Pepper Mottle Virus Research Articles

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Infrared Thermography for Early Detection of Pepper yellow leaf curl virus on Chili Plants

Infrared Thermography for Early Detection of Pepper yellow leaf curl virus on Chili Plants Observations of plant pests and diseases are generally carried out by looking for visual symptoms for each disease target. Agricultural technology 4.0 began to be used for the development of plant disease detection methods. It was reported that there were differences in color and temperature between diseased and healthy plants which could be recorded by a thermal camera. This study aimed to determine the potential of the FLIR One Pro-IOS thermal camera to record differences in color and temperature between viral-infected and healthy chili plants. Chili plants in the greenhouse that were inoculated with Pepper yellow leaf curl virus (PYLCV) experienced an increase in temperature 3 days after inoculation (28.62 ℃) compared to plants that were not inoculated with PYLCV (27.32 ℃). Digital image recording of chili leaf samples from the field showed that plants infected by multiple viruses (Chilli veinal mottle virus, Pepper mottle virus and PYLCV) has higher temperature than those infected with a single virus. The lowest and highest mean temperatures were recorded in plant samples infected with PepMV (17.74 ℃) and mixed infected by PYLCV and ChiVMV (25.68 ℃). Digital images of virus-infected plants tend to show a predominance of bright yellow, while virus-free plants showed a predominance of dark purple. Further analysis confirmed higher digital numbers for diseased plant images than healthy plants. The thermography method has the potential to be an early detection method because it can detect viral infection before visual symptoms appear.

Sequence optimization and multiple gene-targeting improve the inhibitory efficacy of exogenous double-stranded RNA against pepper mottle virus in Nicotiana benthamiana

Double-stranded RNA (dsRNA)-induced RNA interference is a promising agricultural technology for crop protection against various pathogens. Recent advances in this field have enhanced the overall efficiency with which this approach inhibits pathogenic viruses. Our previous study verified that treatment of Nicotiana benthamiana plants with dsRNAs targeting helper component-proteinase (HC-Pro) and nuclear inclusion b (NIb) genes protected the plant from pepper mottle virus (PepMoV) infection. The aim of this study was to improve the inhibitory efficacy of dsRNAs by optimizing the target sequences and their length and by targeting multiple genes via co-treatment of dsRNAs. Each of the two targeting dsRNAs were divided into three shorter compartments and we found that HC-Pro:mid-1st and NIb:mid-3rd showed significantly superior antiviral potency than the other fragments, including the parent dsRNA. In addition, we confirmed that the co-treatment of two dsRNAs targeting HC-Pro and NIb produced a greater inhibition of PepMoV replication than that obtained from individual dsRNA treatment. Complementing our previous study, this study will provide future directions for designing dsRNAs and enhancing their efficiency in dsRNA-mediated RNA interference technologies.

Binding immunoglobulin 2 functions as a proviral factor for potyvirus infections in Nicotiana benthamiana.

Infection of viruses from the genera Bromovirus, Potyvirus, and Potexvirus in Nicotiana benthamiana induces significant up-regulation of the genes that encode the HSP70 family, including binding immunoglobulin protein 2 (BiP2). Three up-regulated genes were knocked down and infection assays with these knockdown lines demonstrated the importance of the BiP2 gene for potyvirus infection but not for infection by the other tested viruses. Distinct symptoms of cucumber mosaic virus (CMV) and potato virus X (PVX) were observed in the BiP2 knockdown line at 10 days postagroinfiltration. Interestingly, following inoculation with either soybean mosaic virus (SMV) or pepper mottle virus (PepMoV) co-expressing green fluorescent protein (GFP), neither crinkle symptoms nor GFP signals were observed in the BiP2 knockdown line. Subsequent reverse transcription-quantitative PCR analysis demonstrated that knockdown of BiP2 resulted in a significant decrease of SMV and PepMoV RNA accumulation but not PVX or CMV RNA accumulation. Further yeast two-hybrid and co-immunoprecipitation analyses validated the interaction between BiP2 and nuclear inclusion protein b (NIb) of SMV. Together, our findings suggest the crucial role of BiP2 as a proviral host factor necessary for potyvirus infection. The interaction between BiP2 and NIb may be the critical factor determining susceptibility in N.benthamiana, but further studies are needed to elucidate the underlying mechanism.

Sequencing and Variant Detection of Eight Abundant Plant-Infecting Tobamoviruses across Southern California Wastewater.

