Phosphatase And Tensin Homolog Deleted On Chromosome Ten Research Articles

Abstract 4686: Synergistic effect of olaparib (AZD2281) with combination of cisplatin on PTEN-deficient lung cancer cell lines

Abstract Poly(ADP-ribose) polymerase (PARP) enzyme plays a key role in the cellular machinery responsible for DNA damage repair. Although inhibition of this enzyme using a pharmacological inhibitor is postulated to enhance the cytotoxicity of DNA-damaging cytotoxic chemotherapy, this has not been profoundly studied in lung cancer. PTEN (phosphatase and tensin homologue deleted on chromosome ten) is a tumor-suppressor gene deactivating PI3K downstream of EGFR (epidermal growth factor receptor) signaling. Approximately 2% to 9% of non-small cell lung cancers (NSCLC) are considered to have PTEN loss, and a recurrent gross-mutation of the PTEN gene is identified in lung cancer with deficient DNA double-strand break repair. We hypothesize that there is a cellular threshold for error-free DNA-repair in lung cancer cells and that the absence of PTEN can sensitize these cells to a concurrent treatment of a DNA-damaging agent (cisplatin) and a PARP inhibitor (olaparib). To investigate the effect of olaparib and cisplatin on PTEN deficient lung tumors, two EGFR mutant (deletion in exon19) NSCLC cell lines, PC-9 (PTEN wild type) and NCI-H1650 (PTEN loss) were used. Two additional cell lines with PTEN loss, prostate cancer cell line (PC-3) and glioblastoma cell line (U-87MG) were also examined. We transfected intact PTEN gene into H1650 cells and knocked down PTEN expression in the PC-9 cells using shRNA. Antiproliferative activity was determined by MTT assay in terms of 50% inhibitory concentration (IC50) values. Olaparib alone was not effective for H1650 cells and other PTEN-deficient cells. IC50 values ranged from 6 to 40 μM for olaparib and from 0.2 to 2 μM for cisplatin. Combination of cisplatin with olaparib showed a synergistic effect in vitro according to the combination index (CI). CIs were 0.23, 0.20, 0.57 and 0.29 when concentration ratios of cisplatin and olaparib were designed to be molar ratios of 1:1, 1:2, 1:3 and 1:5, respectively. Restoration of PTEN in the H1650 cells decreased sensitivity to olaparib and cisplatin (CI >1). Ablation of PTEN in PC-9 cells increased sensitivity to olaparib and cisplatin (CI <1). We also examined the effectiveness of the cisplatin (5 mg/kg/week) and olaparib (50 mg/kg/day) in a xenograft model using H1650 cells. The combination of cisplatin with olaparib was more effective than each agent individually. This effect was not observed in a xenograft model using PTEN transfected H1650 cells. Mechanistic investigations revealed that PTEN-deficiency caused a reduction in radiation-induced nuclear RAD51 focus formation and activation of Chk1 S345. Thus, genetic inactivation of PTEN led to suppression of DNA repair. The combination of cisplatin with olaparib in PTEN deficient lung tumors should be further pursued. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 4686. doi:1538-7445.AM2012-4686

Abstract 3473: Beta catenin inhibitor ICG-001 attenuates proliferation of hepatic tumor initiating cells in Pten deficient models

Abstract Progenitor or tumor initiating cells (TICs) are “altered” stem cells with the capacity to form solid tumors. Tumor suppressor PTEN (phosphatase and tensin homologue deleted on chromosome ten) is aberrantly expressed in liver cancers. Liver specific Pten (Pm) mice develop liver cancer following an extensive phase of chronic lipid accumulation and demonstrate escalating levels of hepatic injury markers from 6-12M, prior to hepatic progenitor cell proliferation. In addition, TUNEL analysis revealed that hepatocytes from Pm mice undergo extensive apoptosis relative to control mice. We hypothesize that hepatocyte cell death induced by hepatic injury presents an opportunity for TICs to proliferate and consequently form mixed lineage tumors. Attenuation of hepatic injury by Akt2 deletion reduces progenitor cell proliferation and delays tumor development. Our analyses also revealed that the Wnt/β-Catenin signaling pathway is the likely molecular mediator of TIC proliferation in our Pm model. Wnt ligands including 7a and 10a as well as Wnt signaling receptor Fzd 2 are induced. In this study, we investigate the role of the Wnt/β-Catenin pathway in the activation of hepatic progenitor cells in the Pten deletion liver cancer model using novel Wnt/β-catenin inhibitor ICG-001. ICG-001 is a small molecule which specifically inhibits β-Catenin/CBP interaction. Coactivator CBP/β-Catenin/T cell factor (TCF) mediated transcription has been reported as critical for stem cell/progenitor cell proliferation. Here we demonstrate that ICG-001 significantly attenuates proliferation of hepatic cancer stem cell line P0 in vitro and also inhibits hepatotoxin induced proliferation of hepatic TICs in vivo in liver Pten null mice. Our preliminary results indicate that targeting the cancer stem cell niche may prove to be a viable approach to inhibit liver tumorigenesis. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 3473. doi:1538-7445.AM2012-3473

