Phylogenic Tree Research Articles

Characterization of CgHIFα-Like, a Novel bHLH-PAS Transcription Factor Family Member, and Its Role under Hypoxia Stress in the Pacific Oyster Crassostrea gigas.

Hypoxia-inducible factor (HIF), a critical member of the basic-helix-loop-helix (bHLH)-containing Per-Arnt-Sim (PAS) protein family, is a master transcription factor involved in maintaining oxygen homeostasis. In the present study, we isolated and characterized a novel bHLH-PAS family member, CgHIFα-like gene, from the Pacific oyster Crassostrea gigas, and determined its importance during hypoxia stress. The 3020-bp CgHIFα-like cDNA encoded a protein of 888 amino acids. The predicted CgHIFα-like amino acid sequence was conserved in the N-terminal bHLH, PAS, and PAC domains (but not in the C-terminal domain) and was most closely related to the HIF family in the bHLH-PAS protein phylogenic tree. Similar to the mammalian HIF-1α, CgHIFα-like could be expressed as four mRNA isoforms containing alternative 5′-untranslated regions and different translation initiation codons. At the mRNA level, these isoforms were expressed in a tissue-specific manner and showed increased transcription to varying degrees under hypoxic conditions. Additionally, the western blot analysis demonstrated that CgHIFα-like was induced by hypoxia. Electrophoretic mobility shift assay indicated that CgHIFα-like could bind to the hypoxia responsive element (HRE), whereas dual-luciferase reporter analysis demonstrated that CgHIFα-like could transactivate the reporter gene containing the HREs. In addition to CgHIFα-like, we identified CgARNT from the C. gigas, analyzed its expression pattern, and confirmed its interaction with CgHIFα-like using a yeast two-hybrid assay. In conclusion, this is the first report on the cloning and characterization of a novel hypoxia transcription factor in mollusks, which could accumulate under hypoxia and regulate hypoxia related gene expression by binding to HRE and dimerizing with CgARNT. As only one member of HIF has been identified in invertebrates to date, our results provide new insights into the unique mechanisms of hypoxia tolerance in mollusks.

A Systematic View of the MLO Family in Rice Suggests Their Novel Roles in Morphological Development, Diurnal Responses, the Light-Signaling Pathway, and Various Stress Responses.

The Mildew resistance Locus O (MLO) family is unique to plants, containing genes that were initially identified as a susceptibility factor to powdery mildew pathogens. However, little is known about the roles and functional diversity of this family in rice, a model crop plant. The rice genome has 12 potential MLO family members. To achieve systematic functional assignments, we performed a phylogenomic analysis by integrating meta-expression data obtained from public sources of microarray data and real-time expression data into a phylogenic tree. Subsequently, we identified 12 MLO genes with various tissue-preferred patterns, including leaf, root, pollen, and ubiquitous expression. This suggested their functional diversity for morphological agronomic traits. We also used these integrated transcriptome data within a phylogenetic context to estimate the functional redundancy or specificity among OsMLO family members. Here, OsMLO12 showed preferential expression in mature pollen; OsMLO4, in the root tips; OsMLO10, throughout the roots except at the tips; and OsMLO8, expression preferential to the leaves and trinucleate pollen. Of particular interest to us was the diurnal expression of OsMLO1, OsMLO3, and OsMLO8, which indicated that they are potentially significant in responses to environmental changes. In osdxr mutants that show defects in the light response, OsMLO1, OsMLO3, OsMLO8, and four calmodulin genes were down-regulated. This finding provides insight into the novel functions of MLO proteins associated with the light-responsive methylerythritol 4-phosphate pathway. In addition, abiotic stress meta-expression data and real-time expression analysis implied that four and five MLO genes in rice are associated with responses to heat and cold stress, respectively. Upregulation of OsMLO3 by Magnaporthe oryzae infection further suggested that this gene participates in the response to pathogens. Our analysis has produced fundamental information that will enhance future studies of the diverse developmental or physiological phenomena mediated by the MLO family in this model plant system.

