amniotic membrane would be best if procured from Caesarean operation under highly aseptic condition to avoid fungal and bacterial contamination on the culture. Isolation procedure using modified Soncini protocol yielded large amount of MSC with high proliferative capacity in culture medium. Characterization of hAMSC showed that the majority of the target cells exhibited specific MSC markers (CD105 and CD90) with a small number of these cells expressing CD45, the marker of hematopoeitic cells. The in vitro osteogenic differentiation of hAMSC followed by Alizarin Red staining showed that osteoblastic differentiation was detected in a significantly high number of cells. This study concludes that hAMSCs isolated from human amniotic membrane have the capacity for in vitro osteogenesis which makes them be one of the potential allogeneic stem cells for application in maxillofacial bone reconstruction.

Feasibility and potential of in utero foetal membrane-derived cell transplantation

Cells isolated from foetal membranes of human term placenta display multiple properties, including some features of stem/progenitor cells, together with immunomodulatory actions and the ability to secrete bioactive soluble factors. Whilst such properties support the potential applicability of these cells in transplantation settings aimed at regenerating/repairing tissues in adults, theoretically, using these cells in prenatal treatment strategies may also be achievable. To assess the feasibility of a foetal membrane-derived cell-based therapeutic treatment during foetal development, we firstly addressed the question of whether in utero transplantation using these cells was possible. To this end, we assessed postnatal microchimerism after transplantation of amniotic membrane-derived cells (a mixture of both mesenchymal stromal/stem cells and epithelial cells) in foetal sheep. Transplantation was performed with or without human umbilical cord blood mononuclear cells and chorionic membrane-derived mesenchymal stromal/stem cells, and was followed by a postnatal booster cell injection. Lambs were euthanized 2-4 months postnatally and their organs/tissues were analysed for microchimerism through detection of human DNA. Human DNA was found in almost all tissues of all of the lambs, with the seemingly random appearance of human cells in some of the analysed tissues suggesting long-term human microchimerism and donor cell migration after in utero/postnatal booster xenotransplation. Differences in microchimerism tissue distribution between animals transplanted with different cell types are discussed. This pilot study adds to ongoing efforts by different investigators to explore the potential of in utero cellular transplantation, and warrants further investigation of using foetal membrane-derived cells for prenatal cell therapies.

High Risk of Embryo-Fetal Toxicity: Placental Transfer of T-2 Toxin and Its Major Metabolite HT-2 Toxin in BeWo Cells

Though T-2 toxin is the most harmful mycotoxin to the fetuses, it remains unclear whether T-2 toxin and its major metabolite, HT-2 toxin, could pass the placenta into the fetus and which kind of placental transport is involved in the passage. To illustrate their placenta transfer mechanism, the uptake and efflux of T-2 and HT-2 toxins across apical membranes of placenta with BeWo cells as a model were studied at different temperatures, pHs, and in the presence of transporter inhibitors with a developed liquid chromatography-tandem mass spectrometry to determine the amount of toxins in both fetal and maternal sites. Higher unidirectional transport of T-2 toxin was observed in the apical-to-basolateral direction than basolateral-to-apical one, whereas HT-2 toxin exhibited similar transport rate from the 2 directions. The main ATP-binding cassette transporters had no effect on the efflux of 2 toxins. Initial uptake of T-2 toxin was sodium dependent and saturable, and the apical uptake was temperature dependent and enhanced under acidic condition. The apical uptake of T-2 toxin was inhibited by metabolic inhibitors and the organic anion and organic cation transporter inhibitors. These results suggested that an active transport mechanism was responsible for the uptake of T-2 toxin, whereas passive diffusion was the principal mechanism for HT-2 toxin transport in the placenta. Taken together, these data characterized the placental transfer of T-2 and HT-2 toxins. The present study offered new ways of reducing the risks of T-2 and HT-2 toxins to both mother and fetuses.

