Phosphorothioate Analogues Research Articles

New aspects of formation of 1,2-cyclic phosphates by phospholipase C-δ1

Phosphoinositide-specific phospholipase C-δ1 (PI-PLC-δ1) cleaves phosphatidylinositol 4,5-bisphosphate (PI-4,5-P 2, 1), 5-phosphate (PI-5-P, 2) and 4-phosphate (PI-4-P, 3) to form the mixture of the corresponding 4,5-, 5- and 4-phosphorylated inositol 1,2-cyclic phosphate (IcP) and 1-phosphate (IP) ( 4– 6 and 7– 9, respectively). In this work, we have studied the rates of the cleavage and the ratios of the cyclic-to-acyclic phosphate products under various pH and Ca 2+ concentration conditions using 31P NMR to monitor the reactions. In agreement with the previous report (Kim et al. Biochim. Biophys. Acta 1989, 163, 177), our results indicate that the IcP/IP ratios strongly depend on the reaction conditions, with the cyclic phosphate products formed predominantly at low pH (pH 5.0) and high calcium concentration (5 mM). Surprisingly, however, we have found that at pH 8.0 and 5 mM Ca 2+, PI-5-P rather than PI-4,5-P 2 is the most preferred substrate with the highest V max. The cleavage of PI-5-P generated also more cyclic phosphate product than the other two substrates. In addition, we have studied the analogous reaction of phosphorothioate analogues of 1 with the sulfur placed in the nonbridging ( 10) or bridging ( 13) positions. We have found that the phosphorothioate analogue 10 produced exclusively the cyclic product 11, whereas the analogue 13 afforded exlusively the acyclic product 7. These results are discussed in terms of the mechanism of PI-PLC, where the cyclic product is formed by ‘leaking’ from the active site before its subsequent hydrolysis. The potential significance of the cyclic products in the signaling pathways is also discussed.

A conformationally preorganized universal solid support for efficient oligonucleotide synthesis.

A novel, conformationally preorganized nonnucleosidic universal solid support for oligonucleotide synthesis was developed. The solid support featured two chemically equivalent hydroxy groups locked in syn-periplanar orientation and orthogonally protected with 4,4'-dimethoxytrityl and acetyl groups. The solid support was extensively tested in the preparation of oligonucleotides and their phosphorothioate analogues containing 2'-deoxy, 2'-O-methyl, and 2'-O-methoxyethylnucleoside residues at the 3'-terminus. Upon completion of oligonucleotide chain assembly, the support-bound oligonucleotide material was treated with concentrated ammonium hydroxide, which removed the O-acetyl protection. The deprotected hydroxy group then effected the transesterification of a phosphate linkage between the solid support and the 3'-terminal nucleoside residue to result in a facile release of the oligonucleotide to solution. The kinetics of the release process was studied in a continuous flow of concentrated aqueous ammonium hydroxide at a temperature of 300.15 K. Optimal conditions for the release of oligonucleotides depending on the chemistry of the backbone and 3'-terminal nucleoside residue were formulated.

Distribution and anti-HBV effects of antisense oligodeoxynucleotides conjugated to galactosylated poly-L-lysine.

