Mutator Phenotype Research Articles

A maternal germline mutator phenotype in a family affected by heritable colorectal cancer.

Variation in DNA repair genes can increase cancer risk by elevating the rate of oncogenic mutation. Defects in one such gene, MUTYH, are known to elevate the incidence of colorectal cancer in a recessive Mendelian manner. Recent evidence has also linked MUTYH to a mutator phenotype affecting normal somatic cells as well as the female germline. Here, we use whole genome sequencing to measure germline de novo mutation rates in a large extended family containing both mothers and fathers who are affected by pathogenic MUTYH variation. By developing novel methodology that uses siblings as "surrogate parents" to identify de novo mutations, we were able to include mutation data from several children whose parents were unavailable for sequencing. In the children of mothers affected by the pathogenic MUTYH genotype p.Y179C/V234M, we identify an elevation of the C>A mutation rate that is weaker than mutator effects previously reported to be caused by other pathogenic MUTYH genotypes, suggesting that mutation rates in normal tissues may be useful for classifying cancer-associated variation along a continuum of severity. Surprisingly, we detect no significant elevation of the C>A mutation rate in children born to a father with the same MUTYH genotype, and we similarly find that the mutator effect of the mouse homolog Mutyh appears to be localized to embryonic development, not the spermatocytes. Our results suggest that maternal MUTYH variants can cause germline mutations by attenuating the repair of oxidative DNA damage in the early embryo.

Split MutT prevents the mutator phenotype of mutT-deficient Escherichia coli

BackgroundThe Escherichia coli MutT (NudA) protein catalyzes the hydrolysis of an oxidized form of dGTP, 8-oxo-7,8-dihydro-dGTP (8-hydroxy-dGTP), and the spontaneous mutation frequency is elevated in E. coli cells deficient in the mutT gene.ResultsA split MutT, comprising the N-terminal (residues 1–95) and C-terminal (residues 96–129) peptides, was designed based on the known tertiary structure and linker insertion mutagenesis experiments. The mutator phenotype was complemented when the two peptides were separately expressed in mutT E. coli cells.ConclusionsThese results indicated that this split MutT functions as a nucleotide pool sanitization enzyme in vivo.

A maternal germline mutator phenotype in a family affected by heritable colorectal cancer.

Variation in DNA repair genes can increase cancer risk by elevating the rate of oncogenic mutation. Defects in one such gene, MUTYH, are known to elevate the incidence of colorectal cancer in a recessive Mendelian manner. Recent evidence has also linked MUTYH to a mutator phenotype affecting normal somatic cells as well as the female germline. Here, we use whole genome sequencing to measure germline de novo mutation rates in a large extended family containing both mothers and fathers who are affected by pathogenic MUTYH variation. By developing novel methodology that uses siblings as "surrogate parents" to identify de novo mutations, we were able to include mutation data from several children whose parents were unavailable for sequencing. In the children of mothers affected by the pathogenic MUTYH genotype p.Y179C/V234M, we identify an elevation of the C>A mutation rate that is weaker than mutator effects previously reported to be caused by other pathogenic MUTYH genotypes, suggesting that mutation rates in normal tissues may be useful for classifying cancer-associated variation along a continuum of severity. Surprisingly, we detect no significant elevation of the C>A mutation rate in children born to a father with the same MUTYH genotype, and we similarly find that the mutator effect of the mouse homolog Mutyh appears to be localized to embryonic development, not the spermatocytes. Our results suggest that maternal MUTYH variants can cause germline mutations by attenuating the repair of oxidative DNA damage in the early embryo.

Holistic understanding of trimethoprim resistance in Streptococcus pneumoniae using an integrative approach of genome-wide association study, resistance reconstruction, and machine learning.

In the age of next-generation sequencing (NGS), while data-driven methods such as genome-wide association study (GWAS) and machine learning (ML) excel at finding patterns, functional validation can be challenging due to the high numbers of candidate variants. We designed an integrative approach combining a GWAS on S. pneumoniae clinical isolates, followed by whole-genome transformation coupled with NGS to functionally characterize a large set of GWAS candidates. Our study validated several phenotypic folA mutations beyond the standard Ile100Leu mutation, and showed that the overexpression of the sulA locus produces trimethoprim (TMP) resistance in Streptococcus pneumoniae. These validated loci, when used to build ML models, were found to be the best inputs for predicting TMP minimal inhibitory concentrations. Integrative approaches can bridge the genotype-phenotype gap by biological insights that can be incorporated in ML models for accurate prediction of drug susceptibility.

