Perineal Patterns Of Females Research Articles

Incidence of Root-Knot Nematode on Misai Kucing (Orthosiphon stamineus) in Peninsular Malaysia: A New Discovery

A survey was conducted over one and half years to estimate the occurrence of root-knot nematode infestation on Ortosiphon stamineus (misai kucing) in selected locations around Peninsular Malaysia. Infestations were monitored in ten misai kucing plantation areas in Pulau Pinang, Perak, Negeri Sembilan, Selangor, Johor, Terengganu, and Kelantan. The survey indicated that misai kucing grown on sandy clay-type soil tends to be more susceptible to heavy root-knot nematode infestation. The highest frequency of disease incidence in which almost all the roots of misaim kucing have a knot-like appearance (100%) was reported from the Batu Kurau area. The other two locations, Ipoh and Pantai Baru, had mild infestations, and these were reported as 16% and 4% incidence. The methodology for access the damage caused by the root-knot nematodes in misai kucing, Meloidogyne gall index and its egg-mass index were calculated and these were found in the range of 1-4. The average egg mass from ten randomly selected stunted misai kucing plants from Batu Kurau was recorded as 599.4, with the highest number of 2274 egg mass per plant. Sampled plants showed the significant presence of Meloidogyne incognita. The root-knot nematodes were morphologically identified based on the perineal patterns of females and the head morphology of both Meloidogyne females and males.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

First Report of Meloidogyne enterolobii Infecting Yellow pitaya (Selenicereus megalanthus) in China.

Yellow pitaya, Selenicereus megalanthus, is a night-blooming, climbing cacti of tropical origin, which has received increasing attention for its potential as a new exotic fruit crop (Lichtenzveig et al. 2000). The crop is grown extensively in Hainan Province, China (3000 ha). In October 2021, a survey was conducted on a farm located in Changjiang (19°21'4″N, 108°47'2″S), Hainan Province, China. Some yellow pitaya plants were found that were stunted and chlorotic, with abnormally thin stems (Fig. 1B), and no symptoms on healthy plants (Fig. 1A). Dead plants were also observed. Many galls and females with egg masses were observed on roots (Figs. 1C & 1D). This is typical of root-knot nematode (RKN) infections, and the incidence of infection was 36.7%. Meloidogyne sp. females and egg masses were dissected from roots of the infected plants. The perineal pattern of females (n= 5) was round to oval-shaped with a high dorsal arch (Figs. 1I & 1J). Second-stage juveniles (J2s) had truncated lips (Figs. 1E & 1F) and long-conical tails with bluntly rounded tips (Figs. 1G & 1H). The J2s body length (n= 24) averaged 416.79 μm (349.21 to 472.76 μm) with a mean width of 15.36 μm (12.47 to 17.52 μm); mean stylet length was 11.16 μm (10.10 to 13.23 μm); tail length averaged 53.73 μm (43.46 to 65.90 μm). The morphological characteristics matched the original description of M. enterolobii (Yang and Eisenback 1983). Males were not found. Genomic DNA was extracted from eight single J2s, and the mitochondrial (mtDNA) region between COII and 16S rRNA gene was amplified with primers C2F3/1108 (Powers and Harris 1993). A 652-bp DNA fragment was obtained, for which the sequence (GenBank accession no. OP122499) was 100% identical to the sequences of M. enterolobii isolates from China（MN269947）and the USA (MN809527). Furthermore, species identification was also confirmed using M. enterolobii specific primers Me-F/Me-R. An amplicon size of ∼230 bp was obtained, which is consistent with those previously reported for M. enterolobii (Fig. 2) (Long et al. 2006). Therefore, this population was identified as M. enterolobii based on morphological and molecular characteristics. Pathogenicity tests were performed in the greenhouse at 26℃ and 80% relative humidity with a 14-h/10-h light/dark photoperiod. Ten RKN-free S. megalanthus seedlings were transplanted into pots containing sterilized soil. After 3 weeks, the roots of 5 plants were inoculated with 3,000 eggs and J2s of M. enterolobii per plant. Five uninoculated plants were used as control plants. After 2 months, no galling or symptoms were observed on the control plants. All inoculated plants had galled roots similar to those observed in the field. Females and egg masses were obtained by dissecting galls. The nematode reproduction factor (RF= final population/initial population) was 1.9. Adult females (n= 5) dissected from inoculated plants were identified as M. enterolobii with sequence-specific primers Me-F/Me-R, thus confirming pathogenicity. The pathogenicity test was carried out twice with similar results. M. enterolobii is one of the most damaging species of RKN, due to its wide host range, high level of pathogenicity, and ability to develop and reproduce on several crops with resistance genes to other RKN (Castagnone-Sereno 2012). To our knowledge, this is the first report of S. megalanthus (yellow pitaya) as a host of M. enterolobii in China. Further studies are needed to develop and evaluate integrated management strategies.

First Report of Root-Knot Nematode, Meloidogyne javanica, Infecting Stachys byzantina in São Paulo, Brazil