To describe distribution of the phosphorothioated antisense oligodeoxynucleotides (PS-asODNs) conjugated to galactosylated poly-L-lysine (Gal-PLL) in mice, and to observe their effects on expression of HBV gene in the 2.2.15 cells and transgenic mice. According to the result of direct sequencing of PCR amplified products, a 16 mer phosphorothioate analogue of the antisense oligodeoxynucleotides (PS-asODNs) directed against the HBV U(5)-like region was conjugated to the hepatotropic Gal-PLL molecules. Its distribution was demonstrated using asODNs labeled with (32)P at the 5' terminus with a T4-polynucleotide Kinase. Its inhibition effect on HBV expression was observed in the transfected 2.2.15 cells and transgenic mice. The Gal-PLL and asODNs could form stable complex at a molar ratio of 2:1. As shown in the HBV-transfected 2.2.15 cells, the inhibition effects of asODNs alone and asODNs conjugated to Gal-PLL, at 10 micromol/L for both, on HBsAg and HBeAg production were different,the former being 70 % and 58 %, respectively, and the latter being 96 % and 82 %, respectively. A more pronounced reduction was also observed in viral DNA load in the culture supernatant for the test with Gal-PLL-asODNs. Among many mouse organs, livers retained more asODNs molecules after administration. The preferential concentration in liver was found to be 52.14 % for Gal-PLL-asODNs, as high as 2.38-fold of that for asODNs (21.9 %). Both elements decreased gradually in liver, with 2.9 % of the former, 5.99 % of the latter retained 24 hours after the administration. The injection interval, therefore, was recommended to be 24 hours. In the transgenic mice, serum HBsAg decreased significantly (P<0.01) at the 12th day after administrating Gal-PLL- asODNs, the serum HBV DNA turned negative in 4 of the 6 mice. Antisense oligodeoxynucleotides conjugated to Gal-PLL can be concentrated in liver and intaked by hepatocytic cells. This may result in specific inhibition of expression and replication of HBV in vitro and in vivo.

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

DNAzymes to β1 and β3 mRNA Down-regulate Expression of the Targeted Integrins and Inhibit Endothelial Cell Capillary Tube Formation in Fibrin and Matrigel

A novel approach based on DNA-cleaving deoxyribozymes (DNAzymes) was developed to control expression of beta(1) and beta(3) integrins in endothelial cells. To engineer a specific cleavage site in mRNA, the flanking domains of DNAzymes were derived from oligodeoxynucleotides complementary to sequences corresponding to 1053-1070 and 1243-1267 in beta(1) and beta(3) mRNA, respectively. Phosphorothioate analogues of these antisense oligodeoxynucleotides, designated beta1-1053 and beta3-1243, significantly inhibited expression of beta(1) and beta(3) integrin subunits in endothelial and K562 cells at the level of mRNA and protein synthesis. They also specifically decreased the cell surface expression of corresponding subunits in endothelial cells and K562 cells, as measured by flow cytometry. In functional tests, beta1-1053 and beta3-1243 markedly reduced adhesion of cells to fibronectin and vitronectin, respectively. We designed DNAzymes to beta(1) and beta(3) mRNAs containing a 15-deoxynucleotide catalytic domain that was flanked by two substrate recognition segments of 8 and 10 deoxynucleotides for beta(1) and beta(3) DNAzymes, respectively. Both DNAzymes in the presence of Mg(2+) specifically cleaved their substrates, synthetic beta(1) and beta(3) mRNA fragments. Although DNAzymes were partially modified with phosphorothioate and with 2'-O-methyl groups at both the 5' and 3' ends indicated similar kinetic parameters, they were significantly more potent than the unmodified DNAzymes because of their much higher resistance to nuclease degradation. Similar to the antisense oligonucleotides, DNAzymes abolished microvascular endothelial cell capillary tube formation in fibrin and Matrigel. In conclusion, DNAzymes to beta(1) and beta(3) mRNAs with 2'-O-methyl modifications are potentially useful as gene-inactivating agents and may ultimately provide a therapeutic means to inhibit angiogenesis in vivo.

Antisense hairpin loop oligonucleotides as inhibitors of expression of multidrug resistance-associated protein 1: their stability in fetal calf serum and human plasma.

