Phyllanthus Maderaspatensis Research Articles

Green synthesis of highly active and recyclable chromium oxide nanocatalyst for biodiesel production from novel nonedible oil seeds

AbstractThis study explores the sustainable production of biodiesel from nonedible Phyllanthus maderaspatensis seed oil (highest oil content of 35%, FFA 0.87 mg/KOH), utilizing an innovative green synthesis approach for chromium oxide nanoparticles derived from the waste fruit parts of Aubergine for the very first time in the current work. In pursuit of alternatives to fossil fuels, our research underscores the environmental and socio‐economic benefits of biofuels, particularly in reducing greenhouse gas emissions. The optimized process yielded a 92% biodiesel conversion under conditions of a 9:1 methanol‐to‐oil ratio, 0.135 wt.% catalyst concentration, and a reaction duration of 150 min at 80°C. Comprehensive analysis techniques, including XRD, FTIR, SEM, EDX, Zeta analysis, differential reflectance spectroscopy (DRS), GC–MS, and NMR (1H, 13C), were employed to characterize the synthesized nanocatalyst and biodiesel product. The biodiesel's fuel properties, such as acid value, fire point, pour point, viscosity, kinematic density, sulfur content, and cloud point, were rigorously tested, demonstrating compliance with international standards (ASTM D‐6571, EN 14214, and GB/T 20828‐2007). The use of P. maderaspatensis seed oil, an economical and environmentally friendly feedstock, in conjunction with a cost‐effective nanocatalyst, presents a viable pathway for the sustainable and scalable production of biodiesel. This study contributes to the advancement of bioproducts for a sustainable bioeconomy by demonstrating an integrated approach to bioenergy production that leverages biotechnological innovations and addresses both environmental and socio‐economic dimensions.

Densitometric Quantification and Optimization of Polyphenols in Phyllanthus maderaspatensis by HPTLC

Quantifying and optimizing the polyphenol content of Phyllanthus maderaspatensis was accomplished using a single-solvent HPTLC system. Analyzing hydroalcoholic extracts for kaempferol, rutin, ellagic acid, quercetin, catechin, and gallic acid, we simultaneously quantified and optimized their concentration. In the experiment, the methanol to water ratio (%), temperature (°C), and time of extraction (min) were all optimized using a Box-Behnken statistical design. Kaempferol, rutin, ellagic acid, quercetin, catechin, and gallic acid were among the dependent variables analyzed. In the HPTLC separation, silica gel 60F254 plates were used, and toluene, ethyl acetate, and formic acid (5:4:1) made up the mobile phase. For kaempferol, rutin, ellagic acid, quercetin, catechin, and gallic acid, densitometric measurements were carried out using the absorbance mode at 254 nm. Hydroalcoholic extract of P. maderaspatensis contains rutin (0.344), catechin (2.62), gallic acid (0.93), ellagic acid (0.172), quercetin (0.0108) and kaempferol (0.06). Further, it may be affected by more than one factor at a time, resulting in a varying degree of reaction. A negative correlation was found between X1 (extraction time (min)) and X2 (temperature), as well as X1 and X3 (solvent ratios). Taking these characteristics into consideration, the method outlined here is a validated HPTLC method for measuring kaempferol, rutin, ellagic acid, quercetin, catechin, and gallic acid.

Immunomodulatory Activity of Phyllanthus maderaspatensis in LPS-Stimulated Mouse Macrophage RAW 264.7 Cells

Phyllanthus species (Family Euphorbiaceae) has been used in traditional medicine of several countries as a cure for numerous diseases, including jaundice and hepatitis. This study is an attempt to evaluate the immunomodulatory activity of various fractions, column eluents of ethyl acetate fraction, and their polyphenols. Phyllanthus maderaspatensis were standardized using high-performance liquid chromatography to identify and quantify polyphenols, and purification of polyphenols was carried out using vacuum liquid chromatography. Subsequently, we tested various fractions, column eluents of ethyl acetate fraction, and polyphenols in vitro to assess their impact on nitric oxide (NO) production in LPS-stimulated mouse macrophage RAW 264.7 cells. The ethyl acetate fraction (100 μg mL−1) had a more significant stimulatory effect on LPS-stimulated NO production by the RAW 264.7 cells. We found that the ethyl acetate fraction contains a high amount of catechin, quercetin, ellagic acid kaempferol, and rutin, which are responsible for immunomodulation. The ethyl acetate fraction at concentrations of 25 and 50 μg mL−1 had a significant inhibitory effect and 100 μg mL−1 had a more significant stimulatory effect when compared with the LPS control. The percentage of inhibition by LPS control ranged from zero percentage, kaempferol ranged from 45.4% at 50 μg mL−1 to 41.88% at 100 μg mL−1, catechin ranged from 50% at 50 μg mL−1 to 35.28% at 100 μg mL−1, rutin ranged from 36.2% at 50 μg mL−1 to 47.44% at 100 μg mL−1, gallic acid ranged from 28.4% at 50 μg mL−1 to 50.9% at 100 μg mL−1, ellagic acid ranged from 45.12% at 50 μg mL−1 to 38.64% at 100 μg mL−1, and purified quercetin ranged from 26.2% at 50 μg mL−1to 45.48% at 100 μg mL−1. As NO plays an important role in the immune function, polyphenols’ treatment could modulate several aspects of host defense mechanisms owing to the stimulation of the inducible nitric oxide synthase.