Mathematical models to predict exchange and facilitated transport across the microvillous plasma membrane (MVM) of the human placenta

Introduction: The Na+-independent uptake of serine into microvillous plasma membrane (MVM) vesicles is thought to be mediated by the exchange transporter LAT2. Exchangers are predicted to transport one amino acid (aa) in exchange for another in an obligatory 1:1 manner. However, the observation that serine is transported across MVM under zero-trans conditions, in the absence of internal exchangeable aa, questions whether exchange is indeed obligatory. We revisit the exchange-for-nothing phenomenon by developing mathematical models to examine obligate versus non-obligate exchange, by introducing a hypothesised facilitated component. Methods: Mathematical models were developed based on carrier-mediated transport via a) obligatory exchange, or b) non-obligatory exchange, corresponding to facilitative diffusion. Models were tested by measuring uptake of 7.5 �M 14C-serine into MVM vesicles isolated from normal term placentas, preloaded with either 0 �M or 250 �M (equal to extravesicular serine concentration) or 1 mM serine (outwardly directed substrate gradient to drive facilitated transport). Results: Trans-stimulation of tracer uptake was observed with increasing intra-vesicular serine concentration indicating an exchange component. However, if exchange were obligatory, the model predicted that equilibrium values would be reflected by ratios of intra- and extra-vesicular concentrations, which was not observed. Crucially, the model predicted that for a facilitated transport component, an outwardly directed aa gradient would cause an overshoot of tracer uptake, which was indeed observed.Conclusion: Models were consistent with serine uptake into MVM vesicles by non-obligatory exchange, or exchange together with an as yet uncharacterised facilitated transporter in parallel. This study emphasizes the utility of mathematical modelling in developing an improved quantitative understanding of aa transporter mechanisms. The physiological role for a facilitated transport component on the MVM is at present unclear and warrants further investigation.

A Study on the Risk Profile of Postnatal Women with Low Birth Weight Babies

A descriptive retrospective cross -sectional study using existing data from a one-year birth registers of 6928 postnatal women was done at District McGann hospital, Shimoga, India. The objective was to study the risk profile of the mothers who delivered low birth weight (LBW) babies and their contribution to the problem. Mothers without formal education were 4 times more likely to give birth to LBW neonates than those who had attained higher education. There was a linear decrease in low birth weights of newborns as fraternal educational level increased. There was no statistically significant difference among parents' occupations regarding LBW of their newborns. Unmarried mothers were more likely to give birth to LBW babies as compared to their married counterparts and the difference was statistically significant. Hypertension, pre-eclampsia and eclampsia disease complex had the highest prevalence and population attributable risk of low birth weight. Other complications and diseases which contributed to high prevalence of LBW included anaemia, thromboembolic diseases, tuberculosis, malaria and other infections. Prevalence of LBW was high in women with premature rupture of membrane, placenta praevia and abruption of placenta. LBW was strongly associated with gestational age below 37 weeks and also with malnutrition. There was a statistical significant difference between the proportions of LBW infants from mothers who did not receive antenatal care and those who attended for the services. There is need of increasing promotion of reproductive health services in relation to safe motherhood at community level in order to reduce risk factors of LBW.

Expression of the epithelial sodium channel sensitive to amiloride (ENaC) in normal and preeclamptic human placenta

Aldosterone modulates the activity of the epithelial sodium channel (ENaC) through changes in its trafficking, membrane expression and open probability. Plasma levels of aldosterone are decreased in preeclampsia. Herein we postulated that if aldosterone regulates ENaC expression then its expression should be decreased in preeclampsia. We found a diminished expression of the three subunits of the ENaC in the membranes of preeclamptic placentas in comparison with the normal ones. Although the role of ENaC in placental tissues is poorly understood, these differences may have consequences for the ion transport involved in the pathophysiology of preeclampsia.

