Pigeon Pea Seedlings Research Articles

SCREEN-HOUSE REARING OF THE CASHEW MIRID HELOPELTIS SCHOUTEDENI REUTER (HETEROPTERA: MIRIDAE) ON THREE VEGETABLES FOR ITS MANAGEMENT ON CASHEW

Helopeltis schoutedeni (Heteroptera: Miridae) is a significant cashew and cotton pest in East and West Africa. To date, viable laboratory rearing and maintenance protocols have been lacking to facilitate biological investigations on the bug. This drawback has largely hindered its successful management. The potential of three vegetable intercrops, cucumber fruit (Cucumis sativus L.), fresh French bean (Phaseolus vulgaris L.) pods, and pigeon pea (Cajanus cajan L.) were the suitable host plants for establishing laboratory colonies of H. schoutedeni. The developmental time, survival, oviposition, and feeding behaviors of H. schoutedeni under screen-house conditions were monitored. Newly hatched nymphs reared on these substrates successfully developed into adults with varying average developmental times of 25.72, 25.81, and 33.26 days for French beans, pigeon peas, and cucumbers, respectively. Similarly, survival varied significantly on the different plants, with the highest survival occurring on pigeon pea seedlings (97-100%) and the lowest on cucumber (48-69%; P < 0.05). Significantly more feeding lesions were recorded on pigeon peas (349.6 ± 82.56) than on cucumbers (52.6 ± 13.62) in the feeding preference test. The proportion of adult feeding during the scotophase was significantly higher than in the photophase (Pigeon pea seedling: t = -3.545; df = 18; P < 0.05, French beans: t = -2.684; df = 28; P < 0.05 and Cucumber t = 3.713; df = 18; P < 0.05). Oviposition was only recorded on pigeon pea seedlings. Present findings demonstrate the potential for using specific vegetables as suitable host plants for H. schoutedeni under confined and open field settings to aid future research studies toward effective management.. KEYWORDS :Cashew, Helopletis Schoutedeni, Legumes, Pest Management, Rearing

Harnessing the power of native biocontrol agents against wilt disease of Pigeonpea incited by Fusarium udum

Fusarium wilt, caused by (Fusarium udum Butler), is a significant threat to pigeonpea crops worldwide, leading to substantial yield losses. Traditional approaches like fungicides and resistant cultivars are not practical due to the persistent and evolving nature of the pathogen. Therefore, native biocontrol agents are considered to be more sustainable solution, as they adapt well to local soil and climatic conditions. In this study, five isolates of F. udum infecting pigeonpea were isolated from various cultivars and characterized morphologically and molecularly. The isolate from the ICP 8858 cultivar displayed the highest virulence of 90%. Besides, 100 endophytic bacteria, 100 rhizosphere bacteria and three Trichoderma spp. were isolated and tested against F. udum isolated from ICP 8858 under in vitro conditions. Out of the 200 bacteria tested, nine showed highest inhibition, including Rb-4 (Bacillus sp.), Rb-11 (B. subtilis), Rb-14 (B. megaterium), Rb-18 (B. subtilis), Rb-19 (B. velezensis), Eb-8 (Bacillus sp.), Eb-11 (B. subtilis), Eb-13 (P. aeruginosa), and Eb-21 (P. aeruginosa). Similarly, Trichoderma spp. were identified as T. harzianum, T. asperellum and Trichoderma sp. Notably, Rb-18 (B. subtilis) and Eb-21 (P. aeruginosa) exhibited promising characteristics such as the production of hydrogen cyanide (HCN), cellulase, siderophores, ammonia and nutrient solubilization. Furthermore, treating pigeonpea seedlings with these beneficial microorganisms led to increased levels of key enzymes (POD, PPO, and PAL) associated with resistance to Fusarium wilt, compared to untreated controls. In field trials conducted for four seasons, the application of these potential biocontrol agents as seed treatments on the susceptible ICP2376 cultivar led to the lowest disease incidence. Specifically, treatments T2 (33.33) (P. aeruginosa) and T3 (35.41) (T. harzianium) exhibited the lowest disease incidence, followed by T6 (36.5) (Carbendizim), T1 (36.66) (B. subtilis), T4 (52.91) (T. asperellum) and T5 (53.33) (Trichoderma sp.). Results of this study revealed that, P. aeruginosa (Eb-21), B. subtilis (Rb-18) and T. harzianum can be used for plant growth promotion and management of Fusarium wilt of pigeonpea.

