Phosphorylation Of P53 Protein Research Articles

Low-Dose Metformin Treatment Reduces In Vitro Growth of the LL/2 Non-small Cell Lung Cancer Cell Line.

Lung cancer maintains a relatively small survival rate (~19%) over a 5-year period and up to 80-85% of all lung cancer diagnoses are Non-Small Cell Lung Cancer (NSCLC). To determine whether metformin reduces non-small cell lung cancer (NSCLC) LL/2 cell growth, cells were grown in vitro and treated with metformin for 48 h. qPCR was used to assess genes related to cell cycle regulation and pro-apoptotic markers, namely Cyclin D, CDK4, p27, p21, and HES1. Treatment with 10 mM metformin significantly reduced HES1 expression (p = 0.011). Furthermore, 10 mM metformin treatment significantly decreased REDD1 (p = 0.0082) and increased p-mTOR Ser2448 (p = 0.003) protein expression. Control cells showed significant reductions in phosphorylated p53 protein expression (p = 0.0367), whereas metformin treated cells exhibited reduced total p53 protein expression (p = 0.0078). There were no significant reductions in AMPK, PKB/AKT, or STAT3. In addition, NSCLC cells were treated for 48 h. with 10 mM metformin, 4 µM gamma-secretase inhibitor (GSI), or the combination of metformin (10 mM) and GSI (4 µM) to determine the contribution of respective signaling pathways. Metformin treatment significantly reduced total nucleus expression of the proliferation maker Ki-67 with an above 65% reduction in Ki-67 expression between control and metformin-treated cells (p = 0.0021). GSI (4 µM) treatment significantly reduced Ki-67 expression by ~20% over 48 h (p = 0.0028). Combination treatment (10 mM metformin and 4 µM GSI) significantly reduced Ki-67 expression by more than 50% over 48 h (p = 0.0245). As such, direct administration of metformin (10 mM for 48 h) proved to be an effective pharmaceutical agent in reducing the proliferation of cultured non-small cell cancer cells. These intriguing in vitro results, therefore, support the further study of metformin in appropriate in vivo models as an anti-oncogenic agent and/or an adjunctive therapy.

Adenosine A1 receptor agonism protection mechanism in intestinal ischemia/reperfusion injury via activation of PI3K/Akt signaling.

Intestinal ischemia/reperfusion (I/R) injury is a common clinical problem with a high mortality rate, resulting from loss of blood flow to an intestinal segment. Adenosine serves a protective role in intestinal I/R injury; however, its potential mechanism is not completely understood. The present study aimed to investigate the protective effects of adenosine A1 receptor (A1R) agonists CPA and LUF6941 and whether their mechanisms are associated with the PI3K/Akt signaling pathway. To simulate intestinal I/R injury, a cell oxygen-glucose deprivation/reoxygenation (OGD/R) model was established and the human colon cancer cell line (Caco-2) was incubated with A1R agonists before OGD/R treatment. The viability of Caco-2 cells was detected by PI and Cell Counting Kit-8 assay, apoptosis was detected using flow cytometry and western blotting was used to analyze protein expression levels of PI3K, Akt and p53 in Caco-2 cells. A1R agonist pretreatment protected Caco-2 cells against OGD/R-induced cell damage and activated PI3K/Akt signaling. Additionally, apoptosis was inhibited by downregulating phosphorylation of p53 protein, as evidenced by increased cell viability. These findings suggested that A1R agonists decreased OGD/R damage in Caco-2 cells, which may be due to their anti-apoptotic effects and activation of the PI3K/Akt/p53 signal pathway.

Antibacterial and Anti-Inflammatory Properties of Peptide KN-17.

