Bacteriophage T4 DNA Ligase Research Articles

Single-Stranded DNA-Binding Proteins Mediate DSB Repair and Effectively Improve CRISPR/Cas9 Genome Editing in Escherichia coli and Pseudomonas.

Single-stranded DNA-binding proteins (SSBs) are essential for all living organisms. Whether SSBs can repair DNA double-strand breaks (DSBs) and improve the efficiency of CRISPR/Cas9-mediated genome editing has not been determined. Here, based on a pCas/pTargetF system, we constructed pCas-SSB and pCas-T4L by replacing the λ-Red recombinases with Escherichia coli SSB and phage T4 DNA ligase in pCas, respectively. Inactivation of the E. coli lacZ gene with homologous donor dsDNA increased the gene editing efficiency of pCas-SSB/pTargetF by 21.4% compared to pCas/pTargetF. Inactivation of the E. coli lacZ gene via NHEJ increased the gene editing efficiency of pCas-SSB/pTargetF by 33.2% compared to pCas-T4L/pTargetF. Furthermore, the gene-editing efficiency of pCas-SSB/pTargetF in E. coli (ΔrecA, ΔrecBCD, ΔSSB) with or without donor dsDNA did not differ. Additionally, pCas-SSB/pTargetF with donor dsDNA successfully deleted the wp116 gene in Pseudomonas sp. UW4. These results demonstrate that E. coli SSB repairs DSBs caused by CRISPR/Cas9 and effectively improves CRISPR/Cas9 genome editing in E. coli and Pseudomonas.

The phage T4 DNA ligase in vivo improves the survival-coupled bacterial mutagenesis

BackgroundMicrobial mutagenesis is an important avenue to acquire microbial strains with desirable traits for industry application. However, mutagens either chemical or physical used often leads narrow library pool due to high lethal rate. The T4 DNA ligase is one of the most widely utilized enzymes in modern molecular biology. Its contribution to repair chromosomal DNA damages, therefore cell survival during mutagenesis will be discussed.ResultsExpression of T4 DNA ligase in vivo could substantially increase cell survival to ionizing radiation in multiple species. A T4 mediated survival-coupled mutagenesis approach was proposed. When polyhydroxybutyrate (PHB)-producing E. coli with T4 DNA ligase expressed in vivo was subjected to ionizing radiation, mutants with improved PHB production were acquired quickly owing to a large viable mutant library generated. Draft genome sequence analysis showed that the mutants obtained possess not only single nucleotide variation (SNV) but also DNA fragment deletion, indicating that T4 DNA ligase in vivo may contribute to the repair of DNA double strand breaks.ConclusionsExpression of T4 DNA ligase in vivo could notably enhance microbial survival to excess chromosomal damages caused by various mutagens. Potential application of T4 DNA ligase in microbial mutagenesis was explored by mutating and screening PHB producing E. coli XLPHB strain. When applied to atmospheric and room temperature plasma (ARTP) microbial mutagenesis, large survival pool was obtained. Mutants available for subsequent screening for desirable features. The use of T4 DNA ligase we were able to quickly improve the PHB production by generating a larger viable mutants pool. This method is a universal strategy can be employed in wide range of bacteria. It indicated that traditional random mutagenesis became more powerful in combine with modern genetic molecular biology and has exciting prospect.

The phage T4 DNA ligase mediates bacterial chromosome DSBs repair as single component non-homologous end joining

DNA double-strand breaks (DSBs) are one of the most lethal forms of DNA damage that is not efficiently repaired in prokaryotes. Certain microorganisms can handle chromosomal DSBs using the error-prone non-homologous end joining (NHEJ) system and ultimately cause genome mutagenesis. Here, we demonstrated that Enterobacteria phage T4 DNA ligase alone is capable of mediating in vivo chromosome DSBs repair in Escherichia coli. The ligation efficiency of DSBs with T4 DNA ligase is one order of magnitude higher than the NHEJ system from Mycobacterium tuberculosis. This process introduces chromosome DNA excision with different sizes, which can be manipulated by regulating the activity of host-exonuclease RecBCD. The DNA deletion length reduced either by inactivating recB or expressing the RecBCD inhibitor Gam protein from λ phage. Furthermore, we also found single nucleotide substitutions at the DNA junction, suggesting that T4 DNA ligase, as a single component non-homologous end joining system, has great potential in genome mutagenesis, genome reduction and genome editing.