Nested wreath groups and their applications to phylogeny in biology and Cayley trees in chemistry and physics

Nested wreath product groups arise from looped or recursive structures that contain repeated copies of the same structure one within the other. Phylogeny trees in biology, Cayley trees, Bethe lattices, NMR graphs of non-rigid molecules, ammoniated ammonium ions are all examples of structures that exhibit such nested wreath product automorphism groups. We show that the conjugacy classes, irreducible representations and character tables of these nested group structures can be generated using multinomial generating functions cast in terms of matrix types that can be simplified into generalized cycle type polynomials. The nested wreath product groups rapidly increase in orders, for example, a simple wreath product group \(\hbox {S}_{7}[\hbox {S}_{7}]\) consists of \((7!)^{8}\) or \(4.1633\times 10^{23}\) operations, 481,890 conjugacy classes, spanning a 481,891 \(\times \) 481,891 character table that would occupy 232,217,972 pages. We have obtained powerful recursive relations for the conjugacy classes, character tables and the orders of various conjugacy cases of any nested wreath product \(\{[\hbox {S}_{\mathrm{n}}]\}^{\mathrm{m}}\) or \(\hbox {S}_{\mathrm{n}}[\hbox {S}_{\mathrm{n}}[\hbox {S}_{\mathrm{n}}{\ldots }.[\hbox {S}_{\mathrm{n}}]]{\ldots }.]\) with order \(\left( {n!}\right) ^{a_m},\,\hbox {a}_{\mathrm{m}}=(\hbox {n}^{\mathrm{m}}-1)/(\hbox {n}-1)\). We have obtained the character tables of phylogenetic trees of any order, character tables of Cayley trees of degrees 3 and 4 and for Cayley trees of larger degrees, we have derived exact analytical expressions for the conjugacy classes and IRs for up to \(\{[\hbox {S}_{7}]\}^{\mathrm{m}}\) with order \((7!)^{137257}\) for \(\hbox {m}=7\). Applications to colorings of phylogenic trees in biology are considered.

Multidrug-Resistant Sequence Type 235 Pseudomonas aeruginosa Clinical Isolates Producing IMP-26 with Increased Carbapenem-Hydrolyzing Activities in Vietnam

Forty clinical isolates of multidrug-resistant Pseudomonas aeruginosa were obtained in a medical setting in Hanoi, Vietnam. Whole genomes of all 40 isolates were sequenced by MiSeq (Illumina), and phylogenic trees were constructed from the single nucleotide polymorphism concatemers. Of these 40 isolates, 24 (60.0%) harbored metallo-β-lactamase-encoding genes, including blaIMP-15, blaIMP-26, blaIMP-51, and/or blaNDM-1 Of these 24 isolates, 12 harbored blaIMP-26 and belonged to sequence type 235 (ST235). Escherichia coli expressing blaIMP-26 was significantly more resistant to doripenem and meropenem than E. coli expressing blaIMP-1 and blaIMP-15 IMP-26 showed higher catalytic activity against doripenem and meropenem than IMP-1 and against all carbapenems tested, including doripenem, imipenem, meropenem, and panipenem, than did IMP-15. These data suggest that clinical isolates of multidrug-resistant ST235 P. aeruginosa producing IMP-26 with increased carbapenem-hydrolyzing activities are spreading in medical settings in Vietnam.

Description of Novosphingobiumflavum sp. nov., isolated from soil.