Multidrug resistance-associated protein (MRP1) is a transmembrane pump protein responsible for the efflux of chemotherapeutic drugs, an important cause of anticancer treatment failure. Trying to circumvent MRP-mediated resistance we designed and synthesized hairpin loops forming antisense oligodeoxyribonucleotides (ODNs), both phosphodiesters (PO-ODNs) and their phosphorothioate analogues (PS-ODNs), to reduce the protein expression by targeting its mRNA in a sequence specific manner. Melting temperature measurements as well as polyacrylamide gel electrophoresis supported the preferential formation of a secondary structure, which was expected to protect ODNs against 3'-exonuclease degradation. ODNs and PS-ODNs designed in this work were successfully tested as antisense inhibitors of the expression of MRP1 in the leukaemia HL60/ADR cell line. Foreseeing the necessity to perform clinical studies with such ODNs we investigated their stability against the 3'-exonuclease activity of fetal calf serum and human plasma. Under the conditions, corresponding to physiological ones, we observed high stability of hairpin loop forming ODNs, especially those containing longer (e.g. 7 base pair) stems. Comparative studies on the stability of chemically unmodified hairpin loop forming ODNs and their PS-counterparts indicated that endonuclease activity did not play any important role in the process of their nucleolytic degradation. Our studies provide strong evidence for high stability of chemically unmodified hairpin loop ODNs, making them an attractive alternative to phosphorothioate analogues commonly used in antisense strategy.

Investigation of antisense DNA having C-5 polyamine substituted 2'-deoxyuridine derivative.

Phosphorothioate analogs of oligodeoxyribonucleotide (S-ODN) bearing non-branched polyamine molecule at C-5 position of certain pyrimidine base were synthesized. The synthesis of the modified S-ODNs was accomplished via post-synthetic modification method utilizing C-5 methoxycarbonylmethyl substituted deoxyuridine derivative with modest yields. The thermal stability of the dulexes containing modified S-ODNs was assessed through the measurement of the melting points (Tms). Interestingly, the Tms of the modified oligomers were considerably lower than that of the corresponding unmodified oligomer at relatively high concentration range. At lower concentration, on the other hand, the Tms of the modified S-ODNs were higher than that of the unmodified oligomer.

The mononucleotide-dependent, nonantisense mechanism of action of phosphodiester and phosphorothioate oligonucleotides depends upon the activity of an ecto-5′-nucleotidase

Many reports indicate different nonantisense yet sequence-specific effects of antisense phosphorothioate oligonucleotides. Products of enzymatic degradation of the oligonucleotides can also influence cell proliferation. The cytotoxic effects of deoxyribonucleoside-5'-phosphates (dNMPs) and their 5'-phosphorothioate analogs, deoxyribonucleoside-5'-monophosphorothioates (dNMPSs) on 4 human cell types (HeLa, HL-60, K-562, and endothelial cells) were examined, and the effects were correlated with the catabolism of these compounds. The results indicate that differences in cytotoxicity of dNMPs or dNMPSs in these cells depend upon different activity of an ecto-5'-nucleotidase. It has also been found that dNMPSs stimulate proliferation of human umbilical vein endothelial cells and HL-60 cells in a concentration-dependent manner. This stimulation might be caused by the binding of deoxynucleoside-5'-phosphorothioates to as-yet unidentified nucleotide receptor(s) at the cell surface. (Blood. 2001;98:995-1002)

The 4-oxopentyl group as a labile phosphate/thiophosphate protecting group for synthetic oligodeoxyribonucleotides

An efficient and economical method for the solid-phase synthesis of oligodeoxyribonucleotides and their phosphorothioate analogues is described. The method entails the use of the 4-oxopentyl group for phosphate/thiophosphate protection. Post-synthesis removal of the protecting group is easily and rapidly achieved under mild conditions at ambient temperature using either pressurized gaseous amines or concentrated ammonium hydroxide.

Effects of intrathecal c-fos antisense oligodeoxynucleotide on adjuvant-induced thermal hyperalgesia.