Peri-implantitis, an infectious disease originating from dental biofilm that forms around dental implants, which causes the loss of both osseointegration and bone tissue. KN-17, a truncated cecropin B peptide, demonstrated efficacy against certain bacterial strains associated with peri-implantitis. This study aimed to assess the antibacterial and anti-inflammatory properties and mechanisms of KN-17. The effects of KN-17 on oral pathogenic bacteria were assessed by measuring its minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC). Moreover, the cytotoxicity and anti-inflammatory effects of KN-17 were evaluated. KN-17 inhibited the growth of Streptococcus gordonii and Fusobacterium nucleatum during in vitro biofilm formation and possessed low toxicity to hBMSCs cells. KN-17 also caused RAW264.7 macrophages to transform from M1 to M2 by downregulating pro-inflammatory and upregulating anti-inflammatory factors. It inhibited the NF-κB signaling pathway by reducing IκBα and P65 protein phosphorylation while promoting IκBα degradation and nuclear P65 translocation. KN-17 might be an efficacious prophylaxis against peri-implant inflammation.

Acute arsenic exposure exacerbates lipopolysaccharide-induced lung injury possibly by compromising the integrity of the lung epithelial barrier in rats

Inhalation of large amounts of arsenic can damage the respiratory tract and may exacerbate the development of bacterial pneumonia, but the exact mechanism remains unclear. In this study, male Wistar rats were randomly divided into control, arsenic trioxide (16.0 μg/kg ATO), lipopolysaccharide (0.5 mg/kg LPS), and ATO combined with LPS (16.0 μg/kg ATO + 0.5 mg/kg LPS) groups. Blood and lung tissue samples were collected from each group 12 h after exposure. The results showed that exposure to ATO or LPS alone produced different effects on leukocytes and inflammatory factors, while combined exposure significantly increased serum interleukin-6, interleukin-10, lung water content, lung lavage fluid protein, and p38 protein phosphorylation levels. Alveolar interstitial thickening, alveolar membrane edema, alveolar type I and II cell matrix vacuolization, and nuclear pyknosis were observed in rats exposed to either ATO or LPS. More severe ultrastructural changes were found in the combined exposure group, and chromatin splitting was observed in alveolar type I cells. Lanthanum nitrate particles leaked from the alveolar vascular lumen in the ATO-exposed group, whereas in the combined exposure group, Evans Blue levels were increased and lanthanum nitrate particles were present in the lung parenchyma. Claudin-3 protein expression increased and claudin-4 expression decreased after ATO or LPS exposure, while claudin-18 expression was unchanged. The changes in claudin-3 and claudin-4 protein expression were further exacerbated by combined exposure. In conclusion, these results suggest that inhalation of ATO may exacerbate the development of bacterial pneumonia and that common mechanisms may exist to synergistically disrupt epithelial barrier integrity.

Effects of resveratrol and its derivative pterostilbene on hepatic injury and immunological stress of weaned piglets challenged with lipopolysaccharide.

The present study was to investigate the protective effects of resveratrol (RSV) and its 3,5-dimethylether derivative pterostilbene (PT) against liver injury and immunological stress of weaned piglets upon lipopolysaccharide (LPS) challenge. Seventy-two weaned piglets were divided into the following groups: control group, LPS-challenged group, and LPS-challenged groups pretreated with either RSV or PT for 14 d (n = 6 pens, three pigs per pen). At the end of the feeding trial, piglets were intraperitoneally injected with either LPS or an equivalent amount of sterile saline. After 6 h of sterile saline or LPS injection, plasma and liver samples were collected. LPS stimulation caused massive apoptosis, activated inflammatory responses, and incited severe oxidative stress in the piglet livers while also promoting the nuclear translocation of nuclear factor kappa B (NF-κB) p65 (P < 0.001) and the protein expression of Nod-like receptor pyrin domain containing 3 (NLRP3; P = 0.001) and cleaved caspase 1 (P < 0.001). PT was more effective than RSV in alleviating LPS-induced hepatic damage by decreasing the apoptotic rate of liver cells (P = 0.045), inhibiting the transcriptional expression of interleukin 1 beta (P < 0.001) and interleukin 6 (P = 0.008), and reducing myeloperoxidase activity (P = 0.010). The LPS-induced increase in hepatic lipid peroxidation accumulation was also reversed by PT (P = 0.024). Importantly, inhibiting protein phosphatase 2A (PP2A) activity in a hepatocellular model largely blocked the ability of PT to prevent tumor necrosis factor alpha-induced increases in NF-κB p65 protein phosphorylation (P = 0.043) and its nuclear translocation (P = 0.029). In summary, PT is a promising agent that may alleviate liver injury and immunological stress of weaned piglets via the PP2A/NF-κB/NLRP3 signaling pathway.