Stachys byzantina belongs to the Labiatae and is known by the names "peixinho-da-horta" (Brazil) and "lamb's ear" (USA). Its importance is associated with its medicinal properties (Bahadori et al. 2020) and nutritional aspects (Milião et al. 2022). Root-knot nematodes cause severe damage to plants and suppress production. In January 2021, plants of S. byzantina in the municipality of Jaboticabal (21°14'38.7"S, 48°17'10.6"W) showed symptoms of reduced growth, yellowed leaves and the presence of galls in the roots. Initially, samples of roots from a S. byzantina were analyzed at the Nematology Laboratory (LabNema/UNESP), Jaboticabal, Brazil, estimating 20,000 eggs and juveniles of Meloidogyne sp. in 10 g of roots. To confirm the host ability of the species, a pathogenicity test was performed using Koch's postulate. For this purpose, the test was conducted in a greenhouse where 3,000 eggs and second-stage juveniles (J2) were inoculated onto three plants (n=3) of S. byzantina. After 90 days, the inoculated plants showed the same symptoms as those observed in the field. No symptom or nematode was detected in the uninoculated plant (control). Nematodes were extracted from the roots of inoculated plants and quantified. The perineal pattern of females (n=10) (Netscher and Taylor, 1974) and the labial region of males (n=10) (Eisenback and Hirschmann, 1981) were analyzed and compared with the morphological characteristics of the original description of the species (Chitwood, 1949). For analysis based on esterase isozyme phenotype, the α-method of Esbenshade and Triantaphyllou (1990) was used, and females (n=7) were examined. To confirm identification, whole genomic DNA from an adult female (n=1) was extracted using the Qiagen DNeasy® Blood & Tissue Kit and this sample was used for both genetic sequencing and the sequence-characterized amplified region techniques (SCAR). PCR amplifications were performed for the 18s rRNA gene using primers 988F and 1912R from Holterman et al (2006). Our sequence was deposited in GenBank (NCBI) under the identifier OP422209. Finally, species-specific SCAR primers (Fjav/Rjav, Me-F/Me-R, and Finc-F/Finc-R) designed by Zijlstra (2000) were used to identify Meloidogyne spp. Koch's postulate analysis yielded the following results: (n=1) 9,280 eggs and J2 (Reproduction factor, RF = 33.09); (n=2) 111,720 eggs and J2 (RF = 37.24); (n=3) 59,700 eggs and J2 (RF = 19.9) (RF mean = 30.08). The following characteristics were observed in the perineal region of females: Low and rounded trapezoidal dorsal arch with two distinct lateral lines clearly separating the dorsal and ventral arch regions, similar to the morphological features of the species description by Chitwood (1949). Males had a convex labial plate with a non-raised labial disk joining the submedial labia, a non-rugged labial region, the basal tubercles were usually wider than high, and a rounded tail tip (Eisenback and Hirschmann 1981). The α-esterase enzyme profile showed the J3 phenotype typical of M. javanica (Rm [×100] = 46.0, 54.5, and 58.9). The 18s rRNA sequences grouped Meloidogyne sp. with species such as M. enterolobii, M. incognita, and M. javanica. A DNA fragment of about 700 bp was amplified with Mj (Fjav/Rjav) primers, but not with Me (Me-F/Me-R) and Mi (Finc-F/Finc-R) primers, which confirmed the identification of M. javanica. Accurate identification and characterization of the occurrence of new hosts of M. javanica will allow us to determine the range and geographic distribution of the species. This is the first report on the occurrence of M. javanica on S. byzantina in Brazil. This report is important so that management strategies can be applied to prevent the spread of the pest to other areas.

First report of Meloidogyne javanica infecting Bletilla striata in Yunnan, China.

Bletilla striata (Thunb. ex Murray) Rchb. F. (Orchidaceae) is an endangered traditional Chinese medicinal plant and has been traditionally used for hemostasis and detumescence in China (Wang et al. 2022). In March of 2021, during a field survey in Xuanwei city, Yunnan province, China, some B. striata plants with symptoms of plant dwarfing and leaf yellowing were observed. Roots of diseased plants presented numerous galls, typical symptoms of root-knot nematodes (RKNs) infection. The diseased area was approximately 66667 m2, showing a patchy disease distribution pattern. To identify the species of RKNs, females and eggs were isolated from galled tissue, and second-stage juveniles (J2s) were collected from eggs hatched. Nematodes were identified through comprehensive morphological and molecular methods. The perineal pattern of females is round to ovoid with a flat or moderately high dorsal arch and has two conspicuous lateral line striae. Morphological measurements of females (n=20) included body length (L) = 702.9 ± 70.8 (556.2-780.2) μm, body width (BW) = 404.1 ± 48.5 (327.5-470.1) μm, stylet length = 15.5 ± 2.2 (12.3-18.6) μm, distance from base of stylet to dorsal esophageal gland opening (DGO) = 3.7 ± 0.8 (2.1-4.9) μm. The morphometrics of J2s (n=20), L = 438.4 ± 22.6 (354.1-464.8) μm, BW = 17.4 ± 2.0 (12.9-20.8) μm, stylet length = 13.5 ± 0.4 (13.0-14.2) μm, DGO = 3.2 ± 0.6 (2.6-4.7) μm, and hyaline tail terminus = 12.3 ± 1.9 (9.6-15.7) μm. These morphological characteristics were similar to the original descriptions of Meloidogyne javanica (Rammah and Hirschmann 1990). DNA extraction was done 60 times, each from a different single females following the method of Yang et al. (2020). Amplification of ITS1-5.8S-ITS2 region of rDNA and the coxI region of mtDNA was done by using primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992) and cox1F/cox1R (5'-TGGTCATCCTGAAGTTTATG-3'/5'-CTACAACATAATAAGTATCATG-3') (Trinh et al. 2019) respectively. The PCR amplification program followed the method described by Yang et al. (2021). The ITS1-5.8S-ITS2 gene sequence (768 bp, GenBank Accession No. OQ091922) showed 99.35-100% identical to the known sequences of M. javanica (GenBank Accession Nos. KX646187, MW672262, KJ739710, KP901063, MK390613). The coxI gene sequence (410 bp, OQ080070) showed 99.75%-100% identical to the known sequences of M. javanica (OP646645, MZ542457, KP202352, KU372169, KU372170). Furthermore, M. javanica species-specific primers Fjav/Rjav (5'-GGTGCGCGATTGAACTGAGC-3'/5'-CAGGCCCTTCAGTGGAACTATAC-3') were used for PCR amplification. An expected fragment of approximately 670 bp was obtained, which was identical to that previously reported for M. javanica (Zijlstra et al. 2000). To verify pathogenicity of this nematode on B. striata, six 1.6-year-old tissue culture seedings of B. striata were maintained in 10-cm-diameter × 9-cm-high plastic pots containing a sterilized mixed soil (humus soil: laterite soil: perlite=3:1:1), and each plant was inoculated with 1000 J2s hatched from eggs of M. javanica. Three non-inoculated B. striata were used as the negative controls. All plants were placed in a greenhouse at approximately 14～26 ℃. After 90 days, the inoculated plants presented symptoms of leaf yellowing, and the roots with root knots identical to those observed in the fields. The root gall rating was 2 according to the 0-5 RKNs rating scale (Anwar and McKenry, 2002) and the reproductive factor (RF= final population/initial population) was 1.6. No symptoms or nematodes were observed on control plants. The nematode was reisolated and identified as M. javanica by morphological and molecular methods as above. To our knowledge, this is the first report of infection of M. javanica on B. striata. The infection of this economically important medicinal plant with M. javanica could pose a great threat to B. striata production in China, and further research will be necessary to develop control strategies.