Evaluation of Pre and Post Emergence Herbicides in Greengram (Vigna radiata L.) during Kharif and Rabi Seasons in the Uplands of Krishna Zone of Andhra Pradesh

Background: Greengram crop is grown round the year as a catch crop in different cropping systems of the uplands of the Krishna Zone of Andhra Pradesh. The practice of application of pre emergence herbicide like pendimethalin is very popular with the farmers for the control of weeds in the uplands, both in kharif and rabi seasons. Further spraying of a selective post emergence herbicide is also practiced by farmers. However, some of the weeds of kharif viz., Phyllanthus maderaspatensis and rabi viz., Chrozophora rottleri could not be controlled with these herbicides due to their late emergence or due to development of partial resistance to these herbicides. Certain new pre (PE) and post emergence (PoE) herbicides viz., pendimethalin 30% + imazethapyr 2%, acifluorfen sodium 16.5% + clodinafop propargyl 8%, fomesafen 11.1% + fluazifop -p-butyl 11.1%, are recommended in crops like soybean and groundnut. However, there is need to test these herbicides available in market for their suitability to control the weeds in greengram. Methods: A field experiment was carried out at Regional Agricultural Research Station, Lam, Guntur, Andhra Pradesh, with an objective to evaluate selected PE and PoE herbicide mixtures in greengram managing the major weeds of greengram grown in vertisols of Krishna Zone of Andhra Pradesh during Kharif and rabi seasons of 2018 under upland conditions. Result: Among the two PE herbicides tested on greengram, pendimethalin 30% + imazethapyr 2% @ 0.75 + 0.05 kg/ha was found to be more effective in reducing the weed density and dry matter compared with pendimethalin 30% @ 0.75 kg/ha. The PoE herbicide mixtures tested viz., fomesafen 11.1% + fluazifop -p-butyl 11.1% @111g/ha, propaquizafop 2.5% + imazethapyr 3.75% @ 50+75 g/ha were on par with imazethapyr 10% @ 50g/ha in controlling the weed population without having any adverse affect on the growth and yield of greengram during kharif and rabi.

In vitro study of antibacterial activity of Kanocha seeds (Phyllanthus maderaspatensis) against some gram-positive and gram-negative bacterial strains

Kanocha is the dried seeds of Phyllanthus maderaspatensis of family Phyllanthaceae. It has been long utilising in Unani system of medicine to cure many ailments including genitourinary infectious diseases. In the current investigation, the aqueous, alcoholic and hydroalcoholic extracts of Kanocha seeds were screened for their antibacterial actions against both gram-positive (Streptococcus mutans, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, Corynebacterium xerosis and Bacillus cereus) and gram-negative (Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa and Proteus vulgaris) bacterial strains compared with the standard Drug: Ciprofloxacin (SD060) 5 μg/disk for gram-positive bacterial strains and Gentamicin (SD016) 10 μg/disk for gram-negative bacterial strains using Zone of Inhibition (ZOI) with the help of Agar well method and minimum inhibitory concentration (MIC) & minimum bactericidal concentration (MBC) with the help of Nutrient Broth method. The data was analysed using Gpad INSTAT programming, one-way ANOVA and post-test Bonferroni. Alcoholic and hydroalcoholic extract showed significant antibacterial activity than the aqueous extract but not up to the mark as compared to standard group indicating that the alcoholic and hydroalcoholic extract has the capability of extracting more phytochemicals than aqueous extract which are responsible fortheir antibacterial activity. It could be concluded that the present drug possesses antibacterial property.