Induction of antioxidant defenses by a low-dose cadmium priming alleviates heat stress in pigeon pea

Global warming has a devastating effect on the growth and productivity of plants. Pigeon pea, the second most important legume crop with high nutritional value, is at high risk due to high temperature exposure. Priming is an innovative agronomical application that can be used as a strategy to minimize the detrimental effects of any kind of stresses. In this study, we investigated how low dose of cadmium priming alleviates heat stress (HS) in pigeon pea seedlings. The results demonstrated that low dose of cadmium priming induced the expression of antioxidant systems and maintain a redox homeostasis. An enhanced level of antioxidant glutathione, and antioxidative enzymes (SOD, APX, and GR) were observed in Cd+HS leaf (40 μM Cd priming followed by exposure to HS, 42°C) as compared to the HS leaf. Moreover, a reduction in hydrogen peroxide (H2O2) and oxidized glutathione (GSSG) content was also noticed in Cd+HS leaf. The GSH/GSSG ratio, which was indicative of the redox state in the plant system, was also high in Cd+HS leaf as compared to HS leaf. Thus, the priming of pigeon pea seeds with low dose Cd alleviates HS by elevating antioxidant defenses, ultimately protecting pigeon pea seedlings against HS.

GREEN SYNTHESIS OF ZINC OXIDE NANOPARTICLES USING SCHREBERA SWIETENIOIDES ROXB., AQUEOUS LEAF EXTRACT AND INVESTIGATION OF ITS EFFECT ON SEED GERMINATION AND PLANT GROWTH ON PIGEON PEA (CAJANUS CAJAN LINN.)

Objective: The present work intended to green and eco-friendly synthesis of Zinc oxide (ZnO) nano particles (NPs) using aqueous leaf extract of Schrebera swietenioides and the synthesised NPs were applied for enhancement of seed germination and plant growth in pigeon pea (Cajanus cajan Linn.). Methods: The Zinc acetate was utilised as metal source and metal was reduced using aqueous leaf extract of S. swietenioides as green reducing agent. The synthesised NPs were characterized using various techniques such as SEM-EDS, TEM, XRD, FT-IR and UV-visible spectrophotometer. The seed germination study as well as plant growth promotion activity, was performed on pigeon pea seeds. Results: The result achieved in characterization of NPs confirms that he NPs were hexagonal wurtzite form having a spherical shape with irregular surfaces. The average size was found to be 68 nm with the metal composition of 73.7 %. The NPs were studied for seed germination and growth promotion activity on pigeon pea seeds and the mean germination time was observed to be 38.60±0.56, 28.53±0.59 and 37.53±0.40 h whereas the final germination percentage was found as 91.33±0.58, 98.00±1.00, and 92.67±1.15 h for control, NPs treated and zinc acetate treated seeds respectively. The NPs treated plants grow more rapidly than the untreated as well as Zn acetate-treated pigeon pea plants. The pigeon pea seeds treated with ZnO NPs shows the high activity of enzyme activities such as amylases, protease, catalase than the untreated as well as Zn acetate treated seeds. Conclusion: The aqueous leaf extract of S. swietenioides mediated ZnO NPs can augment the growth of pigeon pea seedlings, and the NPs treatment shows a stimulatory effect on the enzymes associated with the growth of seedlings.

Differential in vitro morphology exhibited by pigeonpea seedlings in response to plant growth regulators

Differential in vitro morphology exhibited by pigeonpea seedlings in response to plant growth regulators

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Biological control of Fusarium wilt and growth promotion in pigeon pea (Cajanus cajan) by antagonistic rhizobacteria, displaying multiple modes of pathogen inhibition