First Record of Meloidogyne incognita on Maize (Zea mays) in Shaanxi Province of China.

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it's more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) μm, body width (BW) = 433.73 ±12.84 (343.71-551.61) μm, stylet length = 15.64 ± 1.45 (10.86-28.26) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) μm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) μm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) μm, BW = 33.60 ± 0.79 (30.21-36.52) μm, stylet length = 23.63 ± 0.78 (20.14-26.37) μm, DGO = 3.04 ± 0.09 (2.69-3.38) μm, spicule length = 25.72 ± 0.57 (23.97-28.33) μm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) μm, BW = 15.14 ± 0.26 (13.91-16.66) μm, stylet length = 13.44 ± 0.29 (10.96-14.60) μm, DGO = 2.13 ± 0.18 (1.22-3.10) μm, tail length = 57.46 ± 4.89 (38.85-101.33) μm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) μm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 μm (578.75 - 902.65 μm), maximum body width (W) = 471.97 ± 70.95 μm (318.7 - 586.3 μm), stylet length = 15.18 ± 0.96 μm (13.52 - 17.04 μm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 μm (2.60 - 3.80μm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 μm (375.3 - 552.5 μm), stylet length =12.59 ± 1.39 μm (10.5 - 16.8 μm), tail length= 53.35 ± 1.55 μm (51.8 - 54.9 μm), hyaline tail terminus =11.45 ± 0.65 μm (10.2 - 12.1 μm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) μm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) μm, stylet = 11.11 ± 0.73 (10.05-12.29) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) μm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) μm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) μm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) μm, BW = 28.44 ± 1.18 (26.59-29.83) μm, stylet = 18.27 ± 0.97 (16.57-19.28) μm, DGO = 4.89 ± 0.62 (3.82-5.68) μm, and spicule length = 24.04 ± 1.80 (21.30-26.71) μm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) μm, BW = 13.94 ± 0.70 (12.88-15.34) μm, stylet = 11.82 ± 0.49 (10.96-12.61) μm, DGO = 3.68 ± 0.42 (3.09-4.56) μm, tail length = 55.42 ± 5.81 (46.97-67.03) μm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) μm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

First Report of the Root-Knot Nematode Meloidogyne enterolobii infecting Acalypha australis in China.

Copperleaf (Acalypha australis; Euphorbiaceae), widely cultivated in China, is a traditional Chinese herbal medicine that is used for clearing heat and detoxifying, astringency and hemostasis (Zhang and Zhang 1994). In September 2021, wild Asian copperleaf plants showed leaf yellowing in a corner outside a greenhouse (22°50' N; 108°17' E), Guangxi Province, China. Galls and egg masses were observed on the plant roots on approximately 60% of plants. Females and second-stage juveniles (J2) were dissected and extracted from roots with galls. The perineal pattern of females was dorsal-ventrally oval with low and round dorsal arches, lacking clear lateral lines. Morphological measurements of females (n=20; mean ± standard error) were body length (BL) 697.7 ± 17.3 μm, maximum body width (BW) 521.5 ± 18.3 μm, stylet length 14.8 ± 0.3 μm, and dorsal pharyngeal gland orifice to stylet base (DGO) 5.1 ± 0.2μm. J2s (n = 20) were vermiform, had a slender tail, with a tapering to rounded tip with distinct hyaline region at the tail terminus and had the following morphological measurements: BL 475.5 ± 32.7 μm, BW 16.7 ± 0.6 μm, stylet length 14.4 ± 1.4 μm, DGO 3.9 ± 0.1 μm, hyaline tail length 18.0 ± 0.6 μm, and tail length 50.1 ± 1.2 μm. These morphological characteristics fit the description for Meloidogyne enterolobii (Yang and Eisenback 1983). In order to confirm species identification, genomic DNA was extracted from 12 single J2 (Luo et al. 2020). Species identity was further explored by the rDNA-internal transcribed spacer (ITS) region using primers V5367/26S (Vrain et al. 1992), and the D2-D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (De Ley et al. 1999). The sequences for the target genes were 733 bp (GenBank accession no. OM168996) and 734 bp (GenBank accession no. OM177195), respectively. Homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Furthermore, species identification was confirmed using PCR to amplify a portion of the rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (Long et al. 2006). Koch's postulates was tested in a greenhouse at 25 to 28˚C temperature. Eggs were multiplied on tomato in the greenhouse using a single egg mass hand-picked from originally natural infected A. australis roots. Fifteen A. australis seedlings maintained in 14.5-cm diameter and 10-cm high pots containing autoclaved sandy soil (sand/soil = 3:1), one seedling/pot, inoculated with 5,000 eggs/plant, and five noninoculated seedlings were used as controls. After 60 days, all inoculated plants showed galling root symptoms and the control plants displayed no symptoms. The reproduction factor (Rutter et al. 2021) on A. australis was 4.3. Furthermore, the morphological and molecular characterization of the nematode was identical to the original samples. To our knowledge, this is the first report of M. enterolobii infecting Asian copperleaf that is cultivated in 29 provinces/regions of China. The growers should be aware of this nematode and take measures to avoid spread and serious economic losses.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Bupleurum chinensis in Gansu Province, China.