Integrative analysis of transcriptome and metabolome provides insights into the mechanisms of leaf variegation in Heliopsis helianthoides

BackgroundIn the field of ornamental horticulture, phenotypic mutations, particularly in leaf color, are of great interest due to their potential in developing new plant varieties. The introduction of variegated leaf traits in plants like Heliopsis helianthoides, a perennial herbaceous species with ecological adaptability, provides a rich resource for molecular breeding and research on pigment metabolism and photosynthesis. We aimed to explore the mechanism of leaf variegation of Heliopsis helianthoides (using HY2021F1-0915 variegated mutant named HY, and green-leaf control check named CK in 2020 April, May and June) by analyzing the transcriptome and metabolome.ResultsLeaf color and physiological parameters were found to be significantly different between HY and CK types. Chlorophyll content of HY was lower than that of CK samples. Combined with the result of Weighted Gene Co-expression Network Analysis (WGCNA), 26 consistently downregulated differentially expressed genes (DEGs) were screened in HY compared to CK subtypes. Among the DEGs, 9 genes were verified to be downregulated in HY than CK by qRT-PCR. The reduction of chlorophyll content in HY might be due to the downregulation of FSD2. Low expression level of PFE2, annotated as ferritin-4, might also contribute to the interveinal chlorosis of HY. Based on metabolome data, differential metabolites (DEMs) between HY and CK samples were significantly enriched on ABC transporters in three months. By integrating DEGs and DEMs, they were enriched on carotenoids pathway. Downregulation of four carotenoid pigments might be one of the reasons for HY’s light color.ConclusionFSD2 and PFE2 (ferritin-4) were identified as key genes which likely contribute to the reduced chlorophyll content and interveinal chlorosis observed in HY. The differential metabolites were significantly enriched in ABC transporters. Carotenoid biosynthesis pathway was highlighted with decreased pigments in HY individuals. These findings not only enhance our understanding of leaf variegation mechanisms but also offer valuable insights for future plant breeding strategies aimed at preserving and enhancing variegated-leaf traits in ornamental plants.

The Potential Links between lncRNAs and Drug Tolerance in Lung Adenocarcinoma.

Lung cancer patients treated with targeted therapies frequently respond well but invariably relapse due to the development of drug resistance. Drug resistance is in part mediated by a subset of cancer cells termed "drug-tolerant persisters" (DTPs), which enter a dormant, slow-cycling state that enables them to survive drug exposure. DTPs also exhibit stem cell-like characteristics, broad epigenetic reprogramming, altered metabolism, and a mutagenic phenotype mediated by adaptive mutability. While several studies have characterised the transcriptional changes that lead to the altered phenotypes exhibited in DTPs, these studies have focused predominantly on protein coding changes. As long non-coding RNAs (lncRNAs) are also implicated in the phenotypes altered in DTPs, it is likely that they play a role in the biology of drug tolerance. In this review, we outline how lncRNAs may contribute to the key characteristics of DTPs, their potential roles in tolerance to targeted therapies, and the emergence of genetic resistance in lung adenocarcinoma.

Analysis of phenotypic characteristics and mutation patterns in syndromic craniofacial anomalies: Insights from a tertiary care medical genetics unit in South India

ABSTRACT Context: Craniofacial anomalies (CFAs) are rare congenital anomalies that have a profound impact on social acceptance. Most of the syndromic CFAs are genetic in origin and are the result of alteration in single or multiple genes inherited from parents or de novo. Aims: The main aim of this study was to explore the phenotypic variations and the mutation profiles in the various CFA. Subjects and Methods: This was a retrospective study where records of 20 patients were obtained from electronic medical records for analysis. The numbers provided do not accurately reflect the true prevalence as they only encompass cases referred to our department for testing. Results: The median age in this cohort was 1 year with males 60% and females 40%. Out of 20 cases, 8 cases were classified as CFA-associated craniosynostosis and 12 with orofacial clefts. Disease-causing genes identified were FGFR2, RTTN, ASXL3, IRF6, TP63, POLR1D, TCOF1, KMT2D, KDM6A, LARP1, and C5orf42. Most of these craniofacial syndromes were predominantly autosomal dominant, sporadic, and de novo. We had three autosomal recessive cases (RTTN, LARP1, and C5orf42) and one X-linked dominant case (KDM6A). Two novel variants were identified, one for Van der Woude syndrome and another for Crouzon’s syndrome. Conclusions: Although these syndromes are rare in occurrence, the present study provides a detailed phenotypic spectrum and causative mutation in various CFAs in Indian patients. This is crucial for understanding the genetic basis of these conditions and can potentially lead to advancements in diagnosis, treatment, and appropriate genetic counseling.