T4 DNA ligase structure reveals a prototypical ATP-dependent ligase with a unique mode of sliding clamp interaction.

DNA ligases play essential roles in DNA replication and repair. Bacteriophage T4 DNA ligase is the first ATP-dependent ligase enzyme to be discovered and is widely used in molecular biology, but its structure remained unknown. Our crystal structure of T4 DNA ligase bound to DNA shows a compact α-helical DNA-binding domain (DBD), nucleotidyl-transferase (NTase) domain, and OB-fold domain, which together fully encircle DNA. The DBD of T4 DNA ligase exhibits remarkable structural homology to the core DNA-binding helices of the larger DBDs from eukaryotic and archaeal DNA ligases, but it lacks additional structural components required for protein interactions. T4 DNA ligase instead has a flexible loop insertion within the NTase domain, which binds tightly to the T4 sliding clamp gp45 in a novel α-helical PIP-box conformation. Thus, T4 DNA ligase represents a prototype of the larger eukaryotic and archaeal DNA ligases, with a uniquely evolved mode of protein interaction that may be important for efficient DNA replication.

Kinetic Analysis of DNA Strand Joining by Chlorella Virus DNA Ligase and the Role of Nucleotidyltransferase Motif VI in Ligase Adenylylation

Chlorella virus DNA ligase (ChVLig) is an instructive model for mechanistic studies of the ATP-dependent DNA ligase family. ChVLig seals 3'-OH and 5'-PO(4) termini via three chemical steps: 1) ligase attacks the ATP α phosphorus to release PP(i) and form a covalent ligase-adenylate intermediate; 2) AMP is transferred to the nick 5'-phosphate to form DNA-adenylate; 3) the 3'-OH of the nick attacks DNA-adenylate to join the polynucleotides and release AMP. Each chemical step requires Mg(2+). Kinetic analysis of nick sealing by ChVLig-AMP revealed that the rate constant for phosphodiester synthesis (k(step3) = 25 s(-1)) exceeds that for DNA adenylylation (k(step2) = 2.4 s(-1)) and that Mg(2+) binds with similar affinity during step 2 (K(d) = 0.77 mM) and step 3 (K(d) = 0.87 mM). The rates of DNA adenylylation and phosphodiester synthesis respond differently to pH, such that step 3 becomes rate-limiting at pH ≤ 6.5. The pH profiles suggest involvement of one and two protonation-sensitive functional groups in catalysis of steps 2 and 3, respectively. We suggest that the 5'-phosphate of the nick is the relevant protonation-sensitive moiety and that a dianionic 5'-phosphate is necessary for productive step 2 catalysis. Motif VI, located at the C terminus of the OB-fold domain of ChVLig, is a conserved feature of ATP-dependent DNA ligases and GTP-dependent mRNA capping enzymes. Presteady state and burst kinetic analysis of the effects of deletion and missense mutations highlight the catalytic contributions of ChVLig motif VI, especially the Asp-297 carboxylate, exclusively during the ligase adenylylation step.

In Vitro Ligation of Oligodeoxynucleotides Containing C8-Oxidized Purine Lesions Using Bacteriophage T4 DNA Ligase

Ligases conduct the final stage of repair of DNA damage by sealing a single-stranded nick after excision of damaged nucleotides and reinsertion of correct nucleotides. Depending upon the circumstances and the success of the repair process, lesions may remain at the ligation site, either in the template or at the oligomer termini to be joined. Ligation experiments using bacteriophage T4 DNA ligase were carried out with purine lesions in four positions surrounding the nick site in a total of 96 different duplexes. The oxidized lesion 8-oxo-7,8-dihydroguanosine (OG) showed, as expected, that the enzyme is most sensitive to lesions on the 3' end of the nick compared to the 5' end and to lesions located in the intact template strand. In general, substrates containing the OG.A mismatch were more readily ligated than those with the OG.C mismatch. Ligations of duplexes containing the OA.T base pair (OA = 8-oxo-7,8-dihydroadenosine) that could adopt an anti-anti conformation proceeded with high efficiencies. An OI.A mismatch-containing duplex (OI = 8-oxo-7,8-dihydroinosine) behaved like OG.A. Due to its low reduction potential, OG is readily oxidized to secondary oxidation products, such as the guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) nucleosides; these lesions also contain an oxo group at the original C8 position of the purine. Ligation of oligomers containing Gh and Sp occurred when opposite A and G, although the overall ligation efficiencies were much lower than those of most OG base pairs. Steady-state kinetic studies were carried out for representative examples of lesions in the template. Km increased by 90-100-fold for OG.C-, OI.C-, OI.A-, and OA.T-containing duplexes compared to that of a G.C-containing duplex. Substrates containing Gh.A, Gh.G, Sp.A, and Sp.G base pairs exhibited Km values 20-70-fold higher than that of the substrate containing a G.C base pair, while the Km value for OG.A was 5 times lower than that for G.C.

Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions

MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleotide cassette and is used as an amplimer in the PCR. There is no need to purify or phosphorylate the deprotected oligonucleotide before use. Dissolve the oligonucleotide in TE (pH 7.6) at a concentration of 5.0 OD260/ml solution (approx. 17 μM). Oligonucleotide cassette (5.0 OD260/ml [approx. 8.5 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAGGGTTAGGTTCCTGCTACATCTCCAGCCTTGCA3' This 64-nucleotide single-stranded cassette is designed for ligation to target DNAs carrying termini generated by PstI or NsiI. The four 3'-terminal nucleotides (underlined) are complementary to the protruding termini of fragments of DNA generated by cleavage with these enzymes. If another restriction enzyme is used, the nucleotides at the 3' end of the linker must be changed so as to complement the protruding terminus generated by the enzyme. Before use, the oligonucleotide should be purified by C18 chromatography or electrophoresis through a 12% polyacrylamide gel. The 5' terminus of the oligonucleotide should not be phosphorylated. Phenol:chloroform (1:1, v/v) Restriction endonucleases PstI or NsiI Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity V... http://cshprotocols.cshlp.org/cgi/content/full/2006/2/pdb.prot4009?print=true

Cloning PCR Products into T Vectors

MATERIALS Bacteriophage T4 DNA ligase T vector Target DNA (25 μg/ml), amplified by PCR When the PCR mixture contains more than one or two bands of amplified DNA, purify the target fragment by electrophoresis through low melting/gelling temperature agarose (please see Recovery of DNA from Low-meltingtemperature Agarose Gels: Organic Extraction). If not purified by gel electrophoresis, PCR-amplified DNA should be prepared for ligation by extraction with phenol:chloroform and ultrafiltration through a Centricon-100 filter (please see Removal of Oligonucleotides and Excess dNTPs from Amplified DNA by Ultrafiltration).

An Error-Prone Viral DNA Ligase

Our recent demonstration that DNA polymerase X (Pol X), the DNA repair polymerase encoded by the African swine fever virus (ASFV), is extremely error prone during single-nucleotide gap filling led us to hypothesize that it might contribute to genetic variability in ASFV. For the infidelity of Pol X to be relevant, however, the DNA ligase working downstream of it would need to be capable of sealing nicks containing 3'-OH mismatches. We therefore examined the nick ligation capabilities of the ASFV-encoded DNA ligase and here report the first complete 3' fidelity analysis, employing catalytic parameters, for any DNA ligase. The catalytic efficiency of nick sealing by both ASFV DNA ligase and bacteriophage T4 DNA ligase was determined in the steady state for substrates containing all 16 possible matched and mismatched base pair combinations at the 3' side of a nick. Our results indicate that ASFV DNA ligase is the lowest-fidelity DNA ligase ever reported, capable of ligating a 3' C:T mismatched nick (where C and T are the templating and nascent nucleotides, respectively) more efficiently than nicks containing Watson-Crick base pairs. Comparison of the mismatch specificity of Pol X with that of ASFV DNA ligase suggests that the latter may have evolved toward low fidelity for the purpose of generating the broadest possible spectrum of sealed mismatches. These findings are discussed in light of the genetic and antigenic variability observed among some ASFV isolates. Two novel assays for determining the concentration of active DNA ligase are also reported.

Ligating DNA with DNA.