Neuroprotective Treatment of Cerebral Infarction: An Experimental Study

ABSTRACTWe investigated the effect of the amniotic-derived peptide Plaferon-LB on cerebral tissue damage during photochemical insults in rats. Plaferon-LB (US patent number: 20070123467 A1) was extracted from the amniochorionic membrane of a human placenta and showed a relatively strong antihypoxic effect compared to other interferon. Thrombotic infarction was induced by photochemical illumination after intravenous injection of Rose Bengal. The infarct volume, cerebral tissue oxygen tension, cerebral blood flow, and capillary damage were measured in the following groups: untreated control rats, Plaferon-LB-alone rats, insult-alone rats, and insult in Plaferon-LB pretreated rats. The technique of electron paramagnetic resonance (EPR) spectroscopy was used to study free-radical metabolites in the blood and brain tissue ex vivo. Plaferon-LB alone had no effect on systemic blood pressure, cerebral blood flow, and reactive metabolites in the brains of intact animals. In the insult-alone group, a focal hemorrhage was observed in the ischemic area. The cerebral blood flow and tissue oxygen pressure declined to zero within an hour and remained at this level throughout the insult. The treatment with Plaferon-LB 0.5 hr before illumination resulted in a significant reduction of the median infarct size in the insult-alone group. The total length and percentage ratio of thrombotic vessels were significantly diminished in the infarct area. The intensity of Fe2+, Mn2+-, Mo5+-xanthinoxidase-containing complexes, and nitric oxide EPR signals was decreased, and the electron transport in the mitochondria was normalized. The results indicate a significant beneficial effect of Plaferon-LB on cerebral infarct, which is likely due to its antioxidative properties.

Amniotic membrane‐derived cells inhibit proliferation of cancer cell lines by inducing cell cycle arrest

Cells derived from the amniotic foetal membrane of human term placenta have drawn particular attention mainly for their plasticity and immunological properties, which render them interesting for stem-cell research and cell-based therapeutic applications. In particular, we have previously demonstrated that amniotic mesenchymal tissue cells (AMTC) inhibit lymphocyte proliferation in vitro and suppress the generation and maturation of monocyte-derived dendritic cells. Here, we show that AMTC also significantly reduce the proliferation of cancer cell lines of haematopoietic and non-haematopoietic origin, in both cell–cell contact and transwell co-cultures, therefore suggesting the involvement of yet-unknown inhibitory soluble factor(s) in this ‘cell growth restraint’. Importantly, we provide evidence that the anti-proliferative effect of AMTC is associated with induction of cell cycle arrest in G0/G1 phase. Gene expression analyses demonstrate that AMTC can down-regulate cancer cells' mRNA expression of genes associated with cell cycle progression, such as cyclins (cyclin D2, cyclin E1, cyclin H) and cyclin-dependent kinase (CDK4, CDK6 and CDK2), whilst they up-regulate cell cycle negative regulator such as p15 and p21, consistent with a block in G0/G1 phase with no progression to S phase. Taken together, these findings warrant further studies to investigate the applicability of these cells for controlling cancer cell proliferation in vivo.

Cadmium inhibits ABCG2 transporter function in BeWo choriocarcinoma cells and MCF-7 cells overexpressing ABCG2