Sirtuin 4 activates autophagy and inhibits tumorigenesis by upregulating the p53 signaling pathway

The role of autophagy in cancer is context-dependent. In the present study, we aimed to investigate the regulator and underlying mechanism of autophagy. We found that a sirtuin (SIRT) family member, SIRT4, was significantly associated autophagy pathway in pancreatic ductal adenocarcinoma (PDAC). Specifically, in vitro cell culture experiments and in vivo transgenic and xenografted animal models revealed that SIRT4 could inhibit tumor growth and promote autophagy in PDAC. In terms of the mechanism, we demonstrated that SIRT4 activated the phosphorylation of p53 protein by suppressing glutamine metabolism, which was crucial in SIRT4-induced autophagy. AMPKα was implicated in the regulation of autophagy and phosphorylation of p53 mediated by SIRT4, contributing to the suppression of pancreatic tumorigenesis. Notably, the clinical significance of the SIRT4/AMPKα/p53/autophagy axis was demonstrated in human PDAC specimens. Collectively, these findings suggested that SIRT4-induced autophagy further inhibited tumorigenesis and progression of PDAC, highlighting the potential of SIRT4 as a therapeutic target for cancer.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

A new peptide originated from amphibian skin alleviates the ultravioletB-induced skinphotodamage.

Although amphibian-derived bioactive peptides have attracted increasing attention for their potential use in the treatment of photodamage, research is still in its infancy. In this study, we obtained a new antioxidant peptide, named OA-GI13 (GIWAPWPPRAGLC), from the skin of the odorous frog Odorrana andersonii and determined its effects on ultraviolet B (UVB)-induced skin photodamage as well as its possible molecular mechanisms. Results showed that OA-GI13 directly scavenged free radicals, maintained the viability of hydrogen peroxide-challenged keratinocytes, promoted the release of superoxide dismutase, catalase, and glutathione, and reduced the level of lactate dehydrogenase. Furthermore, topical application of OA-GI13 in mice alleviated dorsal skin erythema and edema and protected the skin against UVB irradiation by increasing antioxidant levels and decreasing peroxide, malondialdehyde, and 8-hydroxydeoxyguanosine levels. OA-GI13 also alleviated oxidative stress injury in vivo and in vitro, possibly by inhibiting p38 protein phosphorylation. Our study confirmed the anti-photodamage effects of this novel amphibian-derived peptide, thus providing a new molecule for the development of drugs and topical agents for the treatment of skin photodamage.

The CREB and AP-1-Dependent Cell Communication Network Factor 1 Regulates Porcine Epidemic Diarrhea Virus-Induced Cell Apoptosis Inhibiting Virus Replication Through the p53 Pathway.