Ndfip1 regulates nuclear Pten import in vivo to promote neuronal survival following cerebral ischemia

PTEN (phosphatase and tensin homologue deleted on chromosome TEN) is the major negative regulator of phosphatidylinositol 3-kinase signaling and has cell-specific functions including tumor suppression. Nuclear localization of PTEN is vital for tumor suppression; however, outside of cancer, the molecular and physiological events driving PTEN nuclear entry are unknown. In this paper, we demonstrate that cytoplasmic Pten was translocated into the nuclei of neurons after cerebral ischemia in mice. Critically, this transport event was dependent on a surge in the Nedd4 family-interacting protein 1 (Ndfip1), as neurons in Ndfip1-deficient mice failed to import Pten. Ndfip1 binds to Pten, resulting in enhanced ubiquitination by Nedd4 E3 ubiquitin ligases. In vitro, Ndfip1 overexpression increased the rate of Pten nuclear import detected by photobleaching experiments, whereas Ndfip1(-/-) fibroblasts showed negligible transport rates. In vivo, Ndfip1 mutant mice suffered larger infarct sizes associated with suppressed phosphorylated Akt activation. Our findings provide the first physiological example of when and why transient shuttling of nuclear Pten occurs and how this process is critical for neuron survival.

A novel class of PTEN protein in Arabidopsis displays unusual phosphoinositide phosphatase activity and efficiently binds phosphatidic acid

PTEN (phosphatase and tensin homologue deleted on chromosome ten) proteins are dual phosphatases with both protein and phosphoinositide phosphatase activity. They modulate signalling pathways controlling growth, metabolism and apoptosis in animals and are implied in several human diseases. In the present paper we describe a novel class of PTEN pro-teins in plants, termed PTEN2, which comprises the AtPTEN (Arabidopsis PTEN) 2a and AtPTEN2b proteins in Arabidopsis. Both display low in vitro tyrosine phosphatase activity. In addition, AtPTEN2a actively dephosphorylates in vitro the 3' phosphate group of PI3P (phosphatidylinositol 3-phosphate), PI(3,4)P2 (phosphatidylinositol 3,4-bisphosphate) and PI(3,5)P2 (phosphatidylinositol 3,5-bisphosphate). In contrast with animal PTENs, PI(3,4,5)P3 (phosphatidylinositol 3,4,5-trisphosphate) is a poor substrate. Site-directed mutagenesis of AtPTEN2a and molecular modelling of protein-phosphoinositide interactions indicated that substitutions at the PTEN2 core catalytic site of the Lys267 and Gly268 residues found in animals, which are critical for animal PTEN activity, by Met267 and Ala268 found in the eudicot PTEN2 are responsible for changes in substrate specificity. Remarkably, the AtPTEN2a protein also displays strong binding activity for PA (phosphatidic acid), a major lipid second messenger in plants. Promoter::GUS (β-glucuronidase) fusion, transcript and protein analyses further showed the transcriptional regulation of the ubiquitously expressed AtPTEN2a and AtPTEN2b by salt and osmotic stress. The results of the present study suggest a function for this novel class of plant PTEN proteins as an effector of lipid signalling in plants.