Universal Lineage-Independent Markers of Multidrug Resistance in Mycobacterium tuberculosis.

(1) Background: This study was aimed to identify universal genetic markers of multidrug resistance (MDR) in Mycobacterium tuberculosis (Mtb) and establish statistical associations among identified mutations to enhance understanding of MDR in Mtb and inform diagnostic and treatment development. (2) Methods: GWAS analysis and the statistical evaluation of identified polymorphic sites within protein-coding genes of Mtb were performed. Statistical associations between specific mutations and antibiotic resistance were established using attributable risk statistics. (3) Results: Sixty-four polymorphic sites were identified as universal markers of drug resistance, with forty-seven in PE/PPE regions and seventeen in functional genes. Mutations in genes such as cyp123, fadE36, gidB, and ethA showed significant associations with resistance to various antibiotics. Notably, mutations in cyp123 at codon position 279 were linked to resistance to ten antibiotics. The study highlighted the role of PE/PPE and PE_PGRS genes in Mtb's evolution towards a 'mutator phenotype'. The pathways of acquisition of mutations forming the epistatic landscape of MDR were discussed. (4) Conclusions: This research identifies marker mutations across the Mtb genome associated with MDR. The findings provide new insights into the molecular basis of MDR acquisition in Mtb, aiding in the development of more effective diagnostics and treatments targeting these mutations to combat MDR tuberculosis.

DeTELpy: Python package for high-throughput detection of amino acid substitutions in mass spectrometry datasets.

Errors in the processing of genetic information during protein synthesis can lead to phenotypic mutations, such as amino acid substitutions, e.g. by transcription or translation errors. While genetic mutations can be readily identified using DNA sequencing, and mutations due to transcription errors by RNA sequencing, translation errors can only be identified proteome-wide using mass spectrometry. Here, we provide a Python package implementation of a high-throughput pipeline to detect amino acid substitutions in mass spectrometry datasets. Our tools enable users to process hundreds of mass spectrometry datasets in batch mode to detect amino acid substitutions and calculate codon-specific and site-specific translation error rates. deTELpy will facilitate the systematic understanding of amino acid misincorporation rates (translation error rates), and the inference of error models across organisms and under stress conditions, such as drug treatment or disease conditions. deTELpy is implemented in Python 3 and is freely available with detailed documentation and practical examples at https://git.mpi-cbg.de/tothpetroczylab/detelpy and https://pypi.org/project/deTELpy/ and can be easily installed via pip install deTELpy.

Integrated mutational landscape analysis of poorly differentiated high-grade neuroendocrine carcinoma of the uterine cervix

High-grade neuroendocrine cervical cancers (NETc) are exceedingly rare, highly aggressive tumors. We analyzed 64 NETc tumor samples by whole-exome sequencing (WES). Human papillomavirus DNA was detected in 65.6% (42/64) of the tumors. Recurrent mutations were identified in PIK3CA, KMT2D/MLL2, K-RAS, ARID1A, NOTCH2, and RPL10. The top mutated genes included RB1, ARID1A, PTEN, KMT2D/MLL2, and WDFY3, a gene not yet implicated in NETc. Somatic CNV analysis identified two copy number gains (3q27.1 and 19q13.12) and five copy number losses (1p36.21/5q31.3/6p22.2/9q21.11/11p15.5). Also, gene fusions affecting the ACLY-CRHR1 and PVT1-MYC genes were identified in one of the eight samples subjected to RNA sequencing. To resolve evolutionary history, multiregion WES in NETc admixed with adenocarcinoma cells was performed (i.e., mixed-NETc). Phylogenetic analysis of mixed-NETc demonstrated that adenocarcinoma and neuroendocrine elements derive from a common precursor with mutations typical of adenocarcinomas. Over one-third (22/64) of NETc demonstrated a mutator phenotype of C > T at CpG consistent with deficiencies in MBD4, a member of the base excision repair (BER) pathway. Mutations in the PI3K/AMPK pathways were identified in 49/64 samples. We used two patient-derived-xenografts (PDX) (i.e., NET19 and NET21) to evaluate the activity of pan-HER (afatinib), PIK3CA (copanlisib), and ATR (elimusertib) inhibitors, alone and in combination. PDXs harboring alterations in the ERBB2/PI3K/AKT/mTOR/ATR pathway were sensitive to afatinib, copanlisib, and elimusertib (P < 0.001 vs. controls). However, combinations of copanlisib/afatinib and copanlisib/elimusertib were significantly more effective in controlling NETc tumor growth. These findings define the genetic landscape of NETc and suggest that a large subset of these highly lethal malignancies might benefit from existing targeted therapies.