Fusarium udum is one of the most important pathogens impacting the production of pigeon pea (Cajanus cajan) legume. Legume growers depend heavily on pesticides; however, toxicity danger to farmers, consumers, non-target organisms as well as environmental health cause huge concern. Besides, the rise of fungicide resistance is problematic. The objectives of this study were to decipher the multiple mechanisms of biological control in previously identified two promising rhizobacteria (Pseudomonas sp. NS 1 and Bacillus sp. NS 22) in vitro and evaluate their disease suppression and plant growth promotion ability in pigeon pea in vivo. These rhizobacteria inhibited F. udum mycelia growth and biomass in vitro and reduced wilt disease severity in plants grown in Fusarium-infested soil in controlled environmental conditions. Fungicidal action of these rhizobacteria was due to the production of numerous biocidal compounds including different antifungal metabolites, chitinolytic (endochitinase, exochitinase, chitobiase) and other cell wall degrading lytic enzymes (proteinase, cellulose, amylase, pectinase, lipase), siderophores, and antifungal volatile compounds such as ammonia and cyanide. In planta assay, these rhizobacteria made the plant more resistant to fungal attacks through the induction of systemic defense in host tissue by improving the status of different defense enzymes (phenylalanine ammonia lyase, polyphenol oxidase, and peroxidase) and phenolics. Furthermore, these two bacteria significantly reduced disease severity, root mortality, and at the same time, promoted shoot and root elongation in pigeon pea seedlings as compared to the absolute, pathogen, and chemical control. In nutshell, Pseudomonas sp. NS 1 and Bacillus sp. NS 22 displayed the potential as biofungicides and biofertilizers to prevent F. udum induced disease incidence and promote plant growth in an integrative disease and nutrient management approach of sustainable agriculture practices.

Epidemiological Factors Influencing the Development of Pigeonpea Sterility Mosaic Virus Disease in Pigeonpea

Background: In a region of Karnataka, India with a varied type climate PPSMV infection on pigeonpea occurs in a severe form and considered as green plague and one of the most devastating diseases as it appear in severe form resulting in reduction of 100% yield loss transmitted by vector eriophyid mite Aceriacajani Channabasavanna. However, not much systematic and strategic research work being carried out on epidemiology. In spite of various control measures, Sterility Mosaic Disease has continued to be major constraint in pigeonpea production. A lot of variation exists among the genetic background of different varieties in different regions. These variations render it difficult to evolve a common management strategy to control SMD epidemics. Therefore, it is necessary to know the severity of disease and factors associated with disease development which helps in devising suitable management practices. Methods: To study the influence of sowing dates on SMD and vector population under field conditions. A total of twelve sets of sowings were made at different time interval starting from first week of January 2012 to December, 2012. The SMD disease incidence and mite population were recorded in each treatment at fifteen days interval. Under artificial environment, pigeonpea seedlings of variety ICP8863 were raised. Inoculation of virus was done at different stage of plant growth viz., 15, 30, 45, 60, 75, 90 days after sowing. The observation on terminal disease incidence was recorded at 90 DAS to study the impact of host age on SMD. The eight pigeonpea varieties were sown near the SMD infected plot so as to facilitate the movement of vector population under natural conditions to study the reaction of pigeonpea varieties to SMD. Naturally grown weeds present in and around the sterility mosaic screening nursery were collected at weekly interval to see the presence of mites. In a glass house experiment, twenty-three cultivated species of economic importance and three Nicotiana species were sown three replications to see the alternate host for the virus. Results: The fluctuation in disease incidence and mite population was recorded throughout the year and early stage of crop growth recorded less disease incidence with lower mite population and gradual increase was recorded at later stage of crop growth period. The maximum disease incidence and mite population was recorded in crop sown during month of June and July where mean temperature was 24 to 26oC, RH 67 to 71% and rainfall of 2.13mm. The disease incidence recorded at different months of sowing had a significant positive correlation with mite population. Pigeonpea plants inoculated up to age of 30 days showed complete sterility with 100% disease incidence. The Resistant genotypes recorded less per cent disease incidence and symptom development at 60DAS. Whereas susceptible variety recorded maximum diseases incidence at early stage of crop growth and showed complete sterility. PPSMV and its vector survived on the ratooned pigeonpea plants and its wild relatives Atylosiascaraboeides during off season.