Effect of Phyllanthus maderaspatensis L. crude methanolic extract on diet induced hypercholesterolemia in Wistar albino rats (Mus norvegicus albinus)

Present experiment was aimed to assess the diet induced hypocholesterolemic activity of crude methanolic extracts of Phyllanthus maderaspatensis L. on Wistar rats. The crude whole plant methanolic extract was administered orally at the dosage of 2000 mg/kg body weight per day, to diet induced hypercholesterolemic Wistar albino rats for 14 days to assess the acute toxicity and hypercholesterolemic activity. Lower concentrations were used since no toxicity found during the acute toxicity experiment. Dosages of Methanolic extracts of 400mg, 800 mg and 1200 mg/ kg body weight per day were orally administered to rats for 42 days whilst total cholesterol, triglyceride, were studied. Hardly any acute toxicity signs and liver toxicity were observed with the extract of 2000 mg/kg. The same concentration indicated a reduction of total cholesterol and triglyceride during 14 days. The groups treated with three lower doses of extract exhibited dose dependent negative response with total cholesterol and triglyceride. Results indicated capability of the crude methanolic extract of P. maderaspatensis L. in total cholesterol and triglyceride in diet induced hypercholestrolemic Wistar rats.

Green Synthesis and Biological Applications of Silver Nanoparticles Using Phyllanthus maderaspatensis L. Root Extract

Biosynthesis of metal nanoparticles is a raising research area because of their vital role in nanomedicines. In the present work, we have synthesized silver nanoparticles (AgNPs) using the aqueous extract of Phyllanthus maderaspatensis L. root. AgNPs are characterized by UV–Vis spectroscopy, Fourier transform infrared spectroscopy (FT-IR), scanning electron microscopy (SEM), high-resolution transmission electron microscopy (HR-TEM), XRD – X-ray powder diffraction spectroscopy (XRD), and Energy dispersive X-ray spectroscopy (EDS) techniques. The synthesized AgNPs were also evaluated for its antioxidant, antibacterial, and cytotoxicity activities. The result indicates that the phytoconstituents present in the P. maderaspatensis root extract were mostly accountable for the reduction of Ag+ ions. UV spectrum was observed at 479 nm to the formation of AgNPs. Bioactive compounds were identified by FT-IR. The presence of elements was characterized by EDS. The morphology and size of the AgNPs were determined by SEM, HR-TEM, and X-ray diffraction analysis which showed the average particle size ranging from 3–14 nm. It was more effective against micro-organisms and also, AgNPs might serve as a potent antioxidant as revealed by DPPH and superoxide assays. Furthermore, these AgNPs also showed a potent cytotoxic activity against MCF-7 breast cancer cell lines. Herein, we suggested the green synthesis of AgNPs with potent antibacterial, antioxidant, and cytotoxic activities with feasible biomedical and industrial applications.

Comparative evaluation of standardized alcoholic, hydroalcoholic, and aqueous extracts of Phyllanthus maderaspatensis Linn. against galactosamine-induced hepatopathy in albino rats.

Background:Phyllanthus maderaspatensis species (Euphorbiaceae) has been used in folk medicine of many countries as a remedy against several pathological conditions including jaundice and hepatitis. This study is an attempt to evaluate hepatoprotective activity of P. maderaspatensis against galactosamine-induced toxicity and also investigation of polyphenols in each extract.Materials and Methods:The extraction of P. maderaspatensis as per Ayurveda was simultaneously standardized and quantified for biochemical markers viz., polyphenols: Kaempferol, quercetin, catechin, rutin, and ellagic acid by high-performance thin layer chromatography. Hepatotoxicity was induced albino adult rats by intraperitoneal injection of galactosamine (400 mg/kg). The quantified aqueous, hydroalcoholic and alcoholic extract of P. maderaspatensis (200 and 400 mg/kg body weight/day) were compared for evaluation of hepatoprotective potential, which were assessed in terms of reduction in histological damage, change in serum enzymes such as aspartate amino transaminase, alanine amino transaminase and alkaline phosphatase and increase thiobarbituric acid reactive substances.Results and Discussion:The hydroalcoholic extract was found to contain comparatively high amount of kaempferol, quercetin, catechin, rutin, and ellagic acid which are responsible for hepatoprotection. Antioxidant parameters such as glutathione, catalase, and superoxide dismutase activity in liver tissues were restored toward the normalization more significantly by the hydroalcoholic extract when compared with other extracts. The biochemical observations were supplemented with histopathological examination.Conclusion:The hydroalcoholic extract standardized with respect to known biomarkers may be considered as a potent extract against hepatotoxicity.