Microsatellite instability: A 2024 update.

Deficient mismatch repair (dMMR) results in microsatellite instability (MSI), a pronounced mutator phenotype. High-frequency MSI (MSI-H)/dMMR is gaining increasing interest as a biomarker for advanced cancer patients to determine their eligibility for immune checkpoint inhibitors (ICIs). Various methods based on next-generation sequencing (NGS) have been developed to assess the MSI status. Comprehensive genomic profiling (CGP) testing can precisely ascertain the MSI status as well as genomic alterations in a single NGS test. The MSI status can be also ascertained through the liquid biopsy-based CGP assays. MSI-H has thus been identified in various classes of tumors, resulting in a greater adoption of immunotherapy, which is hypothesized to be effective against malignancies that possess a substantial number of mutations and/or neoantigens. NGS-based studies have also characterized MSI-driven carcinogenesis, including significant rates of fusion kinases in colorectal cancers (CRCs) with MSI-H that are targets for therapeutic kinase inhibitors, particularly in MLH1-methylated CRCs with wild-type KRAS/BRAF. NTRK fusion is linked to the colorectal serrated neoplasia pathway. Recent advances in investigations of MSI-H malignancies have resulted in the development of novel diagnostic or therapeutic techniques, such as a synthetic lethal therapy that targets the Werner gene. DNA sensing in cancer cells is required for antitumor immunity induced by dMMR, opening up novel avenues and biomarkers for immunotherapy. Therefore, clinical relevance exists for analyses of MSI and MSI-H-associated genomic alterations in malignancy. In this article, we provide an update on MSI-driven carcinogenesis, with an emphasis on unique landscapes of diagnostic and immunotherapeutic strategies.

Triple-Negative Myelofibrosis: Disease Features, Response to Treatment and Outcomes

BackgroundMyelofibrosis is the most aggressive subtype among classical BCR::ABL1 negative myeloproliferative neoplasms. About 90% of cases are driven by constitutive activation of 1 of 3 genes impacting the JAK/STAT pathway: JAK2, CALR, and MPL. Triple-negative myelofibrosis (TN-MF) accounts for only 5%-10% of cases and carries the worst outcomes. Little has been described about this subset of disease. Given the marked heterogeneity surrounding disease biology, clonal architecture, clinical presentation, and poor outcomes in TN-MF, identification of features of interest and assessment of treatment response are areas in need of further investigation. Patients and methodsWe collected and evaluated baseline clinical and molecular parameters from 626 patients with a diagnosis of myelofibrosis who presented to the H. Lee Moffitt Cancer Center in Tampa (Florida, US) between 2003 and 2021 and compared them based on presence or absence of the three classical phenotypic driver mutations. ResultsA small proportion of patients (6%) harbored TN-MF which correlated with inferior outcomes, marked by a 4-year reduction in overall survival time compared to the non-TN cohort (mOS 37.4 months vs. 85.7 months; P = .009) and higher rates of leukemic transformation. More pronounced thrombocytopenia and anemia, lower LDH, EPO levels, as well as lower percentage of marrow blasts at baseline were more commonly seen in TN-MF (P < .05). Similarly, patients with TN-MF had higher risk disease per DIPSS+ and GIPSS. Mutations impacting RNA splicing, epigenetic modification and signaling, specifically SRSF2, SETBP1, IDH2, CBL, and GNAS, were more commonly seen among those lacking a classical phenotypic driver. The prevalence of co-mutant ASXL1/SRSF2 clones was significantly higher in TN-MF as was trisomy 8. TN patients had fewer responses (46.2% vs. 63.4%) and shorter duration of response to ruxolitinib. ConclusionTN-MF is invariably associated with significantly decreased survival and more aggressive clinical behavior with higher rates of leukemic transformation and shorter duration of response to ruxolitinib. Mutations impacting RNA splicing, epigenetic modification and signaling (SRSF2, SETBP1, IDH2, CBL, and GNAS) are more common in TN-MF, which likely drive its aggressive course and may account for suboptimal responses to JAK inhibition.