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 μm, 439.72 to 659.93 μm), W (maximum body width) = (403.92 ± 57.17 μm, 311.01 to 513.34 μm), St (stylet length) = (11.28 ± 1.05 μm, 9.82 to 12.91 μm), MBW (width of the median bulb) = (31.13 ± 3.32 μm, 23.66 to 35.55 μm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 μm, 58,62 to 71.92 μm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 μm, 2.72 to 5.00 μm). Male (n=20): L= (1038.25 ± 90.34 μm, 877.28 to 1206.12 μm), St= (18.13 ± 1.48 μm, 15.10 to 20.12 μm), a (body length divided by greatest body width) = (31.77 ± 4.03 μm, 23.29 to 41.16μm), MBW= (10.97 ± 0.78 μm, 9.05 to 12.31 μm), MB= (64.81 ± 3.45 μm, 59.59 to 71.38 μm), DGO= (4.05 ± 0.47 μm, 3.11 to 5.08 μm), and Spic (spicule length) = (22.57 ± 1.91 μm, 19.26 to 26.43 μm). J2 (n=25): L= (381.73 ± 25.85μm, 336.96 to 419.98 μm), St= (10.52 ± 1.03 μm, 9.15 to 12.14 μm), a= (24.35 ± 2.10 μm, 20.45 to 28.29 μm), DGO= (3.02 ± 0.42 μm, 2.42 to 3.79 μm), c (body length divided by tail length) = (8.90 ± 0.86 μm, 7.71 to 10.48 μm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 μm, 3.47 to 5.04 μm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

First Report of Meloidogyne graminicola on Tomato (Solanum lycopersicum) in Hainan of China.

Tomato (Solanum lycopersicum) is an important vegetable crop in Hainan province, Southern China. In this area, rice and tomato rotation is the most common way for tomato cultivation. During March of 2021, in a field of Yazhou District, Sanya City, Hainan Province, leaves of some tomato plants (cv. Jinsheng) turned yellow, although there were no obvious dwarf plants observed. The tomato plants with yellow leaves exhibiting obvious galls on the roots were collected. Several females and gelatinous egg masses of Meloidogyne spp. were found inside the cortex of the root galls after dissection. The perineal patterns of females (n=12) were dorsal-ventrally oval with low and round dorsal arches, lacking obvious lateral lines. Most of the striae were smooth and sometimes short and irregular striae were observed within them. Morphological measurements of females (n=20) included body length (L) = 569.2 ± 53.6 (457.6 - 662.7) µm, body width (BW) = 342.7 ± 69.8 (245.5 - 457.9) µm, stylet = 11.8 ± 0.7 (10.5 - 13.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.0 ± 0.2 (3.7 - 4.6) µm, vulval slit length = 24.1 ± 3.7 (16.7 - 30.7) µm, and vulval slit to anus distance = 16.0 ±1.9 (12.6 - 19.3) µm. The second-stage juveniles (J2s, n=20) had the following morphological characters: L = 440.6 ± 26.7 (395.7 - 488.3) µm, BW = 15.9 ± 1.0 (14.5 - 17.9) µm. stylet = 13.5 ± 0.8 (12.3 - 14.9) µm, tail length = 69.5 ± 3.7 (65.4 - 76.9) µm, hyaline tail terminus = 21.0 ± 2.1 (17.3 - 24.9) µm. These morphological characters matched the original description of Meloidogyne graminicola (Golden and Birchfield, 1968). Ten individual females were transferred to ten different tubes for DNA extraction. The species-specific primers Mg-F3 (5'-TTATCGCATCATTTTATTTG-3') and Mg-R2 (5'-CGCTTTGTTAGAAAATGACCCT-3') were used for the identification of M. graminicola (Htay et al. 2016). For the ten DNA samples, a 369 bp fragment was amplified by this pair of primers, confirming their identities as M. graminicola. The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A DNA fragment of 531 bp was obtained and the sequence (GenBank Accession No. MZ576221) was 99.8% identical to the sequences of M. graminicola (GenBank Accession Nos. MH033621, MK616527, and MG356945). Part of the rDNA spanning ITS1, 5.8S gene, and ITS2 was amplified with primers 18S (5'-TTGATTACGTCCCTGCCCTTT-3') and 26S (5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequences from the ITS region were 790 bp (GenBank Accession No. MZ312595) and were all 100% identical to the known sequences of M. graminicola (GenBank Accession Nos. MF320126, HM623442, and KY020414). In glasshouse tests, six 30-day-old tomato plants (cv. Jinsheng) were individually transplanted in pots (V sand :V soil = 3:1) and inoculated with 1500 J2s hatched from the egg masses of collected M. graminicola samples per plant. Two non-inoculated tomato plants served as negative controls. After 50 days, inoculated plants had galled roots similar to those encountered in the field and there were J2s and eggs within the galls. The nematode reproduction factor (RF = final population/initial population) was 5.3. No symptoms were observed on control plants. These results confirmed the nematode's pathogenicity on tomato. To our knowledge, this is the first time of a natural infection of tomato with M. graminicola in China.

Occurrence of Meloidogyne morocciensis parasitizing beetroot in Brazil

Beetroot plants cv. Boro exhibiting multiple root galls similar to those symptoms associated with root-knot nematodes (RKNs) were detected in the municipality of Rio Grande, Rio Grande do Sul state, Brazil. The nematode identification was based on an integrative taxonomy. Perineal patterns of females were similar to Meloidogyne arenaria and M. incognita whereas isoenzymatic phenotypes α-esterase A3 and malate dehydrogenase N1 were typical to M. morocciensis. Measurements of second-stage juveniles and males corresponded to the same species. Beetroot plants inoculated with 2.000 specimens of RKN showed reduction of fresh weight of shoots (37%) and roots (30%). The nematode reproduction factor was 11.9. Our study provides the first evidence that M. morocciensis causes root-knot disease in beetroot cv. Boro in Brazil and elsewhere.