Clinical significance of PTEN and B7-H1 expressions in pancreatic carcinoma

Objective To investigate the probable correlation between the expressions of phosphatase and tensin homologue deleted on chromosometen (PTEN) and B7-H1 protein in pancreatic carcinoma and the biological behavior characteristics of tumors. Methods Forty-three patients were recruited who had undergone surgical resection for pancreatic carcinoma between 2002 and 2009. The PTEN and B7-H1 protein expressions in the tissue specimens of these 43 patients and 5 non-pancreatic carcinoma people' s pancreatic tissue specimens were evaluated by immunohistochemistry ELPS technique, and the clinical and pathological features of these specimens and the follow-up information were analyzed. Results PTEN expressions were significantly lower in pancreatic carcinoma tissues than in non-pancreatic carcinoma people' s pancreatic tissues but B7-H1 expressions were significantly higher ( P ＜ 0. 01 ). The expression of PTEN was negatively correlated to that of B7-H1 (r = -0.414 ,P ＜0. 01). PTEN and B7-H1 expressions correlated with the pathological grade and tumor-node-metastasis ( TNM ) stage, peripancreatic invasion, regional lymph node involvement,respectively (P＜0. 05). B7-H1 expressions also significantly correlated with the ages (P＜0. 01). Furthermore, PTEN and B7-H1 expressions showed significant prognostic effects (P＜0.01) and there are correlations existed between combined PTEN/B7-H1 expression and prognostic effects (P ＜0. 05). Conclusion The expression of PTEN and B7-H1 may be significantly correlated to the carcinogenesis,development and prognosis of pancreatic carcinoma. Key words: Pancreatic cancer; PTEN; B7-H1; Biological behavior characteristics

PTEN (phosphatase and tensin homolog deleted on chromosome ten)

Review on PTEN (phosphatase and tensin homolog deleted on chromosome ten), with data on DNA, on the protein encoded, and where the gene is implicated.

Dispensable role of PTEN in mouse spermatogenesis

PTEN (phosphatase and tensin homologue deleted on chromosome ten) plays critical roles in multiple cellular processes, including cell proliferation, survival, migration and transformation. A role of PTEN in mammalian spermatogenesis, however, has not been explored. To address this question, we generated a mouse model with PTEN conditional knockout in postnatal male germ cells. We found that spermatogenesis was normal in PTEN-deleted male germ cells. PTEN conditional mutant males produced sperm and sired offspring as competently as wild-type littermates. Moreover, our biochemical analysis also indicated that the Akt (acutely transforming retrovirus AKT8 in rodent T cell lymphoma) signalling pathway was not affected in mutant testis. Taken together, these findings demonstrate that PTEN is dispensable in mouse spermatogenesis.

Research of PTEN mutation in glioma stem/progenitor cells

Objective More and more attention has been given to the presumption that glioma stem cells (GSCs) originate from neural stem cells (NSCs) with gene mutation, however, there is no enough evidence by now. This paper aims to get evidence of this area. Methods Glioma stem/progenitor cells (GSPCs) and neural stem/progenitor cells (NSPCs) were cultivated in vitro, and were identified before the following studies. Total RNA was isolated and then reverse⁃transcribed into cDNA, with primers specific to phosphatase and tensin homolog deleted onchromosome ten (PTEN), high⁃fidelity Taq polymerase was used for the polymerase chain reaction (PCR) to avoid the incorporation of pseudomutation. After amplification, 10 μl of the reaction mixture was electrophoresed through 1.5% agarose gel, and the rest of the reaction mixture was used for sequencing in both directions. The procedures for the isolation of total RNA to PCR and sequencing were repeated twice, and the sequencing results of both DNA and PTEN peptide chain were analysed with DNAssist 1.0 software and compared to the sequence of wild⁃type Homo Sapiens PTEN in GenBank. Results No mutation happened in the PTEN of NSPCs, but there were many base mutations in the mRNA of PTEN of GSPCs compared with the wild⁃type Homo Sapiens PTEN. Though most of these mutations were same sense mutation, still several mutations were not, including the normal DNA bases of PTEN bases 22 to 42 ATCGTTAGCAGAAACAAAAGG in first exon mutated into CTACGATTGATTTGCATCTTT, base 712 T in exon 7 mutated into C, and base 1192 A in exon 9 mutated into T. Accordingly, for the amino acids (AA) sequence in the peptide chain of PTEN, the mutation included AA from the 8th to the 14th (from IVSRNKR to LRLICIF), the 238th AA (from F to L), and the 398th AA (from T to S). These mutated regions were involved in membrane interaction, particularly the combination with phosphatidylinositol 4, 5⁃biphosphate (PIP2) and maintaining the protein stability of PTEN. Therefore, these mutations not only lead to the rapid degradation of PTEN, but also hinder the cellular function of PTEN to down⁃regulate phosphoinostide 3⁃kinase (PI3K) signaling. Conclusion The mutation of PTEN occurs even in the early stage of malignant transformation, which is probably an initiating agent for the tumorigenesis of gliomas. DOI：10.3969/j.issn.1672-6731.2010.06.014

Enhance tumor radiosensitivity by intracellular delivery of eukaryotic translation initiation factor 4E binding proteins