Porcine epidemic diarrhea virus (PEDV) infection causes severe diarrhea, dehydration, and high mortality in sick pigs, causing huge economic losses to the pig industry. However, the relationship between cell communication network factor 1 (CCN1) and PEDV infection has not been reported. In this study, we showed that the expression of CCN1 was enhanced by PEDV infection, and we observed that PEDV promotes the CREB and AP-1 activation to promote CCN1 expression. The PKA and p38 inhibitors significantly suppress CCN1 expression, indicating that PEDV-induced CCN1 expression may be through PKA and p38 pathway. Further tests confirmed that CREB and AP-1 are regulated by PKA and p38, respectively. Overexpression of CCN1 decreased the replication of PEDV, whereas knockdown of CCN1 increased the replication of PEDV. We proved that the overexpression of CCN1 increased the phosphorylation level of p53, promoted the expresion of Bax and the cleavage of caspase 9 and caspase 3, and inhibited the production of Bcl-2. CCN1 knockdown decreased the phosphorylation level of p53, inhibited the production of Bax and the cleavage of caspase 9 and caspase 3, and promoted the expression of Bcl-2. The treatment of PFT-α (p53 inhibitor) significantly suppressed the expression of cleaved caspase 9 and caspase 3, leading to the decrease of apoptosis. Together, these studies showed that PEDV promotes the activation of CREB and AP-1 to increase the expression of CCN1. Overexpression of CCN1 promotes apoptosis by elevating p53 protein phosphorylation and inhibits PEDV replication, and knockdown of CCN1 inhibits apoptosis by decreasing p53 protein phosphorylation and promotes PEDV replication. Our study could provide some reference for the molecular mechanisms of PEDV-induced CCN1 induction and supply a new therapeutic target for PEDV.

Molecular Mechanism of Biofilm Locator Protein Kinase Dbf2p-related kinase 1 in Regulating Innate Immune Response to Interleukin 17-induced Viral Pneumonia

ABSTRACT It focused on the antiviral immune regulation of biofilm-localized protein kinase Dbf2p-related kinase 1 (NDR1) in viral pneumonia. Mouse alveolar monocyte RAW264.7 was used as blank control, and viral pneumonia cell model was prepared by infecting cells with respiratory syncytial virus (RSV). NDR1 overexpression vector and siRNA interference sequences were synthesized, and overexpression/silence NDR1 cell model was fabricated. About 50 ng/mL interleukin 17 (IL-17) was given to stimulate. Enzyme-linked immunosorbent assay (ELISA), quantitative reverse transcription PCR (RT-qRCR), and Western blot were performed to detect cytokines and chemokines, mRNA of inflammatory factors, and signal molecule protein expression. Notably, RSV infection increased RSV-F mRNA in RAW264.7 cells and reduced NDR1 mRNA and protein. Secretion levels of IL-6, interferon β (IFN-β), chemokine (C-X-C motif) ligand 2 (CXCL2), and chemokine (C-C motif) ligand 2 (CCL20) increased in the model group versus blank control (P< 0.05). IL-6, IFN-β, tumor necrosis factor α (TNF-α), and toll-like receptor 3 (TLR3) mRNA were up-regulated (P < 0.05). Extracellular signal-regulated kinase (ERK1/2), p38 protein phosphorylation, human recombinant 1 (TBK1), and nuclear factor kappa-B (NF-κB) protein levels increased (P < 0.05). After overexpression of NDR1, the secretion levels of cytokines and chemokines, inflammatory factors mRNA, and signal molecule protein increased significantly. After NDR1 was silenced, cytokines and chemokines, inflammatory factors mRNA, and signal molecule protein were not significantly different versus blank control group (P > 0.05). In short, NDR1 regulated innate immune response to viral pneumonia induced by IL-17, which can be used as a new target for the treatment of IL-17-induced inflammatory response and autoimmune diseases.

Berberine increases the expression of cytokines and proteins linked to apoptosis in human melanoma cells

Melanoma is the most lethal form of skin cancer, and its incidence has increased considerably in the last decades. Melanoma presents difficult treatment with strong resistance of tumor cells, due to its extremely invasive nature with high capacity to metastases. Berberine (BBR), an isoquinoline alkaloid, is a molecule found in several medicinal plants, and has been studied in several diseases, demonstrating antimicrobial, antidiabetic and anti-inflammatory properties and anti-tumorigenic effects. In SK-MEL-28 cells, 50μM BBR treatment for 24h decreased cell viability by 50 percent. This concentration generated cell death both by early apoptosis and necrosis, with an increase in the DNA damage index. BBR increased (*p < 0.05) the proportion of cells in G1/G0 phase and decreased (###p < 0.005) the percentage of cells in S phase. The alcaloid increased (****p < 0.001) ROS production compared to untreated controls with an increase in activated caspase 3 and phosphorylated p53 protein levels. In addition, BBR significantly enhanced ERK as well as both pro- and anti-inflammatory cytokine expression compared to untreated controls. BBR has important antiproliferative effects and may be alone or in adjunct therapy a promising candidate for melanoma treatment, a cancer with great incidence and high lethality.