Heavy metals such as cadmium, lead and methylmercury are known to be neurotoxic to developing fetus. ABCG2 which is an efflux transporter located in the maternal facing membranes of human placenta protects fetus from xenobiotics by transferring compounds from syncytiotrophoblast to maternal circulation. The aim of this study was to clarify whether heavy metal compounds (CdCl2, PbCl2 and MeHgCl) affect the expression and function of ABCG2 transporter in human placental BeWo choriocarcinoma cells. The expression of ABCG2 was determined by immunoblotting and RT-PCR. The functional activity of ABCG2 was evaluated by measuring the efflux of two known ABCG2 substrates: fluorescent mitoxantrone and 14C-labeled food carcinogen PhIP. According to MTT assay all compounds were cytotoxic as expected (MeHgCl > CdCl2 > PbCl2). CdCl2 inhibited the efflux of mitoxantrone and 14C-PhIP suggesting inhibition of ABCG2 transporter function. PbCl2 had no effect on mitoxantrone efflux. Because of high toxicity, the inhibitory potency of MeHgCl was not tested. According to protein data these heavy metals did not affect ABCG2 transporter protein expression. Also, the expression of ABCC1, ABCC2 or ABCG2 mRNA were not affected by heavy metals. In conclusion, although the studied metal salts did not affect mRNA or protein expression of ABCG2, CdCl2 inhibited its function. Further studies to evaluate whether this leads to elevated placental transfer of ABCG2 substrates are needed.

Preeclampsia, Placenta, Oxidative Stress, and PMCA

Objective: The aim of this study is to summarize the reported evidence on the possible relationship between preeclampsia, placenta, oxidative stress and plasma membrane Ca-ATPase (PMCA) activity, responsible for fine control of intracellular calcium concentration. Methods: Literature search was conducted in MEDLINE/PubMed and several unpublished results from our laboratory were included. Results: Lipid peroxidation in placental and red blood cell plasma membranes during preeclampsia and a concomitant diminution of their PMCA activity are described. Conclusions: Uteroplacental hypoperfusion raises lipid peroxidation by-products in the blood plasma that could alter structure and functionality of the cell membranes of the endothelium and several tissues.

Scavenger receptor for hemoglobin in preterm prelabor rupture of membranes pregnancies complicated by histological chorioamnionitis

Objective: We sought to evaluate the distribution of scavenger receptor for hemoglobin positive (CD163+) cells in the placenta and fetal membranes from pregnancies complicated by preterm prelabor rupture of membranes with respect to the presence and absence of histological chorioamnionitis. Methods: Sixty-two women with singleton pregnancies with a gestational age between 24+0 and 36+6 weeks were included in a prospective cohort study. CD163 was evaluated by immunohistochemistry in the placenta and fetal membranes. The number of CD163+ cells and neutrophils was counted in the following locations: fetal membranes’ amnion, chorion, and decidua, as well as the placenta’s amnion, chorionic plate, subchorionic fibrin, stem villi, terminal villi, and decidua. Results: CD163+ cells were found in all compartments of the placenta and the fetal membranes regardless of the inflammatory status. A positive correlation between the number of CD163+ cells and neutrophils in the subchorionic fibrin and the chorionic plate was found. The number of CD163+ cells was higher in the placental subchorionic fibrin and chorionic plate when histological chorioamnionitis was present. Conclusion: The presence of histological chorioamnionitis affected the number of CD163+ cells in the placental chorionic plate and in the subchorionic fibrin but not in the fetal membranes.

Differential mesengenic potential and expression of stem cell‐fate modulators in mesenchymal stromal cells from human‐term placenta and bone marrow

Placenta has attracted increasing attention over the past decade as a stem cell source for regenerative medicine. In particular, the amniochorionic membrane has been shown to harbor populations of mesenchymal stromal cells (MSCs). In this study, we have characterized ex vivo expanded MSCs from the human amniotic (hAMSCs) and chorionic (hCMSCs) membranes of human full-term placentas and adult bone marrow (hBMSCs). Our results show that hAMSCs, hCMSCs, and hBMSCs express typical mesenchymal (CD73, CD90, CD105, CD44, CD146, CD166) and pluripotent (Oct-4, Sox2, Nanog, Lin28, and Klf4) markers but not hematopoietic markers (CD45, CD34). Ex vivo expanded hAMSCs were found to be of fetal origin, while hCMSCs cultures contained only maternal cells. Cell proliferation was significantly higher in hCMSCs, compared to hAMSCs and hBMSCs. Integrin profiling revealed marked differences in the expression of α subunits between the three cell sources. Cadherin receptors were consistently expressed on a subset of progenitors (ranging from 1% to 60%), while N-CAM (CD56) was only expressed in hAMSCs and hCMSCs but not in hBMSCs. When induced to differentiate, hAMSCs and hCMSCs displayed strong chondrogenic and osteogenic differentiation potential but very limited capacity for adipogenic conversion. In contrast, hBMSCs showed strong differentiation potential along the three lineages. These results illustrate how MSCs from different ontological sources display differential expression of cell-fate mediators and mesodermal differentiation capacity.

