Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity Vectors: Vectorette Polymerase Chain Reactions

Abstract

MATERIALS 10x Amplification buffer Include 0.01% (w/v) gelatin in the buffer. 10x Bacteriophage T4 DNA ligase buffer Bacteriophage T4 DNA ligase Ethanol Optional, please see Step 5. Oligonucleotide (linker) primer (5.0 OD260/ml [approx. 17 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAG3' This oligonucleotide is identical in sequence to the 32 nucleotides at the 5' end of the oligonucleotide cassette and is used as an amplimer in the PCR. There is no need to purify or phosphorylate the deprotected oligonucleotide before use. Dissolve the oligonucleotide in TE (pH 7.6) at a concentration of 5.0 OD260/ml solution (approx. 17 μM). Oligonucleotide cassette (5.0 OD260/ml [approx. 8.5 μM]) in TE (pH 7.6) 5'CATGCTCGGTCGGGATAGGCACTGGTCTAGAGGGTTAGGTTCCTGCTACATCTCCAGCCTTGCA3' This 64-nucleotide single-stranded cassette is designed for ligation to target DNAs carrying termini generated by PstI or NsiI. The four 3'-terminal nucleotides (underlined) are complementary to the protruding termini of fragments of DNA generated by cleavage with these enzymes. If another restriction enzyme is used, the nucleotides at the 3' end of the linker must be changed so as to complement the protruding terminus generated by the enzyme. Before use, the oligonucleotide should be purified by C18 chromatography or electrophoresis through a 12% polyacrylamide gel. The 5' terminus of the oligonucleotide should not be phosphorylated. Phenol:chloroform (1:1, v/v) Restriction endonucleases PstI or NsiI Isolating the Ends of Genomic DNA Fragments Cloned in High-capacity V... http://cshprotocols.cshlp.org/cgi/content/full/2006/2/pdb.prot4009?print=true