NF-κB regulates brown adipocyte function through suppression of ANT2

The transcription factor nuclear factor of kappa-light-chain-enhancer of activated B cells (NF-κB) is expressed in brown adipocytes, but its role remains largely unknown in the cells. This issue was addressed in current study by examining NF-κB in brown adipocytes in vitro and in vivo. NF-κB activity was increased by differentiation of brown adipocytes through elevation of p65 (RelA) expression. The transcriptional activity of NF-κB was induced by the cold stimulation with an elevation in S276 phosphorylation of p65 protein. Inactivation of NF-κB in brown adipocytes made the knockout mice [uncoupling protein 1 (Ucp1)–CreER–p65f/f, U-p65-KO] intolerant to the cold environment. The brown adipocytes exhibited an increase in apoptosis, a decrease in cristae density and uncoupling activity in the interscapular brown adipose tissue (iBAT) of p65-KO mice. The alterations became severer after cold exposure of the KO mice. The brown adipocytes of mice with NF-κB activation (p65 overexpression, p65-OE) exhibited a set of opposite alterations with a reduction in apoptosis, an increase in cristae density and uncoupling activity. In mechanism, NF-κB inhibited expression of the adenine nucleotide translocase 2 (ANT2) in the control of apoptosis. Data suggest that NF-κB activity is increased in brown adipocytes by differentiation and cold stimulation to protect the cells from apoptosis through down-regulation of ANT2 expression.

꾸지뽕나무 잎과 우슬 복합물의 골 질환 개선 소재 개발가능성에 대한 연구

This study was conducted to suggest the Cudrania tricuspidata leaf and Achyranthes japonica Nakai Complex (CAC) possibility of use as a functional natural material for improving bone disease. Cudrania tricuspidata leaf and Achyranthes japonica Nakai were mixed in the same amount, extracted with hot water, and then powdered and used in the study. After, the cytotoxicity of CAC for osteoblasts (MG63 cell), osteoclasts (differentiated RAW264.7 cell), and macrophages (RAW264.7 cell) were evaluated by MTT assay, and ALP assay and TRAP assay were performed to confirm the differentiation capacity of osteoblasts and osteoclasts, respectively. In addition, the anti-inflammatory effect in macrophages was evaluated by ELISA, qRT-PCR, and western blot assay. CAC did not proliferated osteoblasts and osteoclasts, but increased ALP activity against osteoblasts differentiation and decreased TRAP activity against osteoclasts differentiation. CAC did not proliferated macrophages but decreased nitric oxide production. Also, decreased NOS2, IL1B, IL6, PTGS2, and TNFA gene expression, and JNK and p38 protein phosphorylation in a concentration-dependent manner, but ERK protein phosphorylation was not changed. As a result, CAC increased the differentiation and activation of osteoblasts, inhibited the differentiation and activation of osteoclasts, and regulated the expression of inflammatory cytokines in macrophages. Therefore, it is thought that CAC can be used as a functional natural material that prevents bone disease and has an anti-inflammatory effect.

Green Tea Catechins Attenuate Human Primary Pterygium Cell Survival and Migration Via Modulation of ERK p42/p44 and p38 Pathways.