Ethnobotanical Survey of some Medicinal Plants Used as Veterinary Medicine of Banka a District of Bihar

Use of medicinal plants for curing animal diseases are widespread in Banka district of Bihar. This paper provides information of 65 medicinal plants species used by villagers of the forest areas for curing various diseases in animals. In all herbal formulation for 30 ailments are presented of these, use of 16 species, viz, Acalypha indica, Argemone Mexicana, Grewia hirsuta, Salanum tuberosum, Lagenaria Siceraria, Albizzia amara, Aloe vera, Andrographis paniculata, Blumea mollis, Oryza sativa, Butea monosperma, Cassia fistula, Dolichos biflorus, Physalis minima, Holarrhena antidysenterica and Phyllanthus maderaspatensis are being reported for the first time in the cure of animals. The data on mode of preparation, dosage, administration etc, for each ailment is provided.

Weed Interference in Zero-Till Cotton (Gossypium hirsutum L.)

An investigation to study the effect of weed competition on zero-till cotton was carried out at the experimental farm of the Pandit Jawaharlal Nehru College of Agricultural and Research Institute, Karikal during the summer season (February to July) of 2007. The predominant weed species found in the experimented field were Echinochola colanum L., Leptochloa chinensis L., Cyperus rotundus L., Trianthema portulacastru, Rotala densiflora, Eclipta alba, Phyllanthus maderaspatensis, Echinochloa colonum and Leptochloa chinensis. Weed population increased between 20 - 60 days after sowing and decreased thereafter. Weed competition during the first 20 days after sowing resulted in an average yield loss of 12.5 percent which increased to 96.5 percent with full season competition. The seed cotton yield increased from 353 kg/ha to 2308 kg/ha as the initial weed- free period was increased from 20 days after sowing (DAS) to full season. The critical period of weed competition in zero-till cotton prevailed 20 to 60 DAS during which the crop should be kept free of weeds to prevent the potential losses in seed cotton yield.

Green synthesis and characterisation of Ag NPs using aqueous extract of Phyllanthus maderaspatensis L.

In this study we consider the synthesis of silver nanoparticles (Ag NPs) from the aqueous leaf extracts of Phyllanthus maderaspatensis, which, we demonstrate, is a highly potential herb for the biosynthesis of NPs. Ag NPs were effectively produced within 24 h and NPs were characterised using UV–visible spectrophotometry, X-ray diffraction, scanning electron microscopy and Fourier transform infrared spectroscopy. Ag NPs of sizes ranging approximately between 59 and 76 nm were reported. Studies also indicated a gradual increase in the synthesis of NPs with time, thus proving the efficiency of P. maderaspatensis as an ideal catalyst in the formation of biologically synthesised phytonanoparticles.

ANTIBACTERIAL ACTIVITY OF CRUDE EXTRACTS OF VARIOUS MEDICINAL PLANTS AGAINST RESISTANT ESCHERICHIA COLI ASSOCIATED WITH URINARY TRACT INFECTIONS

The crude aqueous extracts of Phyllanthus niruri Linn., Phyllanthus maderaspatensis Linn., Euphorbia hirta Linn., Ricinus communis Linn.(red and green variety), in the present inhibited the growth of isolated nitrofurantoin resistant E.coli strains (LPM01 TO LPM08) that cause majority of UTI and which usually display above average resistance to most antibiotics and non-antibiotics antibacterial agents. The efficacy of the extracts, probably due to the identified secondary metabolites, further confirm its use as an antibacterial agent in folkloric medicine and may thus be useful in the treatment of urinary tract infections. The plant can be used as a source for oral antibacterial drugs that can treat infections caused by susceptible gram-negative bacteria. Although Ricinus communis Linn (red and green variety) were found to contain some bioactive compounds with pronounced antibacterial activities, further phytochemical and pharmacological studies will be needed to isolate the active constituents and evaluate the antimicrobial activities against a wide range of microbial pathogens.