PTEN (phosphatase and tensin homologue deleted on chromosome ten)/PI3K (phosphatidylinositol 3-kinase)/Akt/mTOR (mammalian target of rapamycin) signaling pathway, which is commonly dysregulated in a broad array of human malignancies, controls the assembly of eukaryotic translation initiation factor 4F (eIF4F) complex through regulation of eIF4E binding proteins (4E-BPs) phosphorylation. And accumulated data over the past two decades implicated eIF4F complex as one of the promising targets for anticancer therapy. It has been confirmed that the translation initiation of mRNA coding for hypoxia-inducible factor-1α (HIF-1α) and survivin, which had been considered as the two major determinants of tumor radiosensitivity, are both controlled by eIF4F complex. Also, eIF4F complex controls the expression of VEGF and bFGF, the two well-known pro-angiogenic factors involved in developing radioresistance. Therefore eIF4F complex plays a pivotal role in regulation of radiosensitivity. In this article, we postulate that cell-permeable, phosphorylation-defective 4E-BP fusion proteins, which could be prepared by substituting the mTOR recognition motif located in N-terminal of 4E-BPs with protein transduction domain from HIV-1 TAT, HSV-1 VP22 or PTD4, could not only inhibit tumor growth but also enhance tumor response to radiation therapy through disruption of eIF4F complex assembly. In our opinion, the recombinant fusion proteins are superior to mTOR inhibitors for they do not cause immunosuppression, do not lead to Akt activation, and could be easily prepared by prokaryotic expression. If the hypothesis was proved to be practical, the cell-permeable, phosphorylation-defective 4E-BP fusion proteins would be widely used in clinical settings to improve tumor response to radiotherapy in the near future.

Are we missing the mTOR target in breast cancer?

Abnormalities in the PI3K/Akt/mTOR intracellular signalling pathway have been implicated in several forms of human cancer. The central component of the pathway is the phosphatidylinositol 3-kinase (PI3K) heterodimer which comprises the p85 regulatory and p110 catalytic subunit, and mutations in the catalytic domain of PI3K have been identified in 20–25% of breast cancers [1, 2]. A further 15–35% of breast cancer patients demonstrate reduced expression of PTEN (phosphatase and tensin homologue deleted on chromosome ten), an endogenous inhibitor of the PI3K/AKT pathway [3]. Akt is the ultimate effector of the pathway and directs a multitude of intracellular effects related to growth, glucose metabolism, protein synthesis and cell survival. Activation of the PI3K/Akt pathway provides a cell with unrestricted growth and survival signals, and one important downstream consequence is the alleviation of the suppression by the tuberous sclerosis protein complex (TSC1/2) of the mammalian target of rapamycin (mTOR) [4]. There are at least two groups of mTOR proteins, and the key protein involved in transmitting signals from PI3K/Akt is the mTORC1 complex. Within cells, mTORC1 plays a critical role in the transduction of proliferative signals through phosphorylation of the translational regulator 4E-BP1 (eukaryotic initiation factor 4E-binding protein) and the ribosomal protein p70 (the 70-kDa S6 kinase) that facilitate translation of mRNAs into proteins [5, 6]. In recent years our understanding of this pathway in breast cancer has been exploited by the development of a number of targeted anti-cancer therapeutics, with mTOR inhibitors being the most clinically developed to date. Rapamycin is the original inhibitor of mTOR that was found to be a potent fungicide with immunosuppressive properties, and therapeutics were developed for clinical use in transplantation to prevent graft rejection. Subsequently rapamycin was found to have anti-proliferative effects in a range of experimental tumours [7], and rapamycin analogues with a more favourable pharmacological profile were synthesised including CCI-779 (temsirolimus), RAD001 (everolimus) and AP23573 (ridaforolimus). In various breast cancer cell lines with constitutive activation of the PI3K/Akt pathway due to either HER2 amplification, ER activation or PTEN deletions temsirolimus showed specific sensitivity [8], whilst everolimus (an oral hydroxyethyl ether of rapamycin) demonstrated impressive anti-proliferative activity against a wide variety of tumour models in vivo [9]. In the clinic mTOR antagonists were found to be relatively well tolerated in early phase I/II trials [10, 11], and development programmes were established in various solid malignancies, in particular renal cell cancer and breast cancer. But has the development of mTOR antagonists for breast cancer moved ahead too fast before it was really appreciated how best to utilise these drugs as targeted therapeutics? As a single agent temsirolimus showed only modest activity in the advanced breast cancer setting [12], and subsequently both temsirolimus and everolimus were developed in combination with endocrine therapy following encouraging evidence for additive or synergistic effects from several pre-clinical models of endocrine resistant breast cancer [13, 14]. However, results from randomised clinical trials of mTOR antagonists in combination with This is an invited commentary to articles doi: 10.1007/s10549-010-0967-z, 10.1007/s10549-010-0986-9, 10.1007/s10549-010-1058-x.