Lack of association between two polymorphisms in the corticotropin-releasing hormone gene promoter and preterm birth in a Hispanic population

The molecular mechanisms involved in the initiation of preterm labor are still unknown. Several studies have shown that corticotropin-releasing hormone (CRH) is one of the main molecules related to the onset of preterm labor. CRH is a hypothalamic hormone that is also synthesized by the placenta and fetal membranes during the third trimester of pregnancy. Changes in CRH concentration in late pregnancy, both term and preterm, seem to depend on ethnicity, since Hispanic women have a higher plasma concentration of this hormone at 30 weeks of pregnancy compared with black or nonHispanic women. Furthermore, concentrations of CRH in white women with preterm labor are higher compared with black women with preterm labor [1]. These ethnic variations can be partly explained by differences in genetic background, such as the presence of polymorphisms in the CRH gene. The CRH gene promoter has 4 polymorphisms that have been designated: T-3371G, C-3531G, T-2353C, and T-684C. Three of these polymorphisms (C-3531G, T-2353C, T-684C) cosegregated completely resulting in 2 alleles: A1 and A2. Including the fourth polymorphism in the CRH promoter (T-3371G), the combined alleles have been designated as A1B1, A1B2, A2B1, and A2B2 [2]. The association of these polymorphisms with diseases and their molecular and biological functions have been reported. Populationbased studies have shown that the A2B1 compound allele is protective for the development of rheumatoid arthritis; meanwhile, the A1B1 allele is associated with the development of rheumatoid arthritis [3]. Moreover, in vitro studies using cells transiently transfected with the combined haplotype of the CRH gene promoter coupled to a reporter gene have shown differences in transcriptional activity [4]. It was hypothesized that polymorphisms in the CRH promoter influence the expression of this hormone in pregnant women, and thus might play a role in the induction of preterm birth. The aim of the present studywas to assess the association of CRH polymorphisms with spontaneous preterm birth in a Hispanic population. Patients included in the study were Hispanic women who were receiving obstetric care at the UMAE HGO4 “Luis Castelazo Ayala”, Mexico City, Mexico, between September 2006 and December 2007. The Institutional Review Board and the research ethics committee approved the protocol for sample collection. All study participants gave written informed consent before sample collection. All included pregnancies in this study were singleton live births. Gestational age was determined by last menstrual period and corroborated by ultrasound dating. The control group (n=55) comprised women with normal term deliveries without complications related to pregnancy. The case group comprised women with preterm birth (n=65), defined as preterm delivery preceded by spontaneous labor. Genomic DNA was extracted from placental samples using the QIAamp DNAMini Kit (Qiagen, Valencia, CA, USA), according to themanufacturer's instructions. Polymorphisms in the CRH promoter were analyzed by PCR-RFLP technique, as previously described [5]. Primers used to analyze the CRH promoter polymorphisms in this study were: CRHA: forward 5′ GCTGTTCTTGTGATAGTAAATA 3′, reverse 5′ CCC CAGAGGAAGAGAAGC 3′; CRHB: forward 5′ TGAAGGTACAAGGTGATACAAGTG ACAA 3′, reverse 5′ ACACAAACTGAGGTGAAAAGATGAA 3′. Statistical analysis was performed with Stata SE, version 11.0 (Stata Corp., College Station, TX, USA). The haplotype analysis was performed using the web tool SNPstats. Pb0.05 was considered statistically significant. The demographic characteristics of the 2 groups are shown in Table 1. As expected, the estimated gestational age on admission and neonatal birth weight were significantly different between the preterm and term groups. Distribution of both polymorphisms in the population was consistent with Hardy-Weinberg equilibrium. The frequencies of CRH-A and -B were in accordance with previously published data in other populations. No differences in genotype and allele frequencies for CRH-A and -B were observed between the 2 groups (Table 2). Furthermore, haplotype analysis for both polymorphisms did not reveal significant differences between preterm and term groups (data not shown). This study compared the presence of 2 polymorphisms located in the promoter of the CRH gene in a Hispanic population that had normal term or preterm delivery. The results showed that there was no association between the presence of these polymorphisms and spontaneous preterm birth in this population. However, study of the