Hepatoprotective activity of the Phyllanthus species on tert-butyl hydroperoxide (t-BH)-induced cytotoxicity in HepG2 cells

Background:Phyllanthus (Euphorbiaceae) species have long been used in folk medicine to treat various pathological conditions including liver diseases. Some species of Phyllanthus were found to exhibit hepatoprotective activity against drugs or toxins and this property was majorly attributed to phyllanthin and hypophyllanthin. In this study, we examined the hepatoprotective activity of five different species of Phyllanthus, namely, Phyllanthus amarus, Phyllanthus fraternus, Phyllanthus maderaspatensis, Phyllanthus urinaria, and Phyllanthus Rotundifolius. The extracts were also evaluated for the presence of key phytoconstituents, phyllanthin and hypophyllanthin.Materials and Methods:The extracts were evaluated for hepatoprotective activity against tert-butyl hydroxide (t-BH)-induced cytotoxicity using human hepatocarcinoma cells (HepG2 cell line).Results:Only P. urinaria and P. maderaspatensis exhibited significant hepatoprotective activity as evident from increased cell viability. The HPLC profile revealed that except P. amarus, the other extracts did not contain phyllanthin and hypophyllanthin.Conclusion:P. urinaria and P. maderaspatensis demonstrated dose-dependent hepatoprotective activity and hence, can provide promising therapeutic interventions against chemical–induced liver damage.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools

Ethnopharmacological relevance Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. Aim of the study To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward ( psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer ( trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.

Phyllanthus maderaspatensis, a dietary supplement for the amelioration of adriamycin-induced toxicity and oxidative stress in mice

The effect of ethanol extract of Phyllanthus maderaspatensis (PME), a popular south Indian dietary supplement, was studied for its chemoprotective property on adriamycin (ADR)-induced toxicity and oxidative stress in mice. Adriamycin toxicity was evaluated biochemically by measuring the serum concentration of lactate dehydrogenase (LDH) and creatinine phosphokinase (CPK). Genotoxicity was evaluated by measuring the frequency of micronucleated polychromatic erythrocytes (MNPCEs) in bone marrow cells. Oxidative stress in the heart tissue was estimated by measuring the glutathione (GSH) levels in the homogenate. The treatment of mice with different doses of PME (400 mg/kg and 600 mg/kg body weight, p.o.,) for 7 days before the administration of a single i.p. dose of ADR (15 mg/kg) exhibited significant protection in a dose-dependent manner. The results clearly indicate that PME has a protective effect against ADR-induced toxicity, as revealed by the decrease in the concentrations of LDH, CPK, and the frequency of MNPCEs. The increased levels of GSH are indicative of the antioxidant property of PME.

Hepatoprotection of Phyllanthus maderaspatensis against experimentally induced liver injury in rats

The hexane extract of Phyllanthus maderaspatensis (200 and 100 mg/kg) showed significant hepatoprotection on carbon tetrachloride and thioacetamide induced liver damage in rats. The protective effect was evident from serum biochemical parameters and histopathological analysis. Rats treated with P. maderaspatensis remarkably prevented the elevation of serum AST, ALT and LDH and liver lipid peroxides in CCl 4 and thioacetamide treated rats. Hepatic glutathione levels significantly increased by the treatment with the extracts. Histopathological changes induced by CCl 4 and thioacetamide were also significantly reduced by the extract treatment. The activity of hexane extracts of P. maderaspatensis was comparable to that of silymarin, the reference hepatoprotective drug.

Phylogenetics of tribe Phyllantheae (Phyllanthaceae; Euphorbiaceae sensu lato) based on nrITS and plastid matK DNA sequence data

Phylogenetic relationships within tribe Phyllantheae, the largest tribe of the family Phyllanthaceae, were examined with special emphasis on the large genus Phyllanthus. Nuclear ribosomal ITS and plastid matK DNA sequence data for 95 species of tribe Phyllantheae, including representatives of all subgenera of Phyllanthus (except Cyclanthera) and several hitherto unplaced infrageneric groups, were analyzed. Results for ITS and matK are generally concordant, although some species are placed differently in the plastid and ITS trees, indicating that hybridization/paralogy is involved. Results confirm paraphyly of Phyllanthus in its traditional circumscription with embedded Breynia, Glochidion, Reverchonia, and Sauropus. We favor the inclusion of the embedded taxa in Phyllanthus over further generic segregation. Monophyletic Phyllanthus comprises an estimated 1269 species, making it one of the "giant" genera. Phyllanthus maderaspatensis is sister to all other species of Phyllanthus, and the genus appears to be of paleotropical origin. Subgenera Isocladus, Kirganelia, and Phyllanthus are polyphyletic, whereas other subgenera appear to be monophyletic. Monotypic Reverchonia is sister to P. abnormis, arborescent section Emblica to herbaceous Urinaria, free-floating aquatic P. fluitans to the weed P. caroliniensis, and the phyllocladous section Choretropsis to the delicate leafy P. claussenii. The unique branching architecture known as "phyllanthoid branching" found in most Phyllanthus taxa has been lost (and/or has been derived) repeatedly. Taxonomic divisions within Phyllantheae based on similar pollen morphology are confirmed, and related taxa share similar distributions. We recommend recognition of six clades at generic level: Flueggea s.l. (including Richeriella), Lingelsheimia, Margaritaria, Phyllanthus s.l. (including Breynia, Glochidion, Reverchonia, and Sauropus), P. diandrus, and Savia section Heterosavia.