A novel yellow bacterial strain, designated UCM-28T, was isolated from forest soil in Gyeonggi-Do, South Korea. The isolated strain was Gram-stain-negative, aerobic, non-spore-forming, non-motile and rod-shaped, and grew at 10-37 °C, pH 5.5-9 and with 0-1 % NaCl. It could reduce nitrate to nitrite and hydrolyse aesculin. We determined the taxonomic position of strain UCM-28T; based on the 16S rRNA gene sequence, the strain belongs to the genus Novosphingobium. The bacterium showed the highest similarity to Novosphingobiumpiscinae SLH-16T (98.9 %), Novosphingobium rhizosphaerae JM-1T (97.7 %), Novosphingobium taihuense T3-B9T (97.2 %), Novosphingobium subterraneum DSM 12447T (97.1 %), Novosphingobium aromaticivorans DSM 12444T (97.1 %) and Novosphingobium capsulatum GIFU 11526T (96.7 %). Phylogenic trees also confirmed that strain UCM-28T is most closely related to Novosphingobiumpiscinae SLH-16T and others, and is positioned within the genus Novosphingobium. The DNA relatedness of strain UCM-28T with its references was in the range of 20.9-35.2 %. The polar lipid profile revealed diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, sphingoglycolipid, phosphatidylcholine, phosphatidylmonomethylethanolamine, six unidentified polar lipids and two unknown glycolipids. The major quinone was ubiquinone Q-10, and the major polyamine was spermidine. The DNA G+C content was 63.5 mol%. The major fatty acids included (>10 %) summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c) (46.3 %), summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c) (24.9 %) and C14 : 0 2-OH (11.8 %). Based on the phylogenetic and phenotypic data, strain UCM-28T should be classified within the genus Novosphingobium as a representative of a novel species, named Novosphingobium flavum sp. nov. The type strain is UCM-28T (=KACC 18571T=NBRC 111647T).

English

Chalcone synthase gene is a key enzyme in the biosynthesis of flavonoids and isoflavonoids. This gene assumes several functions in plants such as protection against UV ray and defense against pathogenic factors. In this study, chalcone synthase gene was studied and evaluated in terms of evolutionary rate in 119 species of creatures such as agricultural plants as eukaryote creatures and bacteria as prokaryotes. The evolutionary analyses were performed using bioinformatics tools. After preparing the phylogenic tree, the evolutionary study and comparison were performed. Also divergent time of chalcone synthase gene was investigated in the agricultural plants and bacteria. This study led to obtaining two general conclusions: First, the evolutionary rate between two prokaryote and eukaryote groups is different over time, and second, considering the calculation of divergent time for the genome of prokaryotes from eukaryotes in the previous works, it is recommended to consider the Chalcone synthase gene duplication time as about 410 million years.

Genome-Wide Identification and Expression Profiling of Tomato Hsp20 Gene Family in Response to Biotic and Abiotic Stresses.

The Hsp20 genes are involved in the response of plants to environment stresses including heat shock and also play a vital role in plant growth and development. They represent the most abundant small heat shock proteins (sHsps) in plants, but little is known about this family in tomato (Solanum lycopersicum), an important vegetable crop in the world. Here, we characterized heat shock protein 20 (SlHsp20) gene family in tomato through integration of gene structure, chromosome location, phylogenetic relationship, and expression profile. Using bioinformatics-based methods, we identified at least 42 putative SlHsp20 genes in tomato. Sequence analysis revealed that most of SlHsp20 genes possessed no intron or a relatively short intron in length. Chromosome mapping indicated that inter-arm and intra-chromosome duplication events contributed remarkably to the expansion of SlHsp20 genes. Phylogentic tree of Hsp20 genes from tomato and other plant species revealed that SlHsp20 genes were grouped into 13 subfamilies, indicating that these genes may have a common ancestor that generated diverse subfamilies prior to the mono-dicot split. In addition, expression analysis using RNA-seq in various tissues and developmental stages of cultivated tomato and the wild relative Solanum pimpinellifolium revealed that most of these genes (83%) were expressed in at least one stage from at least one genotype. Out of 42 genes, 4 genes were expressed constitutively in almost all the tissues analyzed, implying that these genes might have specific housekeeping function in tomato cell under normal growth conditions. Two SlHsp20 genes displayed differential expression levels between cultivated tomato and S. pimpinellifolium in vegetative (leaf and root) and reproductive organs (floral bud and flower), suggesting inter-species diversification for functional specialization during the process of domestication. Based on genome-wide microarray analysis, we showed that the transcript levels of SlHsp20 genes could be induced profusely by abiotic and biotic stresses such as heat, drought, salt, Botrytis cinerea, and Tomato Spotted Wilt Virus (TSWV), indicating their potential roles in mediating the response of tomato plants to environment stresses. In conclusion, these results provide valuable information for elucidating the evolutionary relationship of Hsp20 gene family and functional characterization of the SlHsp20 gene family in the future.