Purinergic Receptor-mediated Rapid Depletion of Nuclear Phosphorylated Akt Depends on Pleckstrin Homology Domain Leucine-rich Repeat Phosphatase, Calcineurin, Protein Phosphatase 2A, and PTEN Phosphatases

Akt is an important oncoprotein, and data suggest a critical role for nuclear Akt in cancer development. We have previously described a rapid (3-5 min) and P2X7-dependent depletion of nuclear phosphorylated Akt (pAkt) and effects on downstream targets, and here we studied mechanisms behind the pAkt depletion. We show that cholesterol-lowering drugs, statins, or extracellular ATP, induced a complex and coordinated response in insulin-stimulated A549 cells leading to depletion of nuclear pAkt. It involved protein/lipid phosphatases PTEN, pleckstrin homology domain leucine-rich repeat phosphatase (PHLPP1 and -2), protein phosphatase 2A (PP2A), and calcineurin. We employed immunocytology, immunoprecipitation, and proximity ligation assay techniques and show that PHLPP and calcineurin translocated to the nucleus and formed complexes with Akt within 3 min. Also PTEN translocated to the nucleus and then co-localized with pAkt close to the nuclear membrane. An inhibitor of the scaffolding immunophilin FK506-binding protein 51 (FKBP51) and calcineurin, FK506, prevented depletion of nuclear pAkt. Furthermore, okadaic acid, an inhibitor of PP2A, prevented the nuclear pAkt depletion. Chemical inhibition and siRNA indicated that PHLPP, PP2A, and PTEN were required for a robust depletion of nuclear pAkt, and in prostate cancer cells lacking PTEN, transfection of PTEN restored the statin-induced pAkt depletion. The activation of protein and lipid phosphatases was paralleled by a rapid proliferating cell nuclear antigen (PCNA) translocation to the nucleus, a PCNA-p21(cip1) complex formation, and cyclin D1 degradation. We conclude that these effects reflect a signaling pathway for rapid depletion of pAkt that may stop the cell cycle.

Posttranslational regulation of membrane type 1-matrix metalloproteinase (MT1-MMP) in mouse PTEN null prostate cancer cells: Enhanced surface expression and differential O-glycosylation of MT1-MMP

Membrane type 1 (MT1)-matrix metalloproteinase (MT1-MMP) is a membrane-tethered MMP that has been shown to play a key role in promoting cancer cell invasion. MT1-MMP is highly expressed in bone metastasis of prostate cancer (PC) patients and promotes intraosseous tumor growth of PC cells in mice. The majority of metastatic prostate cancers harbor loss-of-function mutations or deletions of the tumor suppressor PTEN (phosphatase and tensin homologue deleted on chromosome ten). However, the role of PTEN inactivation in MT1-MMP expression in PC cells has not been examined. In this study, prostate epithelial cell lines derived from mice that are either heterozygous ( PTEN +/-) or homozygous ( PTEN −/−) for PTEN deletion or harboring a wild-type PTEN ( PTEN +/+) were used to investigate the expression of MT1-MMP. We found that biallelic loss of PTEN is associated with posttranslational regulation of MT1-MMP protein in mouse PC cells. PTEN −/− PC cells display higher levels of MT1-MMP at the cell surface when compared to PTEN +/+ and PTEN +/− cells and consequently exhibited enhanced migratory and collagen-invasive activities. MT1-MMP displayed by PTEN −/− cells is differentially O-glycosylated and exhibits a slow rate of turnover. MT1-MMP expression in PTEN −/− cells is under control of the PI3K/AKT signaling pathway, as determined using pharmacological inhibitors. Interestingly, rapamycin, an mTOR inhibitor, upregulates MT1-MMP expression in PTEN +/+ cells via PI3K activity. Collectively, these data in a mouse prostate cell system uncover for the first time a novel and complex relationship between PTEN loss-mediated PI3K/AKT activation and posttranslational regulation of MT1-MMP, which may play a role in PC progression.