Cloning DNA typically involves the joining of target DNAs with vector constructs by enzymatic ligation. A commonly used enzyme for this reaction is bacteriophage T4 DNA ligase, which requires ATP as the energy source to catalyze the otherwise unfavorable formation of a phosphodiester bond. Using in vitro selection, we have isolated a DNA sequence that catalyzes the ligation of DNA in the absence of protein enzymes. We have used the action of two catalytic DNAs, an ATP-dependent self-adenylating deoxyribozyme (AppDNA) and a self-ligating deoxyribozyme, to create a ligation system that covalently joins oligonucleotides via the formation of a 3',5'-phosphodiester linkage. The two-step process is conducted in separate reaction vessels wherein the products of deoxyribozyme adenylation are purified before their use as substrates for deoxyribozyme ligation. The final ligation step of the deoxyribozyme-catalyzed sequence of reactions mimics the final step of the T4 DNA ligase reaction. The initial rate constant (k(obs)) of the optimized deoxyribozyme ligase was found to be 1 x 10(-)(4) min(-)(1). Under these conditions, the ligase deoxyribozyme promotes DNA ligation at least 10(5)-fold faster than that generated by a simple DNA template. The self-ligating deoxyribozyme has also been reconfigured to generate a trans-acting construct that joins separate DNA oligonucleotides of defined sequence. However, the sequence requirements of the AppDNA and that of the 3' terminus of the deoxyribozyme ligase limit the range of sequences that can be ligated.

Improved full-length cDNA production based on RNA tagging by T4 DNA ligase.

Second-strand cDNA priming is a central problem for full-length characterization of transcripts. A new strategy using bacteriophage T4 DNA ligase and partially degenerate adapters is proposed for grafting a sequence tag to the end of polyribonucleotides. Based on this RNA tagging system and previously described protocols, a new method for full-length cDNA production has been implemented. Validation of the method is shown in Arabidopsis thaliana by the construction of a full-length cDNA library and the analysis of 154 clones and by 5'-RACE-PCR run on a documented experimental system.

Identification of two middle promoters upstream DNA ligase gene 30 of bacteriophage T4

Bacteriophage T4 DNA ligase gene 30 lies in the cluster of prereplicative genes located counterclockwise from map units 149 to 121. Based on the early transcription studies this gene has been considered as a typical early gene of bacteriophage T4. In agreement with this assignment, two strong T4 early promoters, P E 30.8 (128.6) and P E 30.7 (128.2), located about 3.1 and 2.7 kb upstream from gene 30 have been revealed by promoter mapping and sequence analysis. In addition, the existence of a putative early promoter just upstream of gene 30 was proposed from the sequence data. However, here we show that the putative early promoter just upstream of gene 30 is, in fact, a T4 middle promoter. Furthermore, we detected one more middle promoter located in the genomic region between early promoter P E 30.7 (128.2) and DNA ligase gene 30 in the coding region of gene 30.3. Both new middle promoters have differences from the consensus MotA box, while their −10 regions match the σ 70 consensus sequence very well. The 5′ ends of MotA-dependent transcripts directed from these promoters, as well as the kinetics of 5′ end accumulation in the cells, have been determined by primer extension analysis. The results of these analyses indicate that both MotA-dependent and MotA-independent promoters control the transcription of T4 DNA ligase gene 30 in vivo. Moreover, we show that the first transcripts for gene 30 are directed from its own middle promoter, P M 30.

DNA breaks in the centromeric heterochromatin of polytene chromosomes.

Recently, we found that approximately 20% of DNA in metaphase chromosomes and nuclei of mouse cells is in a topologically open state, which is most likely due to stable DNA breaks [1]. The assumption that break-containing DNA domains are located in the heterochromatic regions of chromosomes allowed us to explain many heterochromatin properties [2, 3]. A break-containing DNA molecule cannot exist in torsionally stressed state because of the possibility of rotation of the broken strand ends. This explains the fact that heterochromatin is packed more densely than euchromatin, because open DNA molecules can be packed more densely than closed molecules. In addition, the presence of free ends in the broken DNA strands allows the heterochromatic regions of chromosomes to stick together due to formation of hybrid stretches, leading to the formation of the chromocenters in interphase nuclei and ectopic fibers between the polytene chromosome bands. Although the proposed hypothesis sufficiently explains some heterochromatin properties, certain doubts in its validity still remain. It seems obvious that a long-term existence of DNA breaks in the nuclei of eukaryotes is impossible. If not repaired, they will cause lethal mutations. In this work, we demonstrated the existence of the breaks by using the biochemical method of ligation of DNA breaks in polytene chromosomes of Chironomus melanotus larvae by phage T4 DNA ligase combined with the biophysical method of determination of the topological state of DNA in the chromosomes and nuclei [4].