Comparative genomics revealed the origin and evolution of autophagy pathway

AbstractAutophagy is prevalent in eukaryotic organisms. Massive research efforts have focused on the mechanism and functionality of autophagy in eukaryotes, for example, their role in human diseases. However, little is known about how this fundamental pathway evolved; in particular, there is an absence of research in prokaryotes. Here, we carried out a comparative genomics analysis among 84 species ranging from eukaryotes to eubacteria and archaebacteria. We found that most of the core proteins in the autophagy pathway were ubiquitous in eukaryotes, whereas the distribution of proteins involved in selective autophagy were limited. In prokaryotes, distant homologs of autophagy‐related proteins were also found. Species in Cyanobacteria and Euryarchaeota possess relatively more of these homologs compared to other prokaryotes, which indicated the prokaryotic origin of some autophagy‐related proteins. Phylogenic tree analysis and the distribution of homologs suggested that the presence of proteins involved in autophagosome formation should be an important sign of autophagy. Furthermore, we found that distribution of mitochondrial protein importing‐related proteins was quite similar to that of autophagy‐related proteins in eukaryotes and that their phylogenic profile was closer to that of several core autophagy proteins compared with 16S/18S ribosomal RNAs, suggesting the engulfment of mitochondria may be the driving force for the evolution of autophagy. Autophagy may have evolved as a quality control system for mitochondria at the very beginning of evolution of eukaryotes. This research shed light on the prokaryotic origin of autophagy and provided a new perspective that mitochondria and autophagy may interplay during the course of eukaryotic evolution.

Genetic structure of human populations based on 5 gene loci: A preliminary report from Northern India

The genetics of human populations reveals the evolutionary causes of population structure, population history, human diversity, racial divergence, adaptation, cultural and social behaviors and understanding human adaptation to local environmental constraints. The study aimed to determine the genetic relationship among six human population of Jammu and Kashmir, Northern India. This preliminary effort involved five gene loci of genetic traits, viz. ABO and Rh blood type, phenylthiocarbamide, color blindness and sickle cell trait. A total of 3679 healthy subjects were selected from six Muslim populations viz., Gujjar and Bakarwal (n=762), Mughal (n=560), Khan (n=642), Malik (n=564), Mir (579) and Syed (n=572). The allele frequencies and heterozygosity levels show significant differences among six populations (p<0.05). The phylogentic tree revealed that Mughal and Gujjar and Bakarwal (tribal population) are close to each other and differ from other four populations (Malik, Mir, Khan and Syed). Further studies in context genomic diversity, history and origin of these populations will be undertaken in future to get more conclusive proof.

MetaTreeMap: An Alternative Visualization Method for Displaying Metagenomic Phylogenic Trees

Metagenomic samples can contain hundreds or thousands of different species. The most common method to identify these species is to sequence the samples and then classify the reads to nodes along a phylogenic tree. Linear representations of trees with so many nodes face legibility issues. In addition, such views are not optimal for appreciating the read quantity assigned to each node. The problem is exaggerated when comparison between multiple samples is needed. MetaTreeMap adapts a visualization method that addresses these weaknesses. The tree is represented by nested rectangles that illustrate the number or percentage of assigned reads. MetaTreeMap implements various options specific to phylogenic trees that allow for quick overview and investigation of the information. More generally, the goal of this software is to provide the user with the ability to easily display phylogenic trees based on various quantities assigned to the nodes, such as read number, percentage or other values. The tool can be used online at http://metasystems.riken.jp/visualization/treemap/.