Upregulation of PTEN in Glioma Cells by Cord Blood Mesenchymal Stem Cells Inhibits Migration via Downregulation of the PI3K/Akt Pathway

BackgroundPTEN (phosphatase and tensin homologue deleted on chromosome ten) is a tumor suppressor gene implicated in a wide variety of human cancers, including glioblastoma. PTEN is a major negative regulator of the PI3K/Akt signaling pathway. Most human gliomas show high levels of activated Akt, whereas less than half of these tumors carry PTEN mutations or homozygous deletions. The unique ability of mesenchymal stem cells to track down tumor cells makes them as potential therapeutic agents. Based on this capability, new therapeutic approaches have been developed using mesenchymal stem cells to cure glioblastoma. However, molecular mechanisms of interactions between glioma cells and stem cells are still unknown.Methodology/Principal FindingsIn order to study the mechanisms by which migration of glioma cells can be inhibited by the upregulation of the PTEN gene, we studied two glioma cell lines (SNB19 and U251) and two glioma xenograft cell lines (4910 and 5310) alone and in co-culture with human umbilical cord blood-derived mesenchymal stem cells (hUCBSC). Co-cultures of glioma cells showed increased expression of PTEN as evaluated by immunofluorescence and immunoblotting assays. Upregulation of PTEN gene is correlated with the downregulation of many genes including Akt, JUN, MAPK14, PDK2, PI3K, PTK2, RAS and RAF1 as revealed by cDNA microarray analysis. These results have been confirmed by reverse-transcription based PCR analysis of PTEN and Akt genes. Upregulation of PTEN resulted in the inhibition of migration capability of glioma cells under in vitro conditions. Also, wound healing capability of glioma cells was significantly inhibited in co-culture with hUCBSC. Under in vivo conditions, intracranial tumor growth was inhibited by hUCBSC in nude mice. Further, hUCBSC upregulated PTEN and decreased the levels of XIAP and Akt, which are responsible for the inhibition of tumor growth in the mouse brain.Conclusions/SignificanceOur studies indicated that upregulation of PTEN by hUCBSC in glioma cells and in the nude mice tumors downregulated Akt and PI3K signaling pathway molecules. This resulted in the inhibition of migration as well as wound healing property of the glioma cells. Taken together, our results suggest hUCBSC as a therapeutic agent in treating malignant gliomas.

Promoter Methylation and Phosphorylation Status of PTEN in Taiwanese Breast Cancer.

Abstract Background: The PTEN (phosphatase and tensin homolog deleted on chromosome Ten) gene is a novel candidate of tumor suppressor that plays an important role in cell cycle regulation and apoptosis by modulating protein kinase-B/AKT activity. In western breast cancer population, PTEN downregulation is frequently associated with high-grade tumor, distant metastases and poorer disease-free survival. It is also noted that the methylation of the PTEN promoter results in PTEN inactivation in a subset of breast cancers. Taiwan is the low-incidence area of breast cancer. However, breast cancer has been jumped to the first place in the incidence of female malignancies in the past 3 years. Hence, we aim to explore the potential role of PTEN in Taiwanese breast cancer.Material and Method: Firstly, we used tissue microarrays containing 192 specimens (PTEN) and 193 samples (p-PTEN) from the Department of Pathology, Kaohsiung Medical University to analyze the expression patterns of PTEN and p-PTEN (Ser380/Thr382/Thr383) protein by immunohistochemistry (anti-PTEN antibody, A2B1, and anti-p-PTEN R, Santa Cruz). Clinical data, such as stage, grade, recurrence, lymph-node metastasis, and patient's age, tumor-specific survival (in months) and others were included in our statistic analysis. The genomic DNA (1 μg) obtained from 318 fresh specimens containing 159 matched cancer and non-cancer tissues were treated with sodium bisulfite for 16 hours and purified using methylation-specific PCR (MSP) kit (Millipore). Separate primers were used for amplification of methylated and unmethylated promoter regions. Primers that amplified a region of the promoter specific to PTEN gene but not the PTEN pseudogene were used. Primers used to amplify the methylated PTEN promoter were 5'-GTATTTCGAGTAAAGGAAGAAGACG-3' and 5'-GATAAAAAACTACAACC CAACGAA-3'; those used to amplify the unmethylated promoter were 5'- TATTTTGAGTA AAGGAAGAAGATGA-3' and 5'-CAATAAAAAACTACAACCCAACAAA-3'.Results: Our results showed that an increased nuclear expression of PTEN was positively correlated with an increased tumor staging (p=0.010). Furthermore, an increased p-PTEN expression in the cytoplasm was inversely correlated with tumor staging (p=0.003), while the decreased expression of p-PTEN in the nucleus was significantly correlated with positive recurrence rate (p=0.009) and metastasis to lymph node (p=0.033). Notably, the expression level of p-PTEN was positively correlated with that of PTEN. We also observed that the methylation of PTEN promoter was increased in 70% of breast cancer tissues as compared with the matched non-cancer breast tissues. Moreover, the increased methylation of PTEN promoter was positively correlated with tumor grade (p=0.037).Discussion: Taken together, our results suggest that an altered PTEN expression through methylation or phosphorylation may have potential roles in Taiwanese breast cancer. The underlying mechanism requires further investigation. Citation Information: Cancer Res 2009;69(24 Suppl):Abstract nr 4060.