First Report of Southern Root-Knot Nematode (Meloidogyne incognita) on Maize in Shandong Province of China

Maize (Zea mays L.) is an important cereal crop globally for food, livestock feed, and raw material for industries. In July and August 2019, patches with poorly developed maize plants were observed in Weifang, Shandong Province, China. Typical root-knot nematode (RKN) symptoms such as stunting and galled roots were observed. Females, males, second-stage juveniles (J2s), and eggs were collected for morphological identification. The perineal pattern of females had a high dorsal arch, which was square or trapezoid and mostly lacking obvious lateral lines. Measurements of females (n = 20): body length (L) = 613.01 ± 68.45 µm (472.38 to 732.11 µm); maximum body width (W) = 381.30 ± 21.92 µm (328.22 to 421.76 µm); stylet length (ST) = 15.75 ± 1.65 µm (13.7 to 19.58 µm); stylet knob height (STKH) = 1.68 ± 0.13 µm (1.51 to 2.06 µm); stylet knob width (STKW) = 3.84 ± 0.32 µm (3.29 to 4.36 µm); and distance from dorsal esophageal gland opening to the stylet knob (DGO) = 3.55 ± 0.26 µm (3.01 to 3.97 µm). Measurements of males (n = 20): L = 1,385.35 ± 144.77 µm (1,061.14 to 1,617.03 µm); W = 35.50 ± 4.24 µm (24.66 to 41.47 µm); L/W = 39.40 ± 4.95 (31.12 to 50.49); L/distance from body anterior end to junction of esophagus and intestine = 14.71 ± 1.59 (11.41 to 17.34); ST = 20.11 ± 1.78 µm (17.32 to 23.34 µm); STKH = 2.70 ± 0.62 µm (1.25 to 3.75 µm); STKW = 3.68 ± 0.71 µm (2.03 to 4.63 µm); DGO = 3.52 ± 0.36 µm (2.72 to 3.98 µm); and spicule length = 29.92 ± 2.40 µm (22.1 to 32.91 µm). Measurements of J2s (n = 20): L = 396.21 ± 18.25 µm (360.94 to 425.45 µm); W = 13.75 ± 1.12 µm (11.63 to 15.73 µm); L/W = 28.93 ± 1.52 (25.83 to 31.67); L/distance from body anterior end to junction of esophagus and intestine = 5.86 ± 0.12 (5.63 to 6.04); ST = 10.05 ± 0.88 µm (8.69 to 11.53 µm); STKH = 1.30 ± 0.10 µm (1.15 to 1.47 µm); and DGO = 2.36 ± 0.13 µm (2.07 to 2.56 µm). Measurements of eggs (n = 20): L = 80.80 ± 6.60 µm (69.59 to 95.28 µm); W = 33.70 ± 5.63 µm (23.23 to 44.91 µm); and L/W = 2.45 ± 0.35 (1.97 to 3.07). Morphological characteristics were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949. DNA was extracted from mature females (Castagnone-Sereno et al. 1995). The D2-D3 region of the 28S rDNA was amplified with universal primer pair D2A/D3B and directly sequenced (Al-Banna et al. 2004). The resulting sequence was deposited in GenBank (MN847618); it had >99% identity with other sequences of M. incognita. For confirmation, M. incognita-specific primer pair IncK-14F/IncK-14R was used for amplification of a sequence characterized amplified region (Randig et al. 2002). A ∼400-bp amplification product was observed under UV light. There were no bands obtained for M. javanica using the above primers. Based on morphological and molecular data, the RKN from maize was identified as M. incognita. A pathogenicity test was carried out by inoculating 1,000 J2s to pots containing 2-week-old maize; 15 plants were inoculated, and four noninoculated plants served as controls. Plants were maintained in a greenhouse at 25 to 28°C. Seven weeks after inoculation, all of the inoculated roots had galling symptoms similar to those observed in the field; the root gall index was ∼5 according to a 0 to 10 RKN rating scale (Bridge and Page 1980). No symptoms developed on the controls. M. incognita is one of the most devastating sedentary endoparasites infecting roots of a wide range of crop plants worldwide (Alioto et al. 2015). The use of appropriate rotation crops is important for the management of RKNs. In China, maize was usually recommended in crop rotation as a nonhost crop for the management of RKNs in some cropping systems. However, the detection of this nematode on maize in China indicates that using maize in crop rotation systems may limit the effectiveness in managing RKNs. The findings are significant for integrated management of RKNs, particularly for crop rotation. To our knowledge, this is the first report of M. incognita parasitizing Z. mays in Shandong Province. Further monitoring and control strategies should be followed.

First Report of Meloidogyne incognita Infecting Stachys byzantina in Brazil.