Fitness Effects of Phenotypic Mutations at Proteome-Scale Reveal Optimality of Translation Machinery.

Errors in protein translation can lead to non-genetic, phenotypic mutations, including amino acid misincorporations. While phenotypic mutations can increase protein diversity, the systematic characterization of their proteome-wide frequencies and their evolutionary impact has been lacking. Here, we developed a mechanistic model of translation errors to investigate how selection acts on protein populations produced by amino acid misincorporations. We fitted the model to empirical observations of misincorporations obtained from over a hundred mass spectrometry datasets of E. coli and S. cerevisiae. We found that on average 20% to 23% of proteins synthesized in the cell are expected to harbor at least one amino acid misincorporation, and that deleterious misincorporations are less likely to occur. Combining misincorporation probabilities and the estimated fitness effects of amino acid substitutions in a population genetics framework, we found 74% of mistranslation events in E. coli and 94% in S. cerevisiae to be neutral. We further show that the set of available synonymous tRNAs is subject to evolutionary pressure, as the presence of missing tRNAs would increase codon-anticodon cross-reactivity and misincorporation error rates. Overall, we find that the translation machinery is likely optimal in E. coli and S. cerevisiae and that both local solutions at the level of codons and a global solution such as the tRNA pool can mitigate the impact of translation errors. We provide a framework to study the evolutionary impact of codon-specific translation errors and a method for their proteome-wide detection across organisms and conditions.

Estimating the Rate of Mutation to a Mutator Phenotype

A mutator is a variant in a population of organisms whose mutation rate is higher than the average mutation rate in the population. For genetic and population dynamics reasons, mutators are produced and survive with much greater frequency than anti-mutators (variants with a lower-than-average mutation rate). This strong asymmetry is a consequence of both fundamental genetics and natural selection; it can lead to a ratchet-like increase in the mutation rate. The rate at which mutators appear is, therefore, a parameter that should be of great interest to evolutionary biologists generally; for example, it can influence: (1) the survival duration of a species, especially asexual species (which are known to be short-lived), (2) the evolution of recombination, a process that can ameliorate the deleterious effects of mutator abundance, (3) the rate at which cancer appears, (4) the ability of pathogens to escape immune surveillance in their hosts, (5) the long-term fate of mitochondria, etc. In spite of its great relevance to basic and applied science, the rate of mutation to a mutator phenotype continues to be essentially unknown. The reasons for this gap in our knowledge are largely methodological; in general, a mutator phenotype cannot be observed directly, but must instead be inferred from the numbers of some neutral “marker” mutation that can be observed directly: different mutation-rate variants will produce this marker mutation at different rates. Here, we derive the expected distribution of the numbers of the marker mutants observed, accounting for the fact that some of the mutants will have been produced by a mutator phenotype that itself arose by mutation during the growth of the culture. These developments, together with previous enhancements of the Luria–Delbrück assay (by one of us, dubbed the “Jones protocol”), make possible a novel experimental protocol for estimating the rate of mutation to a mutator phenotype. Simulated experiments using biologically reasonable parameters that employ this protocol show that such experiments in the lab can give us fairly accurate estimates of the rate of mutation to a mutator phenotype. Although our ability to estimate mutation-to-mutator rates from simulated experiments is promising, we view this study as a proof-of-concept study and an important first step towards practical empirical estimation.

Destructive effects of UVC radiation on Drosophila melanogaster: Mortality, fertility, mutations, and molecular mechanisms.