We examined the effects of intrathecally preadministered injections of a phosphorothioate analog of c-fos antisense and mismatch oligodeoxynucleotides (ODNs) on the withdrawal latency to a thermal stimulus following unilateral injection of complete Freund's adjuvant (CFA) into the hind footpad of rats. Pretreatment with the c-fos antisense ODN significantly decreased the CFA-induced expression of c-Fos protein dose-dependently in ipsilateral laminae I/II (LI/II) of the dorsal horn (mean +/- SEM per section: 10 nM ODN, 43.9+/-1.3; 25 nM ODN, 19.4+/-4.1) compared with pretreatment with the mismatch ODN (63.6+/-2.9; 60.6+/-4.0) or saline (56.6+/-5.5). Animals pre-treated with 25 nM of the c-fos antisense ODN significantly increased the withdrawal latency to the noxious thermal stimulation (63.0-70.5%; compared with contralateral to the CFA injection) compared with animals pretreated with mismatch ODN (28.5-42.6%) or saline (26.4-45.3%) from 0 to 5 h after unilateral injection of CFA into the hind footpad. Pretreatment with 10 nM antisense ODN had a less significant effect. These results indicate that the expression of CFA-induced c-Fos in the dorsal horn might facilitate thermal nociception.

On-line coupling of capillary gel electrophoresis with electrospray mass spectrometry for oligonucleotide analysis.

Homooligodeoxyribonucleotides differing one nucleotide in length from 12- to 15-mer and from 17- to 20-mer were separated by size with capillary gel electrophoresis (CGE) using an entangled polymer solution in coated capillaries. The resolved components were analyzed by on-line coupling of CGE with electrospray mass spectrometry (ES-MS), denoted as CGE/ES-MS, in the full-scan negative ion detection mode. Baseline separation was achieved for the 12-15-mer oligonucleotide mixtures. Both synthetic phosphodiester oligonucleotide mixtures as well as their phosphorothioate analogues, serving as model compounds for antisense oligonucleotides, could be analyzed by on-line CGE/ES-MS coupling. Terminally phosphorylated and nonphosphorylated synthetic failure sequences could be electrophoretically separated and mass spectrometically characterized as well. This methodology might be a useful tool for synthesis control of phosphodiester oligonucleotides as well as for analysis of phosphorothioate analogues as they are used in antisense drug development.

Novel 3',5'-cyclic nucleotide analogue: adenosine 3',5'-cyclic boranomonophosphate.

A general procedure for the first synthesis of a 3',5'-cyclic boranomonophosphate was established. Specifically, adenosine 3',5'-cyclic boranomonophosphosphate (cyclic AMPB, 4c), a P-borane (BH(3)) analogue of adenosine 3',5'-cyclic monophosphate (cAMP), was synthesized via a phosphite approach in good yield. The method is also applicable for syntheses of natural cAMP and its phosphorothioate analogue. The two diasteromers of cyclic AMPB 4c were separated, and their chemical structures were established via spectroscopic methods.

Phosphoramidite coupling to oligonucleotides bearing unprotected internucleosidic phosphate moieties.

The coupling of 2-cyanoethyl thymidine phosphoramidite to solid-support-bound, phosphate-unprotected oligothymidylates and their phosphorothioate analogues was studied. The yield of the coupling reaction depended on the pK(BH)()+ values of protonated nitrogen bases that served as counterions to the phosphodiester functions of oligonucleotides. To maximize the coupling efficiency, the oligonucleotides were detritylated and washed with a mixture of 0.1 M DMAP and 0.1 M 1H-tetrazole, which resulted in a 98+% coupling efficiency. The utility of the results was demonstrated in the preparation of oligonucleotides with a mixed backbone that required the successive use of H-phosphonate and phosphoramidite methods of synthesis. Using this approach, 20-mer antisense oligonucleotides containing 2'-O-(2-methoxyethyl) ribonucleoside residues and phosphorothioate and phosphoramidate internucleosidic linkages were synthesized in high yield.

2-Benzamidoethyl group--a novel type of phosphate protecting group for oligonucleotide synthesis.