Intercropping Transplanted Pigeon Pea With Finger Millet: Arbuscular Mycorrhizal Fungi and Plant Growth Promoting Rhizobacteria Boost Yield While Reducing Fertilizer Input

Pigeon pea (Cajanus cajan) and finger millet (Eleusine coracana) are staple food crops for millions of the rural population in Asia and Africa. We tested, in field trials over three consecutive seasons at two sites in India, an intercropping and biofertilization scheme to boost their yields under low-input conditions. Pigeon pea seedlings were raised during the dry season and transplanted row-wise into fields of finger millet, and arbuscular mycorrhizal fungi (AMF) and plant growth-promoting rhizobacteria (Pseudomonas) were added alone or in combination to both pigeon pea and finger millet. Our major findings are (i) effects of the biofertilizers were particularly pronounced at the site of low fertility; (ii) dual inoculation of AMF+PGPR to finger millet and pigeon pea crops showed increased grain yields more effectively than single inoculation; (iii) the combined grain yields of finger millet and pigeon pea in intercropping increased up to +128% due to the biofertilizer application; (iv) compared to direct sowing, the transplanting system of pigeon pea increased their average grain yield up to 267% across site, and the yield gains due to biofertilization and the transplanting system were additive. These technologies thus offer a tool box for sustainable yield improvement of pigeon pea and finger millet.

Post-Rainy Season Pigeonpea Holds Promise for the Diversification of Cropping Systems

The temporal and spatial intensity of rainfall in north-east plains (Central and Eastern Uttar Pradesh, Bihar, Jharkhand, West Bengal, Assom and North-Eastern states) often leads to temporary waterlogging, causing partial to complete mortality of pigeonpea seedlings during rainy season. Post-rainy season (September) plantings may be adopted as an alternate approach to address the issue of waterlogging and crop diversification. Research conducted at the ICAR-RCER, Patna has shown that sowing of ‘Pusa 9’ during second week of September after harvest of quality protein green cob maize provided up to 3.0 t/ha grain yield under zero tillage with optimum crop management practices (one hand weeding, one-two insecticide spray of imidacloroprid @1mL/L water at 10 days’ interval commencing from second fortnight of February). Similarly, ‘IPA 203’ sown on September 20, 2018 yielded more than 3.0 t/ha under conventional tillage practices (N: P: K: 20:50:0; two hand weeding; one irrigation during second fortnight of December and two spray of the same insecticide at the same interval). These findings indicate that the system is agronomically feasible, economically highly remunerative and ecologically sustainable to bring about diversification in upland ecology of north-east plains of India.

Seed Priming Influences the Seed Quality and Activities of Nitrate Assimilation and Anti-Oxidant Enzymes in Pigeon Pea Seedlings

Field experiments were conducted with four levels of seed priming including control and two varieties of pigeon pea at ICAR-Indian Institute of Seed Science, Mau during three consecutive years (2011-12 to 2013-14). One-year-old seeds of pigeon pea varieties (Bahar and Malviya-13) were primed with growth regulator (100 ppm GA3), in-organic salt (0.2% KNO3) and tap water (sanitized) separately for 06 hrs. and sown in field under RBD with 03 replications. Observations were recorded on seed quality parameters, biochemical attributes including nitrate assimilatory enzymes and activities of anti-oxidant enzymes during seedling stage. Seed quality parameters including germination, seedling growth and vigor indices were significantly enhanced through seed priming with GA3 followed by KNO3 and tap water over unprimed control. Biochemical attributes viz; chlorophyll a andb contents, were more influenced with GA3 priming followed by KNO3 and tap water whereas the proline accumulation was reduced with priming treatments and maximum reduction was noted with GA3 followed by KNO3 and tap water. Enhancement in nitrate assimilatory enzymes including nitrate and nitrite reductase activities was more with KNO3 priming followed by GA3 and tap water. Anti-oxidant enzymes activities including Catalase, Peroxidase and Super Oxide Dismutase were also increased significantly by KNO3 priming followed by GA3 and tap water over unprimed control.

Brassinosterioids Stimulate Nitrogen Metabolism of Pigeon Pea Plants under Water Deficit Conditions

This study was aimed to find the effects of 28-epibrassinolide (28-EBL) and HBL on pigeon pea seedlings subjected to drought stress, either alone and supplemented with 28-EBL and HBL treatments. Supplementation of EBL (2µM) and HBL (2µM) alone also exhibited the significant improvement in nodule number, nodule fresh weight, nodule dry weight, nodule Leghemoglobin content, root nodule nitrogenase (N2ase)under stress free conditions but under Drought stress conditions EBL (2µM) and HBL (2µM) exhibited the significant improvement in nodule number, nodule fresh weight ,nodule dry weight, nodule leghemoglobin content, root nodule nitrogenase (N2ase) while as control and other concentration (0.5,1 µM) didn’t performed up to level. Effect of Brassinosteroids increase the root nitrate reductase (NR), root nitrite reductase (NiR) activity, root nitrate (NO3-) content, root nitrite (NO2-) content, GS enzymes activities, under stress free conditions, under drought stress conditions this activity is ultimately low. Brassinosteroids at all concentration exhibited positive correlation with significantly raise in the root ammonium (NH4+) content and GOGAT enzymes activities. The present study shows that Pigeon pea plants under water stress, stimulate nitrogen metabolism effecting enzymes associated with it. But different concentration of 28-epibassinolide (0.5,1,2µM) and HBL were applied to the crop under drought stress- and stress-free conditions. Exogenous application of EBL and HBL promotes the Nitrogen Metabolism as plotted in the Graphs Further research is required for the detailed analysis.