The detrimental effects of ultraviolet C (UVC) radiation on living organisms, with a specific focus on the fruit fly Drosophila melanogaster, were examined. This study investigated the impact of heightened UVC radiation exposure on D. melanogaster by assessing mortality and fertility rates, studying phenotypic mutations, and investigating the associated molecular mechanisms. The findings of this study revealed that UVC radiation increases mortality rates and decreases fertility rates in D. melanogaster. Additionally, phenotypic wing mutations were observed in the exposed flies. Furthermore, the study demonstrated that UVC radiation downregulates the expression of antioxidant genes, including superoxide dismutase (SOD), manganese-dependent superoxide dismutase (Mn-SOD), zinc-dependent superoxide dismutase (Cu-Zn-SOD), and the G protein-coupled receptor methuselah (MTH) gene. These results suggest that UVC radiation exerts a destructive effect on D. melanogaster by inducing oxidative stress, which is marked by the overexpression of harmful oxidative processes and a simultaneous reduction in antioxidant gene expression. In conclusion, this study underscores the critical importance of comprehending the deleterious effects of UVC radiation, not only to safeguard human health on Earth, but also to address the potential risks associated with space missions, such as the ongoing Emirate astronaut program.

Signification and Application of Mutator and Antimutator Phenotype-Induced Genetic Variations in Evolutionary Adaptation and Cancer Therapeutics.

Mutations present a dichotomy in their implications for cellular processes. They primarily arise from DNA replication errors or damage repair processes induced by environmental challenges. Cumulative mutations underlie genetic variations and drive evolution, yet also contribute to degenerative diseases such as cancer and aging. The mutator phenotype elucidates the heightened mutation rates observed in malignant tumors. Evolutionary adaptation, analogous to bacterial and eukaryotic systems, manifests through mutator phenotypes during changing environmental conditions, highlighting the delicate balance between advantageous mutations and their potentially detrimental consequences. Leveraging the genetic tractability of Saccharomyces cerevisiae offers unique insights into mutator phenotypes and genome instability akin to human cancers. Innovative reporter assays in yeast model organisms enable the detection of diverse genome alterations, aiding a comprehensive analysis of mutator phenotypes. Despite significant advancements, our understanding of the intricate mechanisms governing spontaneous mutation rates and preserving genetic integrity remains incomplete. This review outlines various cellular pathways affecting mutation rates and explores the role of mutator genes and mutation-derived phenotypes, particularly prevalent in malignant tumor cells. An in-depth comprehension of mutator and antimutator activities in yeast and higher eukaryotes holds promise for effective cancer control strategies.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (&amp;gt;0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G&amp;gt;T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

In Vivo Modeling of T-Cell Acute Lymphoblastic Leukemia Reveals Synergistic Oncogenic Pathways and Bcl11b Haploinsufficiency As a Potential Therapeutic Vulnerability