Reduced ligation during DNA base excision repair supported by BRCA2 mutant cells.

The breast cancer predisposing genes BRCA1 and BRCA2 appear to be involved in DNA repair. In particular, the sensitivity of BRCA2-deficient mouse embryonic fibroblasts to ionizing radiation and the demonstrated interaction of the BRCA2 protein with Rad51, a major factor in recombinational repair, indicate that BRCA2 is important for double strand break repair. The human BRCA2-deficient human cell line Capan-1, whilst being sensitive to ionizing radiation, is also sensitive to the alkylating agent methymethanesulfonate. The major lesions induced by this agent are methylated bases which are removed primarily by the base excision repair (BER) pathway. We have investigated the efficiency of BER in Capan-1 cells by an in vitro assay in which plasmid substrates containing a single lesion are repaired by mammalian cell extracts. In comparison to the control cell lines BxPC-3, T24 and MCF7, Capan-1 cells exhibited a reduced rate of DNA ligation during both the single-nucleotide insertion and PCNA-dependent pathways of BER. The reduced rate of DNA ligation exhibited by Capan-1 cell extracts was complemented by addition of bacteriophage T4 DNA ligase or human DNA ligase III. BRCA2-mutant Capan-1 cells may possess reduced DNA ligase activity during BER.

Second pathway for completion of human DNA base excision-repair: reconstitution with purified proteins and requirement for DNase IV (FEN1).

Two forms of DNA base excision-repair (BER) have been observed: a 'short-patch' BER pathway involving replacement of one nucleotide and a 'long-patch' BER pathway with gap-filling of several nucleotides. The latter mode of repair has been investigated using human cell-free extracts or purified proteins. Correction of a regular abasic site in DNA mainly involves incorporation of a single nucleotide, whereas repair patches of two to six nucleotides in length were found after repair of a reduced or oxidized abasic site. Human AP endonuclease, DNA polymerase beta and a DNA ligase (either III or I) were sufficient for the repair of a regular AP site. In contrast, the structure-specific nuclease DNase IV (FEN1) was essential for repair of a reduced AP site, which occurred through the long-patch BER pathway. DNase IV was required for cleavage of a reaction intermediate generated by template strand displacement during gap-filling. XPG, a related nuclease, could not substitute for DNase IV. The long-patch BER pathway was largely dependent on DNA polymerase beta in cell extracts, but the reaction could be reconstituted with either DNA polymerase beta or delta. Efficient repair of gamma-ray-induced oxidized AP sites in plasmid DNA also required DNase IV. PCNA could promote the Pol beta-dependent long-patch pathway by stimulation of DNase IV.

Practical DNA technology in school — 4: Plasm ids and ligase

Two investigations using plasmid and bacteriophage lambda DNA are described in this paper. These demonstrate molecular biological research techniques in a simple and easy format. Although compromises have to be made in their adaptation to the classroom, the experiments reflect procedures used every day in research laboratories The current paper describes two investigations which can be performed in schools using basic equipment. The practicals analyse the evolution of plasmids using restriction analysis and the effect of bacteriophage T4 DNA ligase. Both investigations illustrate aspects of genetic engineering by demonstrating basic DNA cloning principles, without contravening safety regulations for manipulating DNA in schools.