Pterygium belongs to an ocular surface disease with triangular-shaped hyperplastic growth, characterized by conjunctivalization, inflammation, and connective tissue remodeling. We previously demonstrated neoplastic-like properties of pterygium cells. Green tea catechin, (-)-epigallocatechin gallate (EGCG), has been shown to possess antitumorigenic properties; herein, we aimed to determine the effects of green tea catechins on human primary pterygium cell survival and migration and compared to that on patients' conjunctival cells. Both human primary pterygium and conjunctival cells expressed EGCG receptor, the 67 kDa laminin receptor. Seven-day treatment of green tea extract (Theaphenon E; 16.25 μg/mL) and EGCG (25 μM) attenuated pterygium cell proliferation by 16.78% (p < 0.001) and 24.09% (p < 0.001) respectively, without significantly influencing conjunctival cells. Moreover, green tea extract (16.25 μg/mL) and EGCG (25 μM) treatments also hindered pterygium cell migration by 35.22% (p < 0.001) and 25.20% (p = 0.019), respectively, but not conjunctival cells. Yet, green tea extract and EGCG treatments did not significantly induce pterygium cell apoptosis. Furthermore, green tea extract and EGCG treatments significantly increased the phosphorylation of p38 protein but reduced the phosphorylation of p42/p44 protein in pterygium cells. In summary, this study revealed that green tea extract and EGCG attenuated human primary pterygium cell survival and migration in vitro without damaging conjunctival cells, suggesting a novel potential therapeutic approach for primary pterygium treatment.

Molecular mechanism of Fagopyri Dibotryis Rhizoma in treatment of acute lung injury based on network pharmacology and in vitro experiments

The present study explored the mechanism of Fagopyri Dibotryis Rhizoma(FDR) and its main active components in the treatment of acute lung injury(ALI) based on the network pharmacology and the in vitro experiments. The main active components of FDR were obtained from the TCMSP database and screened by oral bioavailability and drug-likeness. The related target proteins of FDR were retrieved from the PubChem database, and the target genes related to ALI were screened out from the GeneCards database. A protein-protein interaction(PPI) network of compound target proteins and ALI target genes was constructed using STRING 11.0. Ingenuity Pathway Analysis(IPA) platform was used to analyze the common pathways of the potential compound target proteins of FDR and ALI target genes, thereby predicting the key targets and potential signaling pathways of FDR for the treatment of ALI. Finally, the potential pathways and key targets were verified by the in vitro experiments of lipopolysaccharide-induced RAW264.7 cells intervened by epicatechin(EC), the active component of FDR. The results of network pharmacology showed that 15 potential active components such as EC, procyanidin B1, and luteolin presumedly functioned in the treatment of ALI through nuclear transcription factor-κB(NF-κB) signaling pathway, transforming growth factor-β(TGF-β) signaling pathway, and adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK) signaling pathway through key targets, such as RELA(P65). The results of in vitro experiments showed that 25 μmol·L~(-1) EC had no toxicity to cells and could inhibit the expression of the p65-phosphorylated protein in the NF-κB signaling pathway to down-regulate the expression of downstream inflammatory cytokines, including tumor necrosis factor-α(TNF-α), IL-1β and nitric oxide(NO), and up-regulate the expression of IL-10. These results suggested that the therapeutic efficacy of FDR on ALI was achieved by inhibiting the phosphorylation of p65 protein in the NF-κB signaling pathway and down-regulating the level of proinflammatory cytokines downstream of the signaling pathways.

Mild Hypothermia Therapy Lowers the Inflammatory Level and Apoptosis Rate of Myocardial Cells of Rats with Myocardial Ischemia-Reperfusion Injury via the NLRP3 Inflammasome Pathway.

Objective To explore the protective effects and mechanism of mild hypothermia treatment in the treatment of myocardial ischemia-reperfusion injury. Material and Methods. A total of 20 Sprague-Dawley (SD) rats were assigned to 4 groups: the blank control group, sham operation group, ischemia reperfusion group, and mild hypothermia therapy group (each n = 5). Some indexes were detected. In addition, myocardial cell models of oxygen-glucose deprivation/reoxygenation injury (OGD) were established. The expression of mRNA IL-6 and TNF-α and the key enzyme levels of apoptosis (cleaved-Caspase-3) and the NLRP3 inflammasome/p53 signaling pathway in the models were determined. Results The expression of serum IL-6 and TNF-α in the mild hypothermia therapy group was significantly lower than that in the ischemia reperfusion group. The mild hypothermia therapy group also showed a significantly lower TUNEL cell count and NLRP3 and p53 phosphorylation levels than the ischemia reperfusion group (all p < 0.05). The in vitro mild hypothermia + OGD group also showed significantly lower mRNA expression of IL-6 and TNF-α and levels of cleaved Caspase-3, NLRP3, and phosphorylated p53 protein than the OGD group (all p < 0.05). Conclusion In conclusion, mild hypothermia therapy can inhibit the apoptosis and myocardial inflammation of cells induced by MI/R injury in rats and inhibiting the activity of the NLRP3 inflammasome pathway and p53 signaling pathway may be the mechanism.