Epidemiological and etiological characteristics of dengue fever in Shenzhen in 2014

Objective To investigate the epidemiological characteristics of dengue fever in Shenzhen city in 2014 and to analyze the evolutional characteristics of the epidemic dengue virus (DENV) strains in order to provide scientific guidelines for the prevention and control of dengue fever. Methods Descriptive epidemiological analysis was used to analyze the prevalence of dengue fever in Shenzhen city in 2014. Immunochromatography and real-time PCR were performed to detect the specific antibodies (IgM and IgG) and DENV nucleic acids in serum samples collected from suspected cases of dengue fever. Serum samples collected from the patients at early stage of dengue fever were used to infect the C6/36 cell line for further isolation of DENV strains. The types of isolated DENV strains were determined by using real-time PCR. E genes of the isolated DENV strains were amplified by RT-PCR and then sequenced. DNAStar and Clustslx (1.83) softwares were used to analyze the homology between DENV strains isolated in Shenzhen and other areas. A phylogenetic tree based on the sequences of E genes of Shenzhen strains and other sequences of DENV reference strains downloaded from GenBank was constructed for further analysis. Results A total of 454 cases of dengue fever were reported in Shenzhen in 2014 with a male to female ratio of 1.43∶1. Local patients accounted for 76.21% and the rest 23.79% were imported cases mainly from Southeast Asian and surrounding cities. There were 441 cases reported from September to November, accounting for 97.14% of all reported cases. Most of the infected subjects were aged 20 to 50, accounting for 76.73%. Of the 270 samples positive for DENV nucleic acids, strains of DENV-1, DENV-2, DENV-3 and DENV-4 accounted for 87.41%, 8.89%, 0.37% and 2.22%, respectively. The phylogenetic tree analysis revealed that the DENV-1 strains belonged to two genotypes, which were genotypeⅠ and genotype Ⅴ. The DENV strains of genotypeⅠ were highly similar to the epidemic strain isolated in Shenzhen in 2010 and the genotype Ⅴ strains were first reported in Shenzhen. The homology analysis of the nucleotides of E genes showed that minor differences in the nucleotide sequences were found between DENV-2 strains. All of the DENV-2 strains belonged to the genotype Ⅳ as indicated by the phylogenic tree. Conclusion There were 454 cases of dengue fever (including both local and imported cases) reported in Shenzhen city in 2014, reaching an all-time high. DENV-1 was the predominant pathogen in combination with an increased infection of DENV-2. This study indicated that the prevalent DENV strains might be imported from Southeast countries and neighboring cities. Further researches should be conducted to analyze whether dengue fever is endemic in Shenzhen City. Key words: Dengue virus; Epidemiological characteristics; E gene; Evolutional analysis

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8% identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7%) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

Advances in Understanding Bacterial Pathogenesis Gained from Whole-Genome Sequencing and Phylogenetics.

The development of next-generation sequencing as a cost-effective technology has facilitated the analysis of bacterial population structure at a whole-genome level and at scale. From these data, phylogenic trees have been constructed that define population structures at a local, national, and global level, providing a framework for genetic analysis. Although still at an early stage, these approaches have yielded progress in several areas, including pathogen transmission mapping, the genetics of niche colonization and host adaptation, as well as gene-to-phenotype association studies. Antibiotic resistance has proven to be a major challenge in the early 21(st) century, and phylogenetic analyses have uncovered the dramatic effect that the use of antibiotics has had on shaping bacterial population structures. An update on insights into bacterial evolution from comparative genomics is provided in this review.