Brassinosterioids Promote Photosynthetic Parameters of Pigeon Pea Plants under Water Deficit Conditions

This study was aimed to find the effects of 28-epibrassinolide (28-EBL) and HBL on pigeon pea seedlings subjected to drought stress, either alone and supplemented with 28-EBL and HBL treatments. Supplementation of EBL alone also exhibited the significant improvement on chlorophyll content (44.3% of Chl a and 54.3 % of Chl b) than EBL under drought stress treatments compared to the control plants. Control plants receiving the EBL alone treatment showed the significant effect (by 36%) than the EBL under stress treatment (19.78%) compared to the control for carotenoid levels. supplementation of EBL exhibited the significant improvement of PN (36%; 0.0411, p≤0.05) over their individuals in comparison to control. application of EBL under unstressed was more effective (45%; 0.0341, p≤0.05) over stressed control than their individual applications in enhancing gS in control plants. Plants treated with HBL alone showed a marked increase in Ci (by 25.1%) compared to control plants. application of HBL and was also effective (41.2%; 0.0265, p≤0.05) over unstressed control than their individual applications in enhancing E in control plants. application of EBL and HBL considerably increased the Fv/Fm and ФPSII in comparison to unstressed control. Control plants treated with EBL exhibited the impact on RuBPcase activity (43.1%; 0.0411, p≤0.05) over stressed control than their individual applications over the control plants. application of EBL was more effective (66.7%; 0.0237, p≤0.05) over unstressed control than their individual applications in enhancing FBPase activity in control plants. Control plants treated with EBL and HBL was found to be less effective on the PGK activity by 66.2% (0.0112, p≤0.05) than their individuals (EBL by 163.9%) compared to control. EBL and HBL has a more significant effect than their individual applications on the improvement of leaf starch and sucrose concentrations in drought stressed and well-watered plants.

Crescimento e conteúdo de prolina em plântulas de guandu submetidas a estresse osmótico e à putrescina exógena

O objetivo deste trabalho foi verificar o efeito da aplicação da poliamina putrescina no acúmulo de prolina e no crescimento inicial de plântulas de guandu cultivadas sob estresse hídrico ou salino, e avaliar se esta poliamina pode ser usada como atenuadora desses estresses. Sementes de duas cultivares de guandu, BRS Mandarim e Caqui, foram germinadas em caixas gerbox forradas com papel de filtro umedecido com 0,0, -0,2, -0,3, -0,4, -0,5 MPa de PEG 6000 ou 0, 20, 40, 60, 80 e 120 mmol L-1 de NaCl, na ausência (0 mmol L-1) ou na presença (0,5 mmol L-1) de putrescina. Utilizou-se o delineamento inteiramente casualizado, em arranjo fatorial 2x5x2 e 2x6x2 (duas cultivares, cinco níveis de deficiência hídrica ou seis níveis de estresse salino, e presença ou ausência de putrescina), com quatro repetições. O crescimento das plântulas é acentuadamente reduzido pelas condições de restrição hídrica e salinidade. A putrescina exógena incrementa, sob ambos os estresses, os teores de prolina nas plântulas de guandu, especialmente na cultivar BRS Mandarin, e atenua os efeitos da deficiência hídrica moderada nas cultivares estudadas. Os estresses de restrição hídrica e de salinidade causam acúmulo de prolina na parte aérea e nas raízes de ambas as cultivares. A prolina pode ser considerada um bom indicador bioquímico e fisiológico desses estresses em plântulas de guandu.