Chemoprotective Effect of Phyllanthus maderaspatensis. in Modulating Cisplatin-Induced Nephrotoxicity and Genotoxicity

The chemoprotective effect of Phyllanthus maderaspatensis. Linn (PME) was studied on cisplatin-induced nephro- and genotoxicity in male Swiss albino mice. The treatment of mice with different doses of PME (400 and 600 mg/kg body weight) for 7 days before the administration of a single i.p. dose of cisplatin (5 mg/kg) exhibited significant chemoprotective activity. Renal dysfunction was evaluated biochemically by measuring the concentration of blood urea nitrogen (BUN) and serum creatinine and histologically by light microscopy. Genotoxicity was evaluated by the bone marrow micronucleus assay. A single dose of cisplatin significantly elevated the levels of blood urea nitrogen, serum creatinine, and the kidney to body weight ratio, but pretreatment with PME (600 mg kg−1 day−1) for 7 days significantly attenuated the cisplatin-induced nephrotoxicity. The frequency of micronucleated polychromatic erythrocytes (MNPCEs) in the bone marrow was determined at 24 h after the administration of cisplatin. After administration of cisplatin, the frequency of MNPCEs distinctly increased. In mice treated with PME before cisplatin application, there was a decrease in the number of MNPCEs when compared with mice injected with only cisplatin. Ethanol extract of PME thus has a marked free radical scavenging effect indicating its antioxidative property. The results suggest that the ethanol extract of PME has a protective effect against cisplatin-induced nephro- and genotoxicity through its antioxidant property.

In vitro antioxidant activities of methanol extracts of five Phyllanthus species from India

In this study, the antioxidant activity of methanol extracts of five plants from the genus Phyllanthus was evaluated by various antioxidant assays, including total antioxidant, free radical scavenging, superoxide anion radical scavenging, hydrogen peroxide scavenging, nitric oxide scavenging, reducing power and metal ion chelating activities. The various antioxidant activities were compared to standard antioxidants such as butylated hydroxytoluene and ascorbic acid. All the extracts showed strong antioxidant activity in all the tested methods. Among the five plants Phyllanthus debilis has been found to possess the highest activity in all tested models, the activity decreased in the order Phyllanthus debilis> Phyllanthus urinaria> Phyllanthus virgatus> Phyllanthus maderaspatensis> Phyllanthus amarus. In addition to the antioxidant activity of these plants, the total phenolic compounds, flavonoids and flavonols were measured in the extracts. A correlation between the antioxidant activity and total phenolic content was observed.

Comparative pharmacognostic studies of three Phyllanthus species

Different species of Phyllanthus are considered to be very effective hepatoprotective agents in the Indian indigenous systems of medicine and are considered bitter, astringent, stomachic, diuretic, febrifuge, deobstruant and antiseptic. Still ayurvedic practitioners prescribed fresh juice of ‘Bhuiamlki’ for jaundice. Various species of Phyllanthus are being sold in India under the trade name ‘Bhuiamlki’. During market surveillance of herbal drug, it was observed that almost all the commercial samples, either comprise of Phyllanthus amarus Schum & Thonn. or Phyllanthus maderaspatensis Linn. or mixture of Phyllanthus amarus, Phyllanthus fraternus Webster. and Phyllanthus maderaspatensis. Therefore, in this context the detailed pharmacognostical evaluation of all the three species has been carried out with the aim to establish the identification markers of this important hepatoprotective agent (effective in hepatitis B too). The study conclude that all the three species can be differentiated on the basis of macro and microscopic characters, physico-chemical values, HPTLC fingerprint profile, and detection of phyllanthin and hypophyllanthin as marker components. Besides, an interesting conclusion can also be drawn that phyllanthin and hypophyllanthin said to protect hepatocytes against carbon tetrachloride and galactosamine induced toxicity, may not be exclusively responsible for hepatoprotective activity as these are present only in Phyllanthus amarus while Phyllanthus fraternus and Phyllanthus maderaspatensis also possess significant hepatoprotective activity.