A number of 5'-O-(4,4'-dimethoxytrityl)thymidine N,N-diisopropylamino phosphoramidites protected at P(III) with derivatives of 2-benzamidoethanol were synthesized and incorporated into synthetic oligonucleotides. Depending on substitution patterns at the alkyl chain, amido group, and phenyl ring, the time required for removal of these protecting groups using concentrated ammonium hydroxide varied from 48 h at 55 degrees C to 25 min at 25 degrees C. Of the 11 groups studied, 2-[N-isopropyl-N- (4-methoxybenzoyl)amino]ethyl- (H) and omega-(thionobenzoylamino)alkyl protections (I and K) were most easily removed. Derivatives of the 2-[N-methyl-N-benzoylamino]ethyl group (E-G) demonstrated moderate stability, but those of the 2-(N-benzoylamino)ethyl group (A-C) were the most stable. For the most reactive group, H, a phosphitylating reagent, bisamidite 60, was synthesized and used in the preparation of four deoxynucleoside phosphoramidites 28 and 65-67, plus the 2'-O-(2-methoxyethyl)-5-methyluridine phosphoramidite 68. All of these novel building blocks were successfully tested in the preparation of natural, 20-mer oligonucleotides and their phosphorothioate analogues. With the model phosphotriester 37, the mechanism of deprotection was studied and revealed, in the case of group H, a pH-independent formation of the 2-oxazolinium cation 47. Under aqueous conditions, 47 gave 54, which in turn was converted in the presence of ammonia to a number of identified products. It is important to note that none of the products formed was reactive toward the oligonucleotide backbone or nucleic bases. Thus, a general strategy for protection of internucleosidic phosphodiester groups is described, which may also find application in synthetic organic chemistry of phosphorus(III) and (V).

Design of nuclease resistant protein kinase cα DNA enzymes with potential therapeutic application

For the therapeutic application of catalytic nucleic acids it is desirable to have small, stable and inexpensive compounds that are active at physiological Mg 2+ concentrations. We have explored the possibility of using the versatile 10–23 DNA catalytic core to suppress the expression of the protein kinase Cα (PKCα) isoform in malignant cells. By introducing either a 3′-3′-inverted thymidine nucleotide or site-specific phosphorothioate modification into a PKCα DNA enzyme, we have designed stable catalysts that retained a significant in vitro cleavage activity. In particular, a DNA enzyme containing phosphorothioate analogues in the antisense arms and in the pyrimidine residues of the catalytic core was found to be remarkably stable in 50 % human serum ( t 1/2 > 90 hours) and inhibited in vitro cell growth by up to 90 % at nanomolar concentrations. The inhibition of PKCα gene expression is sequence-specific, as a DNA enzyme with reversed antisense arms was found to be ineffective. Epifluorescence microscopic analysis of cells transfected with a 5′ fluorescein isothiocyanate-conjugated DNA enzyme showed that the DNA enzyme molecules are mainly localised in the nuclei. Most of the DNA enzyme-treated cells were killed by apoptosis. The ability of the described PKCα DNA enzymes to trigger apoptosis (apoptozymes) in malignant cells illustrates their therapeutic potential. Furthermore, such agents can be a valuable tool for probing gene function.

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.

A novel lysophosphatidic acid analog, LXR-1035, inhibits leukocyte-endothelium interaction via inhibition of cell adhesion molecules.

A novel synthetic phosphorothioate analog of oleoyl lysophosphatidic acid LXR-1035 was studied for its ability to modulate leukocyte-endothelial cell interactions using intravital microscopy of the rat mesentery. Superfusion of the rat mesentery with 50 microM L-NAME elicited a significant, time-dependent increase in leukocyte rolling, adherence, and transmigration compared to control rats superfused with Krebs-Henseleit solution. However, superfusion of the rat mesentery with 300 nM LXR-1035 consistently attenuated 65-87% of the L-NAME-induced leukocyte rolling, adherence, and transmigration, without altering systemic blood pressure or mesenteric venular shear rate. Similar results were also obtained in rats subjected to 90 min of hemorrhage followed by 90 min of reperfusion. Resuscitation from hemorrhage increased significantly the number of rolling, adherent, and transmigrated leukocytes in the rat mesenteric microcirculation. However, superfusion of the rat mesentery with LXR-1035 markedly attenuated the leukocyte-endothelium interaction occurring after hemorrhage and reinfusion by 75+/-12%. Immunohistochemical localization of P-selectin expression on mesenteric venular endothelium was significantly increased after exposure to L-NAME and after hemorrhage-reinfusion, which was significantly attenuated by LXR-1035 (P<0.05). In addition, treatment of isolated rat neutrophils with 300 nM LXR-1035 significantly attenuated leukotriene B4-induced up-regulation of CD18 (P<0.05). Our data clearly demonstrate that LXR-1035 can potently inhibit the recruitment of leukocytes in the mesenteric rat microvasculature by attenuating cell-surface expression of adhesion molecules.