Identification of differentially expressed genes preferably related to drought response in pigeon pea (Cajanus cajan) inoculated by arbuscular mycorrhizae fungi (AMF)

Pigeon pea is an ideal crop for sustainable agriculture systems in Karst areas of southwest China, which frequently suffers from the formidable water deficit. Physiologically, arbuscular mycorrhizae (AM)-colonized pigeon pea (Cajanus cajan) demonstrated a further enhanced tolerance to drought stress. To elucidate the molecular mechanism underlying the elevated tolerance, suppression subtractive hybridization (SSH) were employed to dig up the differentially expressed genes using mixed cDNAs prepared from drought-stressed and unstressed pigeon pea seedlings inoculated by AM fungi (AMF) in the present work. Both forward and reverse SSH cDNA library were constructed and a total of 768 clones were obtained. Dot-blotting expression analysis identified that 142 clones were upregulated, and 49 were downregulated during water stress. After sequencing, 182 unique expressed sequence tags (ESTs) were obtained via blast analysis, among which 142 (78%) exhibited high homology to previously identified or putative proteins, however, 40 (22%) showed no homology in the database. The upregulated (102) and downregulated (40) ESTs with significant protein homology might be sorted into 16 and 12 functional categories respectively, which involved in a broad spectrum of biological pathways. Furthermore, semi-quantitative reverse transcription (RT)-PCR was carried out for the 35 differentially expressed genes whose putative functions implicated in abiotic stress tolerances in other species, and it was verified these differentially expressed genes highly involved in drought stress tolerance of AM-colonized pigeon pea.

Variation in contents of phenolic compounds during growth and post-harvest storage of pigeon pea seedlings

The variation in contents of seven phenolic compounds in pigeon pea seedlings during growth and storage was investigated. Maximum contents of vitexin, isovitexin and orientin were found in leaves growing 40 days, which were 0.99 ± 0.06, 6.63 ± 0.35 and 30.89 ± 1.92 mg/g DW. Apigenin and luteolin were extensively distributed in leaves, stems and roots. Pinostrobin and cajaninstilbene acid were mainly accumulated in leaves, the peak values 3.53 ± 0.18 and 2.49 ± 0.13 mg/g DW appeared at the 60th day. Slight and steady increases of seven phenolic compounds were found in room temperature (25 °C) stored pigeon pea leaves up to 120 days. The highest accumulation of seven phenolic compounds at chilling temperature (4 °C) was observed at the 45th day, after which the contents decreased sharply. The stems extracts exhibited more efficient DPPH radical-scavenging ability while the roots extracts demonstrated the strongest lipid peroxidation inhibitory activity.

Effect of the expression of Escherichia coli fhuA gene in Rhizobium sp. IC3123 and ST1 in planta: Its role in increased nodule occupancy and function in pigeon pea

The inability to utilize a fungal siderophore as source of iron nutrition by most of the rhizobial cultures isolated from pigeon pea, could be considered a negative fitness factor since hydroxamate siderophores are found in significant amounts in natural soils. Thus these cultures were engineered to use ferrichrome a prototype of hydroxamate type siderophore. Pigeon pea Rhizobium spp. IC3123 and ST1 harboring Escherichia coli fhuA gene, responsible for uptake of Fe 3+-ferrichrome, were obtained by transformation with pGR1, a broad host range plasmid carrying the fhuA gene under the control of the lac promoter of E. coli. Expression of fhuA in transformed rhizobial strains IC3123::pGR1 and ST1::pGR1 was confirmed by the ability of the plasmid-bearing strains to utilize iron bound to ferrichrome. Inoculation of pigeon pea plants with fhuA expressing rhizobial strains in pot experiments showed a significant increase in plant growth as well as nodule density as compared to those inoculated with the parent as well as the empty vector-bearing strain. Inoculation of pigeon pea seedlings with IC3123::pGR1 and ST1::pGR1 led to marked increase in shoot fresh weight, nodule number per plant, chlorophyll content of leaves and effective nodule symbiosis when compared with plants inoculated with the parent strains IC3123 and ST1. The positive effect of IC3123::pGR1 and ST1::pGR1 treatment on plant growth was more significantly observed when ferrichrome producing Ustilago maydis, known to secrete ferrichrome, was co-inoculated along with the transformed rhizobia. The presence of fhuA gene in rhizobial strains also led to an increased survival and root colonization.