X-linked Inhibitor of Apoptosis Protein (XIAP) Regulates PTEN Ubiquitination, Content, and Compartmentalization

Apoptotic cell death plays a normal role in various physiological processes, and deregulated apoptosis is a hallmark of several diseases, including cancer. Cell fate is dictated by the balance between pro- and antiapoptotic factors. Akt is one of these antiapoptotic factors, which must be activated through phosphorylation. The phosphorylation of Akt has previously been shown to be promoted by X-linked inhibitor of apoptosis protein (XIAP), another antiapoptotic protein dictating the fate of normal and cancer cells. However, the underlying mechanisms are poorly understood. We have observed that XIAP associates with PTEN (phosphatase and tensin homolog deleted on chromosome ten), the best characterized negative regulator of Akt phosphorylation, in vitro and in vivo. XIAP knockdown reduces constitutive mono- and polyubiquitination of PTEN, increases PTEN protein levels, and prevents nuclear accumulation of PTEN. Overexpression of XIAP induces polyubiquitination of PTEN and proteasome-dependent decrease of PTEN protein levels. RNA interference experiments showed that XIAP-induced regulation of Akt phosphorylation is PTEN-dependent. Additional experiments confirmed that XIAP also regulates PTEN in vivo; primary mouse embryonic fibroblasts derived from XIAP(-/-) mice contain higher levels of PTEN protein, less mono- and polyubiquitinated PTEN, and less nuclear PTEN than primary mouse embryonic fibroblasts derived from XIAP(+/+) mice. Finally, we found that XIAP can directly ubiquitinate PTEN in vitro. We thus propose that XIAP acts as an E3 ubiquitin ligase for PTEN and promotes Akt activity by regulating PTEN content and compartmentalization.

Akt Demoted in Glioblastoma

In glioblastomas, an Akt-independent, PTEN (phosphatase and tensin homolog deleted on chromosome ten)-regulated signaling pathway links EGFR (epidermal growth factor receptor) to the phosphorylation of TOR (target of rapamycin) and of the ribosomal protein S6 and to the control of cell replication. Although PKCalpha (protein kinase Calpha) has been identified as an essential component, the detailed wiring of this previously unexplored noncanonical pathway remains to be worked out.

Aberrant Hyperactivation of Akt and Mammalian Target of Rapamycin Complex 1 Signaling in Sporadic Chordomas

Chordomas are rare, malignant bone neoplasms in which the pathogenic mechanisms remain unknown. Interestingly, tuberous sclerosis complex (TSC) is the only syndrome in which the incidence of chordomas has been described. We previously reported the pathogenic role of the TSC genes in TSC-associated chordomas. In this study, we investigated whether aberrant TSC/mammalian target of rapamycin complex 1 (mTORC1) signaling pathway is associated with sporadic chordomas. We assessed the status of mTORC1 signaling in primary tumors/cell lines of sacral chordomas and further examined upstream of mTORC1 signaling, including the PTEN (phosphatase and tensin homologue deleted on chromosome ten) tumor suppressor. We also tested the efficacy of the mTOR inhibitor rapamycin on signaling and growth of chordoma cell lines. Sporadic sacral chordoma tumors and cell lines examined commonly displayed hyperactivated Akt and mTORC1 signaling. Strikingly, expression of PTEN, a negative regulator of mTORC1 signaling, was not detected or significantly reduced in chordoma-derived cell lines and primary tumors. Furthermore, rapamycin inhibited mTORC1 activation and suppressed proliferation of chordoma-derived cell line. Our results suggest that loss of PTEN as well as other genetic alterations that result in constitutive activation of Akt/mTORC1 signaling may contribute to the development of sporadic chordomas. More importantly, a combination of Akt and mTORC1 inhibition may provide clinical benefits to chordoma patients.