M-DNA: pH Stability, Nuclease Resistance and Signal Transmission

In the presence of divalent metal ions (Zn2+, Co2+, and Ni2+) and at pHs above 8, duplex DNA forms a complex called M-DNA. M-DNA can be converted back to B-DNA by addition of EDTA or lowering the pH. The stability of M-DNA depends on the metal ion and/or the sequence of DNA. For calf thymus DNA the order of stability with decreasing pH is: Ni2+> Co2+>Zn2++. The interconversion with B-DNA shows hysteresis; once formed Ni-M- DNA remains stable for more than one hour at pH 7, but conversion of B-DNA to M-DNA is slow at pHs below 8. Among synthetic sequences, poly[d(AT)] does not form M-DNA whereas the phosphorothioate analogues form only at pH 9.0. In contrast, the Ni-M-DNA form of poly[d(GC)] is stable even at pH 6.5. Ni-M-DNA is resistant to cleavage by DNase I whereas B-DNA is digested rapidly under identical conditions. The Co2+ and Ni2+ forms of M-DNA were paramagnetic with increased mass susceptibilities (χ) compared to other metal complexes. Signal transmission in M-DNA was tested by constructing duplexes of 54 base pairs with fluorescein (donor) at one end and rhodamine (acceptor) at the other. Quenching of fluorescein fluorescence was observed for the Zn2+ form of M-DNA only when the DNA was labeled with both donor and acceptor. Therefore, the pathway of quenching maybe via electron transfer. Taken together, these results suggest that M-DNA is a distinct conformation with tightly bound metal ions, and certain forms may be stable under physiological conditions. Furthermore, M-DNA may be used as a molecular wire for signal transmission over long distances.

ChemInform Abstract: The H‐Phosphonate Approach to the Synthesis of Oligonucleotides and Their Phosphorothioate Analogues in Solution.

AbstractChemInform is a weekly Abstracting Service, delivering concise information at a glance that was extracted from about 100 leading journals. To access a ChemInform Abstract of an article which was published elsewhere, please select a “Full Text” option. The original article is trackable via the “References” option.

Comparative evaluation of99mTc-MAG2-oligodeoxynucleotides with phosphodiester or phosphorothioate backbones: preparation, stability and biodistribution

Antisense oligodeoxynucleotides (ODNs) conjugated to a suitable bifunctional chelating agent and labelled with a suitable radionuclide could become useful in the diagnosis and differentiation of cancers. Radiolabelled natural DNA with phosphodiester (PO) backbone is a candidate for use in imaging, while phosphorothioate (PS) ODNs already are proving their efficacy in antisense therapy. In this study, two PO and two PS ODNs have been conjugated with the N2SO chelator MAG2 in a procedure designed to make a N3S tetraligand which forms stable complexes with technetium-99m. Depending on the S-protecting group used and reaction conditions employed, labelling yields of more than 90% can routinely be obtained. The 99mTc-MAG2-ODNs are stable in solution, even in the presence of a 30-fold excess of cysteine. However, at higher concentrations of cysteine and in foetal calf serum they are not stable. In vivo in mice, the PO 99mTc-MAG2-ODNs are degraded more than 50% in 5 min, while the PS analogues remain intact. The PS and PO 99mTc-MAG2-ODNs are distributed in a similar fashion in normal mice, except for a higher liver retention of the PO 99mTc-MAG2-ODNs at 60 min. Copyright © 1999 John Wiley & Sons, Ltd.