Enhanced Survival and Nodule Occupancy of Pigeon pea Nodulating Rhizobium sp. ST1 expressing fegA Gene of Bradyrhizobium japonicum 61A152

Problem statement: Rhizobial isolates belonging to genera (Rhizobium sp. and Mesorhizobium sp.) in our laboratory produced only catecholate type of siderophores. Although FhuA and FegA (ferrichrome receptors) homologs were found to be present in the sequenced genomes of few rhizobia (e.g., 1 in R. etli and 2 in Mesorhizobium sp. BNC1), laboratory isolates of the corresponding genera failed to utilize ferrichrome, a siderophore which is present in nanomolar concentrations in the soil. This inability was considered as a negative fitness factor with respect to rhizospheric colonization by these rhizobia. Approach: The 2.4 kb fegA gene (encoding ferrichrome receptor) was amplified along with its native promoter from Bradyrhizobium japonicum 61A152 and cloned in a broad host range plasmid vector pUCPM18. The plasmid construct pFJ was transferred by conjugation into Rhizobium sp. ST1 to give transconjugant ST1pFJ12. The consequence of FegA expression on the transconjugant was tested under lab and soil conditions, using physiological experiments. Results: Ability of the transconjugant ST1pFJ12 to utilize ferrichrome and expression of a 79 kD protein band on the outer membrane of the transconjugant confirmed FegA expression. Transconjugant ST1pFJ12 exhibited increased growth rate as compared to the parent strain ST1, in minimal media containing ferrichrome as the sole iron source, confirming the positive effect of FegA expression. Inoculation of pigeon pea seedlings with transconjugant ST1pFJ12 led to a marked increase in plant growth parameters as compared to plants inoculated with the parent strain ST1, the effect being more pronounced when Ustilago maydis, a ferrichrome producer was co-inoculated in the systems. Nodule occupancy on pigeon pea plant when inoculated with the transconjugant ST1pFJ12 alone was 57% which increased to 66% when co-inoculated with U. maydis as compared with 37 and 30% respectively, seen with parental strain ST1 inoculation. Conclusion: The clear increase in nodule occupancy and higher rhizospheric colonization by the fegA transconjugants, presented in this study together with the previous research reported from our laboratory, led us to conclude that ferrichrome utilization ability played an important role in the rhizospheric colonization of the bioinoculant strains. Testing the ability to utilize hydroxamate siderophores therefore, holds prime importance in selecting an efficient biofertilizer strain.

Increase in Seedling Emergence and Dry Weight of Pigeon Pea in the Field with Chitin-supplemented Formulations of Bacillus subtilis AF 1

Different formulations of a chitinolytic plant growth-promoting rhizobacterium, Bacillus subtilis AF 1, were evaluated for growth promotion of pigeon pea in the field. Alginate, peat, chitin/Aspergillus niger mycelium-supplemented peat, and spent compost formulations of B. subtilis AF 1 effectively increased the seedling emergence, plant height and dry weight in the field, with chitin-supplemented peat formulation being the most effective in two different cropping seasons viz., ‘kharif’ and ‘rabi’. As a seed treatment, chitin-supplemented peat formulation of B. subtilis AF 1 increased the emergence and dry weight of pigeon pea seedlings by 29 and 33%, in comparison to an increase of 21 and 30%, respectively by mid-exponential phase cells of B. subtilis AF 1. Colonization of the root system was assessed by the recovery of introduced ampicillin-resistant and chitin-degrading B. subtilis AF 1, on media containing ampicillin and colloidal chitin, from the rhizoplane during the cropping period.

Organ compartmentation of zinc and nickel in pigeonpea seedlings in relation to cultivar tolerance

Zinc (Zn) and nickel (Ni) accumulation in the seedlings of two pigeonpea [Cajanus cajan (L.) Millspaugh] cultivars were studied under different concentrations of Zn and Ni supplied. Significant differences in the seedling growth were observed between the two cultivars of pigeonpea as well as between Zn and Ni treatments. The Zn and Ni treatments decreased dry weights and relative growth indices of the roots and shoots. The Zn and Ni accumulation was greater in the roots of cv. LRG30 than cv. ICPL87. The amount of metal ions allocated to the shoots was more in cv. ICPL87 than in cv. LRG30. The conspicuous compartmentation of Zn and Ni in the roots of the seedlings and the differential responses of the two cultivars of pigeonpea to these heavy metals indicated that cv. LRG30 possesses better root compartmentation of Zn and Ni and therefore resulted in relatively better growth than cv. ICPL87.