Stachys byzantina C. Koch (Lamiaceae alt. Labiatae), commonly known as lamb's ear, is an important medicinal plant with anti-inflammatory, antitumor, anticancer, antispasmodic, sedative and diuretic properties (Asnaashari et al. 2010). This plant is widely consumed in Europe and Asia as aromatic teas. In Brazil, it is an unconventional food plant, nonetheless, its medicinal properties have been recognized as well as its production. In May 2019, in a Sao Paulo State municipality, Jaboticabal, (21°14'38.7"S 48°17'10.6"W), S. byzantina plants presented reduced growth and chlorotic leaves associated with root galls. In the phytopathological clinic, 7,983 eggs and juveniles of Meloidogyne sp. were counted in 10 g of the plant roots. In 100 cm³ of soil surrounding the plant, 532 second-stage Meloidogyne sp. juveniles (J2) were found. Morphological, enzymatic and molecular identification of the nematode species found were performed (Fig. S1). For morphological analysis, perineal pattern of females (n = 10) and labial region of males (n = 10) were analyzed. In the perineal region of females, a high and trapezoidal dorsal arch with thick striations was observed, whereas the males presented the trapezoidal labial region with the prominent labial disc in relation to the sub-median lips and transverse streaks in the head region, typical characteristics of M. incognita (Kofoid and White, 1919) Chitwood 1949. (Netscher and Taylor 1974; Eisenback and Hirschmann 1981). The esterase enzyme profile, obtained individually from 8 females, was compatible with phenotype I1 [Rm (x100) = 46.25], also associated with M. incognita (Esbenshade and Triantaphyllou 1985). Molecular analysis was realized (n = 3) by applying the primers Finc/Rinc (Zijlstra et al. 2000) in the DNA of individual females, which resulted in the amplification of an amplicon of 1200 bp specific for M. incognita. Pathogenicity testing was conducted in a greenhouse by inoculation of 5,000 eggs and juveniles from the original population into S. byzantina seedlings (n = 4). After 90 days, the inoculated plants, unlike the non-inoculated ones, exhibited symptoms similar to those initially observed in the field. The nematodes were extracted from the roots of the inoculated plants, quantified, and the identity of M. incognita was confirmed. The average reproductive factor obtained was 136.6, confirming the pathogenicity of M. incognita to S. byzantina. Thus, this is the first report of M. incognita associated with S. byzantina in Brazil and in the world. Lamb's ear is a horticultural plant, and its high reproductive factor to M. incognita can also result in damage to the subsequent crops. In addition, Lamb's ear is propagated vegetatively and this favors the spread of nematodes to other areas. This new report is important in order to alert producers to realize the proper management of this nematode in S. byzantina.

First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.

Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24-48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines. Measurements of females (n = 20) included vulval slit length = 26.4 ± 2.7 (23.6 to 31.2) µm, vulval slit to anus distance = 22.1 ± 2.4 (18.9 to 24.7) µm. The J2s had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of J2s (n = 20) were body length = 432.4 ± 23.1 (386.8 to 465.3) µm, body width = 16.2 ± 1.8 (14.2 to 18.9) µm, stylet = 12.8 ± 0.5 (11.6 to 13.7) µm, dorsal esophageal gland orifice to stylet base = 3.6 ± 0.4 (3.1 to 4.8) µm, tail = 52.9 ± 3.8 (46.3 to 61.4) µm, hyaline tail length = 15.7 ± 2.6 (12.5 to 19.2) µm. These morphological characteristics were consistent with the original description of M. enterolobii (Yang and Eisenback 1983). Molecular biology analyses were also conducted to confirm species identification. Genomic DNA was extracted from a single J2 (Song et al. 2017). The ITS rRNA gene and D2-D3 region of the 28S rRNA gene were amplified using the primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The ITS rRNA gene sequence (765 bp, GenBank accession No. MT654126) was 100% identical to M. enterolobii sequences previously obtained from Fujian, China (MT406251) and Vietnam (MG773551), and the D2/D3 region sequence of 28S rRNA gene (759 bp, MT654127) revealed 99% identity with M. enterolobii sequences from Fujian (MT193450) and Taiwan (KP411230), China, and South Carolina, USA (MH800969). In addition, species identification was further confirmed using the M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) and MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC), respectively (Long et al. 2006; Tigano et al. 2010). The PCR products had the expected fragment lengths of 236 bp and 520 bp, which were consistent with those previously reported for M. enterolobii (Long et al. 2006; Tigano et al. 2010). The pathogenicity test of this nematode was performed in a greenhouse at 25°C. Ten industrial hemp seedlings (cv. Longma No. 5 ) maintained in 12-cm diameter and 12-cm high pots containing autoclaved soil, were inoculated with 800 freshly hatched J2s of the original population of M. enterolobii per plant, and 8 non-inoculated seedlings were used as controls. At 60 d after inoculation, all inoculated plants exhibited gall symptoms on the roots similar to those in the field, and the nematode reproduction factor (final population density/initial population density) was 18.2. No symptoms were observed on control plants. These results confirmed the pathogenicity of M. enterolobii on industrial hemp. To our knowledge, this is the first report of industrial hemp as a new host of M. enterolobii in China. As M. enterolobii has a broad host range, a strong pathogenicity, and a high reproduction rate, it could become a major threat to industrial hemp production. Further monitoring and research on effective control strategies are needed.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Codonopsis pilosula in China