For decades, T-ALL models were based on retroviral overexpression of NOTCH1 in murine hematopoietic stem cells (HSCs). This induces aggressive T-ALL but does not reflect the genetic and clinical heterogeneity of the disease. Large-scale genomic analyses have mapped the detailed landscape of T-ALL driver events over recent years, but how these diverse oncogenic events interact in T-ALL pathogenesis and which vulnerabilities this creates remains incompletely explored. This is in part due to the lack of appropriate mouse models that recapitulate the complex disease biology and are suitable to identify and study potential therapeutic targets and interventions in a more realistic context. We modeled the genetic heterogeneity of T-ALL through in vivo multiplexing of gain-of-function and loss-of-function oncogenic events known to drive the disease. We developed a novel mouse strain that expresses Cre-recombinase and an inducible Cas9 only in the thymus ( LSL.Cas9 x Lck-cre) along with a lentiviral vector system into which T-ALL specific oncogenes are cloned in antisense flanked by LOX66/71 sites. Gain-of-function events, such as the overexpression of transcriptional regulators ( Tlx1, Tal1, or Lmo2) and signal transducers ( NRAS G12D, PIK3CD E1021K) were induced in developing thymocytes by Cre-mediated inversion together CRISPR-Cas9 editing of recurrent T-ALL loss-of-function drivers. This combinatorial approach allowed to probe more than 2000 possible oncogenic mutational combinations in vivo. Transplantation of HSCs from LSL.Cas9 x Lck-cre mice transduced with our vector system into sublethally irradiated mice led to T-ALL development with different morphology and disease phenotypes. Developing leukemia harbored reproducible phenotypes, covering very immature CD4-CD8-CD25+CD44+ T-ALL in the Tlx1_NRAS subgroup, in contrast to the classical cortical CD4+CD8+CD3- phenotype (Tlx1_PIK3CD subgroup), as well as mature single-positive CD4+CD3+ or CD8+CD3+ blasts (Tal1_Lmo2 subgroup). We identified Tlx1, Tal1, Lmo2, NRAS G12Dand PIK3CD E1021Kas the main driver of disease phenotype and gene expression profile, whereas the loss-of-function mutations contributed to and accelerated the onset of the disease. Tumor-derived cell lines could be easily established and kept their phenotypic characteristics and mutation patterns. The resulting T-ALL tumors contained up to eight different disease-relevant genetic alterations, thus recapitulating the genetic complexity in humans and overcoming the long latency for spontaneous mutations in less complex mouse models. Among these, co-evolution of insertions and deletions in Notch1, Cdkn2a, Bcl11b, and Pten were among the most frequently observed mutations in definitive T-ALL, whereas others, e.g., in Dnm2, Phf6, Etv6, and Lef1, occurred more randomly. While gene editing by CRISPR-Cas9 mostly resulted in frame-shift mutations in both alleles, Bcl11b exhibited a strong haploinsufficient phenotype with exactly one knock-out and one intact allele in each case examined. Following this observation, further suppression of Bcl11b by shRNAs in Bcl11b +/- cell lines derived from our tumor models demonstrated rapid induction of cell death, which was more intense in T-ALL cells compared to non-malignant thymocytes. In addition, re-analysis of CRISPR-based loss-of-function screens of human hematopoietic cell lines retrieved from the Cancer Dependency Map confirmed BCLL11B as a strong selective dependency in human T-ALL. In summary, we model subgroup-specific T-ALL transformation through conditional and multiplexed in vivo gene editing and oncogene overexpression, thus creating a resource of novel mouse models that recapitulate the genetic and biological heterogeneity of the disease. Using our resource, we identified Bcl11b as a strong and selective context-specific dependency in T-ALL. Although Bcl11b is a transcription factor, our results could serve as an starting point for novel therapies that interfere with Bcl11b function, such as molecular glue degraders or protein interaction inhibitors.

Rare germline variants in POLE and POLD1 encoding the catalytic subunits of DNA polymerases ε and δ in glioma families

Pathogenic germline variants in the DNA polymerase genes POLE and POLD1 cause polymerase proofreading-associated polyposis, a dominantly inherited disorder with increased risk of colorectal carcinomas and other tumors. POLE/POLD1 variants may result in high somatic mutation and neoantigen loads that confer susceptibility to immune checkpoint inhibitors (ICIs). To explore the role of POLE/POLD1 germline variants in glioma predisposition, whole-exome sequencing was applied to leukocyte DNA of glioma patients from 61 tumor families with at least one glioma case each. Rare heterozygous POLE/POLD1 missense variants predicted to be deleterious were identified in glioma patients from 10 (16%) families, co-segregating with the tumor phenotype in families with available DNA from several tumor patients. Glioblastoma patients carrying rare POLE variants had a mean overall survival of 21 months. Additionally, germline variants in POLD1, located at 19q13.33, were detected in 2/34 (6%) patients with 1p/19q-codeleted oligodendrogliomas, while POLE variants were identified in 2/4 (50%) glioblastoma patients with a spinal metastasis. In 13/15 (87%) gliomas from patients carrying POLE/POLD1 variants, features of defective polymerase proofreading, e.g. hypermutation, POLE/POLD1-associated mutational signatures, multinucleated cells, and increased intratumoral T cell response, were observed. In a CRISPR/Cas9-derived POLE-deficient LN-229 glioblastoma cell clone, a mutator phenotype and delayed S phase progression were detected compared to wildtype POLE cells. Our data provide evidence that rare POLE/POLD1 germline variants predispose to gliomas that may be susceptible to ICIs. Data compiled here suggest that glioma patients carrying POLE/POLD1 variants may be recognized by cutaneous manifestations, e.g. café-au-lait macules, and benefit from surveillance colonoscopy.