Advanced oxidation protein products induce inflammatory responses and invasive behaviour in fibroblast-like synoviocytes via the RAGE-NF-κB pathway.

AimsRheumatoid arthritis (RA), which mainly results from fibroblast-like synoviocyte (FLS) dysfunction, is related to oxidative stress. Advanced oxidation protein products (AOPPs), which are proinflammatory mediators and a novel biomarker of oxidative stress, have been observed to accumulate significantly in the serum of RA patients. Here, we present the first investigation of the effects of AOPPs on RA-FLSs and the signalling pathway involved in AOPP-induced inflammatory responses and invasive behaviour.MethodsWe used different concentrations of AOPPs (50 to 200 µg/ml) to treat RA-FLSs. Cell migration and invasion and the expression levels of tumour necrosis factor-alpha (TNF-α), interleukin-6 (IL-6), matrix metalloproteinase-3 (MMP-3), and MMP-13 were investigated. Western blot and immunofluorescence were used to analyze nuclear factor-κB (NF-κB) activation.ResultsAOPPs promoted RA-FLS migration and invasion in vitro and significantly induced the messenger RNA (mRNA) and protein expression of TNF-α, IL-6, MMP-3, and MMP-13 in dose- and time-dependent manners. Moreover, AOPPs markedly activated the phosphorylation of nuclear factor-κB (NF-κB) p65 protein, which triggered inhibitory kappa B-alpha (IκBα) degradation, NF-κB p65 protein phosphorylation, and NF-κB p65 translocation into the nucleus. Furthermore, treatment with a neutralizing antibody specific to receptor for advanced glycation end products (RAGE) significantly suppressed aggressive behaviour and inflammation, decreased TNF-α, IL-6, MMP-3, and MMP-13 expression, and blocked AOPP-induced NF-κB pathway activation.ConclusionThe results indicate that AOPPs can enhance aggressive behaviour and the inflammatory response in RA-FLSs via the RAGE–NF-κB pathway. These results present AOPPs as a new class of potentially important mediators of progressive disease in RA patients.Cite this article: Bone Joint Res 2021;10(4):259–268.

Phenylpropanoid-conjugated pentacyclic triterpenoids from the whole plants of Leptopus lolonum induced cell apoptosis via MAPK and Akt pathways in human hepatocellular carcinoma cells

Our present and previous phytochemical investigations on Leptopus lolonum have resulted in the isolation of almost 30 phenylpropanoid-conjugated pentacyclic triterpenoids (PCPTs). During the continuous study on PCPTs, this kind of triterpenoid ester is considered as a natural product with low toxicity because of it’s widely distribution in natural plants and edible fruits including kiwi fruit, durian, jujube, pawpaw, apple and pear. In the present work, we report the isolation, structural elucidation and cytotoxic evaluation of four new PCPTs (1–4) which obtained from L. lolonum. In addition, the possible biosynthesis pathway for 28-norlupane triterpenoid and potent effect of phenylpropanoid moiety for increasing the cytotxic effect of triterpenoids were also discussed. Among these compounds, compound 1 exhibited the highest cytotoxic effect on HepG2 cells with IC50 value of 11.87 μM. Further flow cytometry and western blot analysis demonstrated that 1 caused G1 cell cycle arrest by up-regulated the expression of phosphorylated p53 protein in HepG2 cells and induced cell apoptosis via MAPK and Akt pathways. These results emphasized the potential of PCPTs as lead compounds for developing anti-cancer drugs.