Worldwide, root-knot nematodes are among the most important plant-parasitic nematodes infecting and causing yield losses on many important plant species. They can cause extensive galling on plant roots, leading to serious economic losses (Azevedo de Oliveira et al. 2018). Codonopsis pilosula is used extensively in traditional Chinese herbal medicine and is a major economic crop in Gansu province. In the summer of 2019, a survey for plant-parasitic nematodes was conducted in Gansu province, northwest China. During the survey, 35 out of 76 fields of C. pilosula had plants exhibiting stunting, decline, and extensive galling on the secondary and tertiary roots. These are typical symptoms of infection by root-knot nematodes. Females, males, J2s, and eggs collected from roots of C. pilosula had the following morphometric characters: the perineal pattern of females (n = 10) were round-shaped, with low dorsal arches and small punctations near the anus, lateral line marked. Females (n = 20): body length (L) = 579.06 ± 50.19 μm (511.42 to 677.41 μm), maximum body width (W) = 423.81 ± 29.11 μm (396.72 to 467.41 μm), stylet length = 9.93 ± 0.88 μm (8.71 to 11.72 μm), distance from dorsal esophageal gland opening to the stylet knot (DGO) = 4.93 ± 0.42 μm (3.91 to 5.84 μm), stylet median bulb width (MBW) = 29.67 ± 3.61 μm (24.41 to 35.31 μm). Males (n = 10): L = 1,021.75 ± 106.38 μm (885.09 to 1,230.52 μm), stylet length = 17.15 ± 1.41 μm (15.27 to 19.89 μm), DGO = 5.04 ± 0.61 μm (4.24 to 5.83 μm), MBW = 9.82 ± 2.09 μm (7.11 to 14.24 μm), spicule length = 21.97 ± 1.67 μm (19.54 to 24.59 μm). J2s (n = 20): L = 363.66 ± 25.96 μm (322.41 to 398.88 μm), a = 24.41 ± 4.32 (21.33 to 27.12), stylet length = 10.41 ± 0.79 μm (9.01 to 11.32 μm), DGO = 4.01 ± 0.56 μm (3.22 to 5.13 μm), tail length = 53.15 ± 10.56 μm (32.74 to 71.24 μm). Eggs (n = 20): L = 73.92 ± 4.35 μm (68.43 to 80.13 μm), W = 25.19 ± 3.94 μm (20.48 to 30.74 μm). These morphological characteristics are consistent with Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). Molecular analysis was conducted for further research; DNA was isolated from four individual females, and then the ITS region and D2/D3 region of 28S were amplified with primers18S/26S (Vrain et al.1992) and D2A/D3B (Al-Banna et al. 2004), respectively. The D2/D3 region of 28S sequence and ITS sequence were deposited in GenBank under accession numbers MN752204 and MN752202, respectively. D2/D3 region of 28S sequence was 99.84 to 99.91% identical to those of M. hapla from China (KJ755187), Myanmar (MN446015), and Japan (KF430798). The ITS region sequence was 99.31 to 99.61% identical to several sequences of M. hapla from GenBank, including ones from Spain (MH011978), Taiwan (KJ572385), the United States (AY268108), and Japan (LC030357). Furthermore, species identification was also confirmed using PCR to amplify with M. hapla-specific primers Mh-F/Mh-R (Feng et al. 2008). An expected PCR fragment of approximately 462 bp was obtained, which was consistent with M. hapla reported. No amplification products were observed in the control. A pathogenicity test of this M. hapla population was carried out in a growth chamber maintained at 20 to 25°C. Eight healthy C. pilosula seedlings were transplanted into plastic pots (one plant per pot). After 2 weeks, the roots of six plants were inoculated with 3,000 J2s and eggs per root system, and two uninoculated plants were used as a control. After 65 days, all inoculated plants exhibited yellowish leaves and stunting and had extensive galling on roots, which resembled those on field-grown plants. No galling or symptoms were observed on control plants. The final population density was quantified, and mean nematode reproduction factor (final population/initial population) was 4.3. These results confirm this root-knot nematode population on C. pilosula is M. hapla. To our knowledge, this is the first report of M. hapla in Gansu province and the first report of C. pilosula as a new host of M. hapla.

First Report of the Suginami Root-Knot Nematode, Meloidogyne suginamiensis, Infecting Maple Trees, Acer palmatum, from Japan

HomePlant DiseaseVol. 104, No. 1First Report of the Suginami Root-Knot Nematode, Meloidogyne suginamiensis, Infecting Maple Trees, Acer palmatum, from Japan PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of the Suginami Root-Knot Nematode, Meloidogyne suginamiensis, Infecting Maple Trees, Acer palmatum, from JapanJ. F. Gu, Y. W. Fang, and L. L. LiuJ. F. Gu†Corresponding author: J. F. Gu; E-mail Address: jeffgu00@qq.comhttp://orcid.org/0000-0002-8514-813XNingbo Customs Technical Centre (Ningbo Inspection and Quarantine Science Technology Academy), Ningbo 315100, Zhejiang, ChinaSearch for more papers by this author, Y. W. FangNingbo Customs Technical Centre (Ningbo Inspection and Quarantine Science Technology Academy), Ningbo 315100, Zhejiang, ChinaSearch for more papers by this author, and L. L. LiuNingbo Customs Technical Centre (Ningbo Inspection and Quarantine Science Technology Academy), Ningbo 315100, Zhejiang, ChinaSearch for more papers by this author AffiliationsAuthors and Affiliations J. F. Gu † Y. W. Fang L. L. Liu Ningbo Customs Technical Centre (Ningbo Inspection and Quarantine Science Technology Academy), Ningbo 315100, Zhejiang, China Published Online:6 Nov 2019https://doi.org/10.1094/PDIS-07-19-1386-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Thousands of maple trees (Acer palmatum Thunb.) are imported from Japan to the port of Ningbo, China, each year since 2012. In 2018, during an inspection for plant-parasitic nematodes, around 100 s-stage juveniles (J2) of root-knot nematodes were extracted from soil (200 g) surrounding the roots of one of the 18 trees using a modified Baermann funnel. The roots were washed, and small round galls occurring in groups in close proximity were observed on roots with a dissecting microscope. Female root-knot nematodes excised from galls were white, globular to pear-shaped, with projecting neck, slightly flattened to round posteriorly, and without a posterior protuberance. The perineal pattern of females was slightly square to oval, with wavy and very fine, thin striae. The body length and tail of the J2 (n = 25) were 380 to 436 μm and 20.8 to 27.3 μm, respectively. Tail length/tail diameter (c′) = 2.7 to 3.7. Tail conoid and short, deeply constricted, usually one-third of tail length from a broad terminus, and 3.2 to 5.2 μm hyaline region. These morphological characteristics were similar to those of Meloidogyne suginamiensis Toida and Yaegashi, 1984 (Toida and Yaegashi 1984). M. mali Itoh, Ohshima & Ichinohe, 1969 was also reported on maple from Japan, but it could be separated by its oval outline, smooth striae of the female perineal pattern, and longer J2 tail length (30 to 40 μm) with finely rounded almost pointed terminus. The morphological identification was confirmed by sequence analysis of the region between the cytochrome oxidase subunit II (COII) gene and the 16S ribosomal RNA gene in the mitochondrial DNA (mtDNA) with primers C2F3 (5′-GGTCAATGTTCAGAAATTTGTGG-3′) and 1108 (5′-TACCTTTGACCAATCACGCT-3′) (Powers and Harris 1993). The PCR product of mtDNA was 536 bp long and analyzed by PCR-restriction fragment length polymorphism with the following restriction enzymes: AluI, BclI, DdeI, DraI, EcoRI, HindIII, HinfI, MsoI, MseI, SspI, StyI, and VspI. The result was identical to a previous report for M. suginamiensis (Orui 1998). Soil samples were collected for a pot experiment to confirm the nematode’s ability to reproduce on maple. Three maple trees were planted in infested soil and grown for 1 year. Galls, eggs, females, and juveniles were detected in all trees and identified as M. suginamiensis. To our knowledge this is the first report of M. suginamiensis on maple from Japan. M. suginamiensis was first reported on mulberry (Morus spp.) from Japan in 1984; its hosts include woody plants like mulberries, fig (Ficus carica L.), elm (Ulmus spp.), raspberry (Rubus spp.), and cherry (Prunus spp.), and also some weeds and vegetables. This species has only been reported from Japan. The mtDNA and rDNA sequences were deposited in GenBank (accession nos.: COII, MN115432; 18S, MN101829 to MN101832; ITS, MN101821 to MN101828; 28S, MN101833 to MN101838), which will benefit identification worldwide.The author(s) declare no conflict of interest.