Unlike TET2 and ASXL1, Co-Occurring DNMT3A Mutations Are Not Associated with Increased Age in JAK2-Mutant Myeloproliferative Neoplasms (MPNs)

MPNs including essential thrombocythemia (ET), polycythemia vera (PV), and myelofibrosis (MF) are characterized by JAK2, CALR and MPL mutations. Additional mutations outside these driver genes also co-occur. To better understand interactions between phenotypic driver mutations and concomitant mutations, we evaluated patterns of somatic mutation acquisition in 1301 MPN (535 ET, 392 PV, 331 MF, and 43 MPN NOS) patients who underwent clinical next generation sequencing (NGS) at our institution. For this analysis, we focused on a single NGS panel obtained closest to MPN diagnosis. Median age at MPN diagnosis was 59 years, with MF patients older than ET/PV patients (p&amp;lt;4e-11). 67%, 17%, and 4.5% of patients had mutations in JAK2, CALR, or MPL. The average variant allele fraction (VAF) for JAK2, CALR and MPL was 48%, 34%, and 40%. 52% of patients had pathogenic mutations in an additional gene (range 0-7), most frequently TET2, DNMT3A, and ASXL1. PV patients were more likely to have a TET2 mutation compared with JAK2-mutated ET patients (42% vs 25%). Mutation combinations that occurred together more frequently than expected (p&amp;lt;1e-3) included DNMTA-TET2, ASXL1-TET2, ASXL1-DNMT3A, and ASXL1-SRSF2. We then investigated how these concomitant mutations interacted with the MPN driver mutation and each other. JAK2-mutatedMPN patients with no concomitant mutations were younger than JAK2-mutated patients with TET2 or ASXL1 mutations. In contrast, age distributions were similar between JAK2-only patients and those with JAK2 and DNMT3A mutations (Fig 1A). This observation held when looking within PV and ET, and whether patients with single or multiple concomitant mutations were considered. Since DNMT3A, TET2 and ASXL1 clonal hematopoiesis is associated with increasing age, the similar age distribution of JAK2-only and JAK2-DNMT3A co-mutant patients was an unexpected finding, and worthy of further study. We evaluated the fraction of JAK2-mutated patients with a given concomitant mutation as a function of age. The fraction of patients with TET2 and ASXL1 mutations increased with age, but not the fraction of patients with DNMT3A mutations (95% CI of slope: 4e-3 to 7e-3 for TET2, 0 to 3e-3 for DNMT3A). Similarly, when we evaluated the fraction of JAK2-mutated patients with a given concomitant mutation as a function of JAK2 VAF, the fraction of patients with TET2 and ASXL1 mutations increased as JAK2 VAF increased, but the fraction of patients with DNMT3A mutations decreased (Fig 1B; 95% CI of slope: 1e-3 to 3e-3 for TET2, -2e-3 to 0 for DNMT3A). One potential explanation for this is that JAK2 and DNMT3A mutations occur as independent clonal acquisitions and that the JAK2-mutant clone “out-competes” the DNMT3A-mutant clone over time. At JAK2 VAFs of 50% and 100%, the ratio of TET2:JAK2 VAFs clustered at 1.0 and 0.5, suggesting frequent presence of a dominant JAK2-TET2 clone in all cells with heterozygous or homozygous JAK2 mutations. ASXL1 mutations occurred mostly in patients with JAK2 VAF &amp;gt; 50%, consistent with it being a subclonal acquisition. In contrast, DNMT3A concomitant mutations were more likely to occur in patients with JAK2 VAF&amp;lt;50% vs &amp;gt;50%, again suggesting that DNMT3A clones diminish as JAK2 clones expand. 6/45 DNMT3A mutations that occurred as the sole concomitant mutation were R882 hotspot mutations. However, DNMT3A was more likely to co-occur at JAK2 VAF&amp;gt;50% in patients with &amp;gt;1 concomitant mutation (most commonly TET2). This suggests that in the context of JAK2-mutant driven MPNs, DNMT3A subclones may require the presence of an additional mutation to expand. In summary, we found DNMT3A mutations behave differently from TET2 and ASXL1 mutations in JAK2-mutant MPNs. Patients with JAK2-mutant MPN are less likely to have DNMT3A mutations as JAK2 VAF increases. Compared with TET2 or ASXL1, DNMT3A appears more likely to exist as an independent clone in JAK2-mutant MPN, with our data suggesting the JAK2-mutant clone exhibits increased fitness compared to the DNMT3A-mutantclone over time. However, DNMT3A mutations persist when accompanied by other concomitant mutations (particularly TET2). These results raise interesting questions regarding clonal competition in MPN. Since all our analyses were performed from single clinical NGS panels, our findings require additional validation, including with multi-gene single-cell genotyping, which we are currently pursuing.