The functional landscape of Golgi membrane protein 1 (GOLM1) phosphoproteome reveal GOLM1 regulating P53 that promotes malignancy

Golgi membrane protein 1 (GOLM1) was implicated in carcinogenesis of multiple types of cancer. However, Phosphoproteome landscapes of GOLM1 overexpression in lung cancer remain largely unknown. In this study, using data from the Cancer Genome Atlas (TCGA) and phosphoproteome, we systematically evaluated the feature of GOLM1 and studied its prognostic value in non-small cell lung cancer (NSCLC). The proliferation, migration, and invasion capacities in PC9 cell with GOLM1 overexpression were determined using Trans-well system assay. Tumor engrafts was visualized in mice models and confirmed by ex vivo. An increased expression of GOLM1 had shorter overall survival (OS) in patients with NSCLC in TCGA database. GOLM1 in single gene set enrichment analysis (GSEA) related to adherent’s junction, cell cycle, and pathway in cancer. Overexpression of GOLM1 in GOLM1OE PC9 cells promoted cell proliferation, migration, and invasion. Decreased migration and invasion potential were also observed in knockdown of GOLM1 in GOLM1KD PC9 cells in migration assay. An increased expression of GOLM1 could significantly increase the growth of tumor in xenograft mice models. phosphoproteome analysis showed 239 upregulated and 331 downregulated Phosphorylated proteins in GOLM1OE PC9 cells. Overexpression of GOLM1 in GSEA was significantly related to P53 in MAPK signaling pathway. Overexpression of GOLM1enhanced the phosphorylation of P53 protein at site S315 but inhibited the formation of P53 tetramers. These results indicate that overexpression GOLM1 enhances non-small-cell carcinoma aggressiveness through inhibited the formation of P53 tetramer.

Betulinic Acid Alleviates Spleen Oxidative Damage Induced by Acute Intraperitoneal Exposure to T-2 Toxin by Activating Nrf2 and Inhibiting MAPK Signaling Pathways.

T-2 toxin, which is mainly produced by specific strains of Fusarium in nature, can induce immunotoxicity and oxidative stress, resulting in immune organ dysfunction and apoptosis. Betulinic acid (BA), a pentacyclic triterpenoids from nature plants, has been demonstrated to possess immunomodulating and antioxidative bioactivities. The purpose of the study was to explore the effect of BA on T-2 toxin-challenged spleen oxidative damage and further elucidate the underlying mechanism. We found that BA not only ameliorated the contents of serum total cholesterol (TC) and triglyceride (TG) but also restored the number of lymphocytes in T-2 toxin-induced mice. BA dose-dependently reduced the accumulation of reactive oxygen species (ROS), enhanced superoxide dismutase (SOD) activity, and decreased malondialdehyde (MDA) content, as well as increased the total antioxidant capacity (T-AOC) in the spleen of T-2-toxin-exposed mice. Moreover, BA reduced inflammatory cell infiltration in the spleen, improved the morphology of mitochondria and enriched the number of organelles in splenocytes, and dramatically attenuated T-2 toxin-triggered splenocyte apoptosis. Furthermore, administration of BA alleviated the protein phosphorylation of p38, c-Jun N-terminal kinase (JNK), and extracellular signal-regulated kinases (ERK); decreased the protein expression of kelch-like erythroid cell-derived protein with CNC homology [ECH]-associated protein1 (Keap1); and increased the protein expression of nuclear factor erythroid 2 [NF-E2]-related factor (Nrf2) and heme oxygenase-1 (HO-1) in the spleen. These findings demonstrate that BA defends against spleen oxidative damage associated with T-2 toxin injection by decreasing ROS accumulation and activating the Nrf2 signaling pathway, as well as inhibiting the mitogen-activated protein kinase (MAPK) signaling pathway.