Gestational weight loss has adverse effects on placental development

Objective: To clarify whether mothers with gestational weight loss (GWL) were likely to have adverse effects on the placenta. Study design: Subjects who delivered viable singleton infants after 24 weeks of gestation were enrolled. A retrospective analysis to evaluate cases of GWL in association with the findings of the placenta and amniotic membrane after delivery was conducted. After consideration of confounders, a case–control study with matched pairs (1:2) was performed. Results: Of all subjects (5551 cases), 83 cases (1.5%) with GWL were found. Since the pre-pregnancy maternal body mass index (BMI) was significantly higher in cases, 166 controls with a matched BMI were selected. The neonatal birth weights, placental weights and the umbilical cord length in cases were significantly smaller than in controls (p < 0.05). Preterm delivery and small for gestational age (SGA) infants were more frequently observed in cases compared with controls [odds ratio (OR) 6.3; 95% confidence interval (CI) 3.3, 12.1, OR 4.3; 95% CI 1.9, 9.9]. pPROM were observed in 10.8% of the cases and 1.8% of the control (OR 6.6; 95% CI 1.7, 25.1). However, the frequencies of chorioamnionitis and the cervical length at second trimester were not different between the two groups. Conclusion: GWL is associated with SGA, small placenta, short umbilical cord length, preterm delivery and pPROM.

Analysis of tight junctions in placentas affected by chorioamnionitis: in vivo and in vitro analysis

The human placenta and fetal membranes provide a barrier regulating the transfer of materials between the mother and the developing fetus throughout gestation. Chorioamnionitis is an important risk factor for preterm delivery that is associated with high perinatal morbidity and mortality. Chorioamnionitis is the term applied to infections of the placenta and membranes resulting in high concentrations of IL- 1beta, IL-6, IL-8 and TGF-beta in the amniotic fluid (D’Alquen et al., 2005). With progression of inflammation, immune cells penetrate blood vessels and infiltrate the umbilical cord, resulting in funisitis (Romero and Mazor, 1988). In normal conditions the two important physical entities in endothelial/epithelial paracellular clefts are adherens junctions and tight junctions. Tight junction governs the paracellular movement of water, solutes and immune cells, through the intercellular space creating a boundary between the apical and basolateral sides of cellular barriers (Gruenheid and Finlay, 2003). We have evaluated the localization of tight junctions studying the Zonula Occludens-1 (ZO-1) and Occludin expressions as well as the localization of adherent junctions, testing the expression of VE-cadherin and beta-catenin in placentas from normal gestations, from preterm idiopathic deliveries and from chorioamnionitis by immunohistochemistry. In addition, we have evaluated the mRNAs by real time PCR, the protein levels of these molecules by Western blot analysis in placental tissues, and to better clarify the action of some cytokines on occludin we performed in vitro analysis of HUVEC cultures. Our more striking result is the decrease of occludin expression in placentas from chorioamnionitis and an evident action of the cytokines on this molecule.

Amniotic Stem Cells: Potential in Regenerative Medicine

Amniotic Stem Cells: Potential in Regenerative Medicine