Comparison of ITS, RAPD and ISSR from DNA-based genetic diversity techniques

ITS, RAPD-PCR and ISSR-PCR are most popular DNA-based techniques that are extensively applied in the determination of the genetic diversity of species among populations. However, especially for organisms having high genetic polymorphism, phylogenetic trees drawn from the results of these techniques may be different. For finding a meaningful phylogenetic tree, it should be compared phylogenetic trees obtained from these different techniques with geographic locations of populations. Lichens have a high genetic polymorphism and tolerance against different environmental conditions. In this study, these three DNA-based genetic diversity techniques were compared, using different populations of a lichen species (Xanthoria parietina). X. parietina was especially chosen because of its high genetic diversity in narrow zones. Lichen samples were collected from ten different locations in a narrow transition climate zone Bilecik (Turkey). Statistical analyses of all results were calculated using UPGMA analysis. Phylogenic trees for each technique were drawn and transferred to the Bilecik map for comparative analysis. The results of three techniques allowed us to verify that populations of X. parietina have high genetic variety in a narrow zone. But phylogenetic trees obtained from these results were found to be very different. Our comparative analysis demonstrated that the results of these techniques are not similar and have critical differences. We observed that the ITS method provides more clear data and is more successful in genetic diversity analyses of more asunder populations, in contrast to ISSR-PCR and RAPD-PCR methods.

Molecular characterization of southern bluefin tuna myoglobin (Thunnus maccoyii).

The primary structure of southern bluefin tuna Thunnus maccoyii Mb has been elucidated by molecular cloning techniques. The cDNA of this tuna encoding Mb contained 776 nucleotides, with an open reading frame of 444 nucleotides encoding 147 amino acids. The nucleotide sequence of the coding region was identical to those of other bluefin tunas (T. thynnus and T. orientalis), thus giving the same amino acid sequences. Based on the deduced amino acid sequence, bioinformatic analysis was performed including phylogenic tree, hydropathy plot and homology modeling. In order to investigate the autoxidation profiles, the isolation of Mb was performed from the dark muscle. The water soluble fraction was subjected to ammonium sulfate fractionation (60-90% saturation) followed by preparative gel electrophoresis. Autoxidation profiles of Mb were delineated at pH 5.6, 6.5 and 7.4 at temperature 37°C. The autoxidation rate of tuna Mb was slightly higher than that of horse Mb at all pH examined. These results revealed that tuna myoglobin was unstable than that of horse Mb mainly at acidic pH.

Ix-layer structure for genomics:A powerful conceptual framework that integrates research, test and treatment

Genomic data are now available from various fields of medicine and biology, and I proposed a conceptual framework "Six-layer structure" to integrate various areas of genomics. The proposed layers are "life" as the uppermost layer, followed by "species","population","family","individual",and finally "cell" as the bottommost layer. In each pair of adjacent layers, each member of the upper layer comprises a set of members of the lower layer. In each layer, we can define consistent partial orders of members based on genomic data in the forms of phylogenic and pedigree trees. Based on this framework, we can give integrated explanations for various researches, tests and drug therapies concerning genomic data, and we can use this framework for new discoveries as well as new test and drug developments.

How Well Can We Detect Lineage-Specific Diversification-Rate Shifts? A Simulation Study of Sequential AIC Methods.

Evolutionary biologists have long been fascinated by the extreme differences in species numbers across branches of the Tree of Life. This has motivated the development of statistical methods for detecting shifts in the rate of lineage diversification across the branches of phylogenic trees. One of the most frequently used methods, MEDUSA, explores a set of diversification-rate models, where each model assigns branches of the phylogeny to a set of diversification-rate categories. Each model is first fit to the data, and the Akaike information criterion (AIC) is then used to identify the optimal diversification model. Surprisingly, the statistical behavior of this popular method is uncharacterized, which is a concern in light of: (1) the poor performance of the AIC as a means of choosing among models in other phylogenetic contexts; (2) the ad hoc algorithm used to visit diversification models, and; (3) errors that we reveal in the likelihood function used to fit diversification models to the phylogenetic data. Here, we perform an extensive simulation study demonstrating that MEDUSA (1) has a high false-discovery rate (on average, spurious diversification-rate shifts are identified of the time), and (2) provides biased estimates of diversification-rate parameters. Understanding the statistical behavior of MEDUSA is critical both to empirical researchers—in order to clarify whether these methods can make reliable inferences from empirical datasets—and to theoretical biologists—in order to clarify the specific problems that need to be solved in order to develop more reliable approaches for detecting shifts in the rate of lineage diversification. [Akaike information criterion; extinction; lineage-specific diversification rates; phylogenetic model selection; speciation.]