First Report of Root-Knot Nematode, Meloidogyne graminicola, on Rice in Sichuan Province, Southwest China

Root-knot nematode, Meloidogyne graminicola, is a major parasite of rice and causes substantial yield loss (Mantelin et al. 2017). In June 2018, stunned, yellowish plants were observed 30 days after transplantation in fields in Guanghan City (31°6′N, 104°13′E), Sichuan Province, Southwest China. Patches of seedlings with chlorosis were observed in source upland seedling nurseries. Galls and hooked tips were found in the roots of rice seedlings and plants. Rice plants (30) were randomly sampled from these and adjacent fields. Females and eggs were observed in galled roots and did not protrude through the root surface. Hatched second-stage juveniles (J2) were also found inside the galls. The perineal pattern of females (n = 9) was oval with low and round dorsal arches, smooth striae, sometimes with a few lines converging at either end of the vulva, and lateral lines obscure or absent. Measurements (mean ± SE, range) of J2 (n = 20): body length (446.7 ± 12.8 µm, 402.6 to 509.1µm), stylet length (12.1 ± 0.4 µm, 10.6 to 13.2 µm), tail length (70.2 ± 2.9 µm, 61.3 to 79.7 µm), and hyaline tail terminus (19.5 ± 1.0 µm, 16.5 to 22.7 µm); male (n = 10) abundant, body cylindrical and fairly long (1,270.0 ± 76.2 µm, 1,043.5 to 1,553.5 µm), stylet length (17.2 ± 0.7 µm, 15.2 to 18.9 µm), and spicule length (21.4 ± 0.4 µm, 20.1 to 22.0 µm). Morphometric analyses were consistent with M. graminicola (Golden and Birchfield 1965). Two individual females from each of 30 samples were transferred to tubes for DNA extraction. The D2 to D3 domain regions of 28S ribosomal RNA (rRNA) gene was amplified with the primers RK28SF (5′-CGGATAGAGTCGGCGTATC-3′) and MR (5′-AACCGCTTCGGACTTCCACCAG-3′) (Ye et al. 2015) and yielded a 589-bp PCR fragment. The internal transcribed spacer (ITS) region was amplified with species-specific primers Mg-F3 (5′-TTATCGCATCATTTTATTTG-3′) and Mg-R2 (5′-CGCTTTGTTAGAAAATGACCCT-3′) (Htay et al. 2016) and yielded a 338-bp PCR fragment. BLAST results of 28S rRNA gene and ITS region had 99% similarity with M. graminicola isolates available in GenBank. Sequence identities were further confirmed by Bayesian phylogeny analyses; they were nested in a well-supported clade (posterior probability = 1) together with other M. graminicola populations. The ITS and 28S rRNA sequences of the females from each of 30 samples were 99 to 100% identical. The ITS and 28S rRNA sequences of one population (GH-2) were deposited in GenBank (MK560173, 28S rRNA; MK559561, ITS). Morphological and molecular characterization confirmed this nematode as M. graminicola. To assess M. graminicola reproductive capacity, 2-week-old rice (Oryza sativa ‘Nipponbare’) seedlings were individually transplanted into a standard tube (25 × 95 mm) containing 10 ml of steam-sterilized sand and absorbent polymer substrate (Reversat et al. 1999), inoculated with 100 J2 of population GH-2 soon after transplanting, and then incubated in a growth chamber under 16/8-h light/dark at 26 to 28°C. There were 20 nematode-inoculated plants and 10 non-inoculated (tap water only) control plants. Twenty-five days after inoculation the number of egg masses and number of eggs per egg mass were determined and the multiplication factor [(number of egg masses × number of eggs per egg mass)/nematode inoculum level] calculated as 8.9 to 11.6. Hook-shaped and galled roots and stunned aboveground parts were observed on all inoculated plants; no symptoms were found on control plants. Observations confirmed the pathogenicity of the isolated M. graminicola population on rice. This is the first report of M. graminicola in Sichuan Province, a major rice-growing area. The first report of M. graminicola in China was in Fujian Province (Liu et al. 2011; Zhou et al. 2015), and it was soon found in other parts of China (Long et al. 2017; Tian et al. 2017; Wang et al. 2017). The infective J2 may be transmitted by gravity irrigation from field to field due to the topography of agricultural lands in the area. The extension of practices of upland nurseries, aerated irrigations, and direct seeding in Sichuan Province may further exacerbate the problem because such practices favor the survival and damage of M. graminicola (De Waele and Elsen 2007; Win et al. 2013). Further monitoring and research on control methods are needed.