Pharmacological Inhibition of mTORC1 Suppresses Anatomical, Cellular, and Behavioral Abnormalities in Neural-SpecificPtenKnock-Out Mice

PTEN (phosphatase and tensin homolog deleted on chromosome ten) is a lipid phosphatase that counteracts the function of phosphatidylinositol-3 kinase (PI3K). Loss of function of PTEN results in constitutive activation of AKT and downstream effectors and correlates with many human cancers, as well as various brain disorders, including macrocephaly, seizures, Lhermitte-Duclos disease, and autism. We previously generated a conditional Pten knock-out mouse line with Pten loss in limited postmitotic neurons in the cortex and hippocampus. Pten-null neurons developed neuronal hypertrophy and loss of neuronal polarity. The mutant mice exhibited macrocephaly and behavioral abnormalities reminiscent of certain features of human autism. Here, we report that rapamycin, a specific inhibitor of mammalian target of rapamycin complex 1 (mTORC1), can prevent and reverse neuronal hypertrophy, resulting in the amelioration of a subset of PTEN-associated abnormal behaviors, providing evidence that the mTORC1 pathway downstream of PTEN is critical for this complex phenotype.

Onco-Mir-155 Targets SHIP to Regulate TNF-Dependent B-Cell Lymphoma Growth

Diffuse large B-cell lymphoma (DLBCL) accounts for approximately 40% of non-Hodgkin lymphomas, with an overall 3-year relapse-free survival of 53%. DLBCL consists of a germinal center B-cell (GCB-like) subgroup and an activated B-cell (ABC-like) subgroup exist, associated with good and poor prognosis, respectively. In addition to differential expression of coding genes, ABC-type lymphoma cells express high levels of the non-coding microRNA, miR-155, an onco-miR whose ectopic expression in the mouse has been shown to give rise to B-cell malignancies. DLBCL feature a dysregulated PI3 kinase pathway, which can promote proliferation and survival. PI3K is regulated by phosphatases PTEN (phosphatase and tensin homolog deleted on chromosome ten) and SHIP (SH2 domain-containing inositol 5-phosphatase). PTEN is a known tumor suppressor and is mutated in human cancer with a frequency approaching that of p53. cDNA array analyses of DLBCL patient specimens indicate that low mRNA expression level of SHIP can be used as a negative prognostic marker for survival. We have now identified SHIP as the first bona-fide target of miR-155. RT-PCR analysis of micro-dissected lymphoma samples confirmed high levels of miR-155 and low levels of SHIP in poor-prognosis ABC-cells as compared to GCB-cells. We further demonstrate that elevated levels of miR-155, and consequent abrogation of SHIP expression, is not due to point mutations or promoter hypermethylation of SHIP in primary DLBCL cells, but rather the result of a TNFa-mediated autocrine loop, a pro-inflammatory cytokine whose serum levels are elevated in DLBCL patients. Consequently, anti-TNFa regimens (Etenercept (Enbrel®), Infliximab (Remicade®)) are sufficient to reduce miR-155 levels, restore expression of SHIP, decrease p-Akt levels, and slow tumor cell growth of ABC-sub-type DLBCL cell lines. Furthermore, we observe a highly significant decrease in tumor growth when DLBCL-xenograft mice are treated with Etenercept, suggesting a novel approach for restoring tumor suppressor activity and inducing growth inhibition of these aggressive tumors. Our findings offer the first direct evidence that specific miRs can function as a the link between inflammation and cancer. Finally, our hypothesis, that TNFa promotes survival of DLBCL via miR-155, SHIP and pAkt, opens up a novel and immediately accessible (co)treatment for poor prognosis DLBCL.

Genetic and phenotypic heterogeneity in the PTEN hamartoma tumour syndrome

Germline PTEN (Phosphatase and TENsin homologue deleted on chromosome TEN) mutations predispose to phenotypically diverse disorders that share several overlapping clinical features: Cowden syndrome, Bannayan-Riley-Ruvalcaba syndrome, Proteus syndrome and Proteus-like syndrome, collectively classified as PTEN hamartoma tumour syndrome (PHTS). The meticulous acquisition and documentation of PHTS phenotypic data at different levels and the profiling of the plethora of genetic changes in PTEN and other genes within the same or related pathways are important in resolving the challenge of discriminating heritable cancers from sporadic PHTS-mimicking clinical features. The characterization of PTEN and PTEN-related pathways from a multidisciplinary perspective underscores the importance of incorporating data from different -omics, which is crucial for the advancement of personalized medicine.