Specific Function of DNA Ligase I in Simian Virus 40 DNA Replication by Human Cell-free Extracts Is Mediated by the Amino-terminal Non-catalytic Domain

The joining of Okazaki fragments during lagging strand DNA replication in mammalian cells is believed to be due to DNA ligase I. This enzyme is composed of a 78-kDa carboxyl-terminal catalytic domain and a 24-kDa amino-terminal region that is not required for ligation activity in vitro. Extracts of the human cell line 46BR.1G1, in which DNA ligase I is mutationally altered, supported aberrant in vitro SV40 DNA replication; the joining of Okazaki fragments was defective, and unligated intermediates were unstable. Human DNA ligase I, but not DNA ligase III or bacteriophage T4 DNA ligase, complemented both defects in 46BR.1G1 extracts. The catalytic domain of DNA ligase I was 10-fold less effective in complementation experiments than the full-length protein, indicating that the amino-terminal region of the enzyme is required for efficient lagging strand DNA replication. Moreover, in vitro SV40 DNA replication in normal human cell extracts was inhibited by an excess of either full-length DNA ligase I or the amino-terminal region of the protein, but not by the catalytic domain. This inhibition may be mediated by the interaction of the amino-terminal region of DNA ligase I with other replication proteins.

The oligomeric structure of nucleoid protein H-NS is necessary for recognition of intrinsically curved DNA and for DNA bending

Escherichia coli hns, encoding the abundant nucleoid protein H-NS, was subjected to site-directed mutagenesis either to delete Pro115 or to replace it with alanine. Unlike the wild-type protein, hyperproduction of the mutant proteins did not inhibit macromolecular syntheses, was not toxic to cells and caused a less drastic compaction of the nucleoid. Gel shift and ligase-mediated circularization tests demonstrated that the mutant proteins retained almost normal affinity for non-curved DNA, but lost the wild-type capacity to recognize preferentially curved DNA and to actively bend non-curved DNA, a property of wild-type H-NS demonstrated here for the first time. DNase I foot-printing and in vitro transcription experiments showed that the mutant proteins also failed to recognize the intrinsically bent site of the hns promoter required for H-NS transcription autorepression and to inhibit transcription from the same promoter. The failure of the Pro115 mutant proteins to recognize curved DNA and to bend DNA despite their near normal affinity for non-curved DNA can be attributed to a defect in protein-protein interaction resulting in a reduced capacity to form oligomers observed in vitro and by a new in vivo test based on functional replacement by H-NS of the oligomerization domain (C-domain) of bacteriophage lambda cI repressor.

Reconstitution of complete SV40 DNA replication with purified replication factors.

The identification and purification of human cell proteins required for the production of form I DNA following DNA replication from the simian virus 40 (SV40) origin is described. Using these proteins, complete SV40 DNA replication was reconstituted with only purified DNA replication factors: SV40 large tumor antigen (TAg), replication protein A (RPA), DNA topoisomerases I and II, DNA polymerase alpha-primase, replication factor C (RFC), the proliferating cell nuclear antigen (PCNA), DNA polymerase delta, maturation factor 1 (MF1), and DNA ligase I. MF1, a 5' to 3' exonuclease and DNA ligase I were both identified as essential components for production of covalently closed circular relaxed (form I) DNA. MF1 is probably the same exonuclease previously shown by others to function during DNA synthesis on artificial DNA templates or in conjunction with DNA polymerase alpha from the SV40 origin. Combined with these previous studies, our results suggest that MF1 functions to remove an RNA primer attached to every Okazaki fragment during lagging strand DNA synthesis. Interestingly, whereas mammalian DNA ligase I functioned in the reconstituted replication system, mammalian DNA ligase III did not substitute and the phage T4 DNA ligase functioned inefficiently, suggesting that DNA ligase I has a specific role as a replicative DNA ligase in eukaryotic cells.

A novel method for site specific introduction of single model oxidative DNA lesions into oligodeoxyribonucleotides.

Calf thymus terminal deoxynucleotidyl transferase was used to incorporate several products of oxidative base damage onto the 3' end of oligodeoxyribonucleotides. Under the defined conditions described in this report, single residues of dihydrothymine, beta-ureidoisobutyric acid, thymine glycol, urea, 7-hydro-8-oxoadenine, 7-hydro-8-oxoguanine, 5-hydroxycytosine and 5-hydroxyuracil were incorporated into oligodeoxyribonucleotides of different lengths. The reaction is both efficient and cost effective. The 3' termini of the reaction products were suitable substrates for ligation by phage T4 DNA ligase, facilitating greatly the construction of oligodeoxyribonucleotides containing unique and site specific oxidative DNA lesions.