16S-gyrB-rpoB multilocus sequence analysis for species identification in the genus Microbispora.

The genus Microbispora has been considered difficult to define taxonomically. While 16S rRNA gene analysis is required to determine phylogenetic relationships among species in this genus, most 16S rRNA gene-based phylogenetic tree topologies are not reliable. The genus Microbispora currently contains eight species along with six reclassified species (Microbispora chromogenes, Microbispora diastatica, Microbispora parva, Microbispora indica, Microbispora karnatakensis, Microbispora rosea) and Microbispora rosea subsp. aerata, a taxon composed of three further reclassified species (Microbispora aerata, Microbispora thermodiastatica, and Microbispora thermorosea). 16S rRNA, 23S rRNA, gyrB, and rpoB gene sequences were obtained for the type strains of Microbispora species, and eleven endophytic isolates from a Brazilian medicinal plant, Vochysia divergens. Using the concatenated sequence, most Microbispora type strains could be distinguished with high probability support. Based on these analyses, we propose that five of the species reclassified within the subspecies of M. rosea (M. chromogenes, M. karnatakensis, M. parva, M. aerata and M. thermorosea) are distinct from M. rosea and so should be retained as distinct species. The concatenated 16S-gyrB-rpoB gene phylogenic tree had significant probability support and topology. We propose the use of concatenated 16S-gyrB-rpoB gene sequences to determine phylogenetic relationships within the genus Microbispora. We also suggest that strains sharing >98.1% 16S-gyrB-rpoB gene sequences similarity be defined as a single species, based on results from this analysis. Seven of the strains isolated from V. divergens were not related to any previously described Microbispora species.

Phylogenetic relationships among Staphylococcus aureus isolated from clinical samples in Mashhad, Iran.

The spa gene occurs in all strains of Staphylococcus aureus (S. aureus), can function as a genetic marker and might be used distinguish strains at the species level. Hence, due to these advantages, we used spa typing and the Based Upon Repeat Pattern (BURP) to assign the clonal and phylogenetic relationships of S. aureus strains. The sensitivity of S. aureus strains to methicillin was determined using agar disk diffusion. The extracted DNA from 56 isolates of S. aureus was subjected to PCR to detect the spa gene with specific primers. The spa typing method was performed for each of the isolates, and then, BURP was used to cluster spa types (spa-CCs). Finally, using relevant software, the phylogenic tree was drawn. The results of this study showed that 25 out of 56 (44.6%) isolates were resistant to methicillin. The typing of S. aureus isolates revealed 24 different spa types among 56 isolates, and BURP analysis clustered the 24 spa types into 5 spa clonal complexes (CCs) and 12 singletons. The process of spa typing, in combination with BURP analysis, provides an efficient method for investigating phylogenetic and clonal relationships among clinical isolates and can be useful for monitoring bacterial spread between hospitals and communities as well as between and within hospitals.

Understanding Management Concepts through Development of their Tool Box: The case of total quality management

Abstract This paper offers an alternative approach to defining the management concept. The proposed methodology relies on the identification of tools supporting the given concept. The author assumed that the identification of tools’ evolution gives clearer insights into circumstances of constant development of—by its nature—a more general concept. The tools’ classification resembles a phylogenic tree and is based on the idea of an affinity diagram. To provide the proof for such reasoning, the total quality management (TQM) concept was chosen. This proposition can be useful for better understanding origins and the development of management thought. It clarifies relationships among methods constituting frameworks of quality management.