Tobamoviruses are agriculturally relevant viruses that cause crop losses and have infected plants in many regions of the world. These viruses are frequently found in municipal wastewater, likely coming from human diet and industrial waste across wastewater catchment areas. As part of a large wastewater-based epidemiology study across Southern California, we analyzed RNA sequence data from 275 influent wastewater samples obtained from eight wastewater treatment plants with a catchment area of approximately 16 million people from July 2020 to August 2021. We assembled 1,083 high-quality genomes, enumerated viral sequencing reads, and detected thousands of single nucleotide variants from eight common tobamoviruses: bell pepper mottle virus, cucumber green mottle mosaic virus, pepper mild mottle virus, tobacco mild green mosaic virus, tomato brown rugose fruit virus, tomato mosaic virus, tomato mottle mosaic virus, and tropical soda apple mosaic virus. We show that single nucleotide variants had amino acid-altering consequences along with synonymous mutations, which represents potential evolution with functional consequences in genomes of these viruses. Our study shows the importance of wastewater sequencing to monitor the genomic diversity of these plant-infecting viruses, and we suggest that our data could be used to continue tracking the genomic variability of such pathogens. IMPORTANCE Diseases caused by viruses in the genus Tobamovirus cause crop losses around the world. As with other viruses, mutation occurring in the virus's genomes can have functional consequences and may alter viral infectivity. Many of these plant-infecting viruses have been found in wastewater, likely coming from human consumption of infected plants and produce. By sequencing RNA extracted from influent wastewater obtained from eight wastewater treatment plants in Southern California, we assembled high-quality viral genomes and detected thousands of single nucleotide variants from eight tobamoviruses. Our study shows that Tobamovirus genomes vary at many positions, which may have important consequences when designing assays for the detection of these viruses by agricultural or environmental scientists.

Identification of viral genes involved in pepper mottle virus replication and symptom development in Nicotiana benthamiana.

Pepper mottle virus (PepMoV) infects primarily Capsicum species, including pepper and bell pepper which are important vegetable and spice crops in Korea. We have previously collected 13 PepMoV isolates from nine regions comprising five provinces, causing different symptoms on inoculated indicator host plants in Korea. To further identify the responsible symptom determinant(s) and explore viral protein functions of PepMoV, two out of 13 isolates, including 134 and 205136, were used in this study. Isolate 134 causes necrosis and yellowing, while 205136 causes severe mottle and yellowing symptoms on Nicotiana benthamiana. All chimeric and site-directed mutants contain the PepMoV 134 genome as a backbone with specific regions switched for those from counterparts of PepMoV 205136. Effects of all mutants compared with 134 after inoculation onto N. benthamiana by agroinfiltration. Results from our study provide direct evidence that the helper component-proteinase (HC-Pro) and the nuclear inclusion protein b (NIb)-coat protein (CP) regions are involved in virus accumulation and symptom determinants. In addition, we mapped to amino acid residues tyrosine, glycine, and leucine at position 360, 385, and 527, respectively, in the HC-Pro region participate in faster viral accumulation or movement in the plant. The residue valine at position 2773 of NIb plays an essential role in isolate 134 symptom development. As part of this study, we seek to gain insight into viral factors involved in the PepMoV infection cycle and a better understanding of plant-virus interactions. These findings complement the insufficiency of the gene function study of the PepMoV virus and provide a novel perspective for the protein function study of the Potyvirus.

Characteristics of Virus Symptoms in Chili Plants (Capsicum frutescens) Based on RGB Image Analysis

Virus infection in chili plants may cause various symptoms. The complexity of the symptoms and human vision ability often become limiting factors during disease investigations. Digital image analysis is expected to become a method to assist in comprehensively describing the symptoms of plant viruses. A disease survey was conducted on cayenne pepper fields in Southeast Sulawesi Province to observe symptoms of virus infection virtually and to record the symptomatic plant using an RGB camera. The split-channel method is used to process images, followed by multidimensional scaling statistical analysis. Later on, viruses associated with plants were detected serologically. Single or mixed infection of Tobacco mosaic virus, Cucumber mosaic virus, Chili veinal mottle virus, and Pepper mottle virus was confirmed by plant leaves showing yellow-mosaic and mottle symptoms. The digital image analysis method could show variations in the characteristics of symptoms based on digital numbers in that cannot be recognized based on the observation of visual symptoms. A new approach to study the interactions between plant infecting viruses and their effects based on image analysis has also been developed during this research. This method needs to be further validated through testing under controlled conditions, such as inoculating plants with a predetermined type of virus.

First report of Pepper mottle virus in Iran

Pepper mottle virus is a member of genus Potyvirus and infects many plants worldwide. Bell pepper (Capsicum annuum) leaves with virus symptoms were collected, and after using RT-PCR amplification using pepper mottle virus-specific primers for the coat protein, amplicons were sequenced. Sequences revealed the presence of pepper mottle virus (PeMV) for the first time in Iran. Phylogenetic analysis of the coat protein sequences showed that Iranian isolates shared greatest pairwise identities (98.6%) with those from Korea, and lowest identities (91.5%) with those from Cuba.

Pepper Mottle Virus and Its Host Interactions: Current State of Knowledge.

Pepper mottle virus (PepMoV) is a destructive pathogen that infects various solanaceous plants, including pepper, bell pepper, potato, and tomato. In this review, we summarize what is known about the molecular characteristics of PepMoV and its interactions with host plants. Comparisons of symptom variations caused by PepMoV isolates in plant hosts indicates a possible relationship between symptom development and genetic variation. Researchers have investigated the PepMoV–plant pathosystem to identify effective and durable genes that confer resistance to the pathogen. As a result, several recessive pvr or dominant Pvr resistance genes that confer resistance to PepMoV in pepper have been characterized. On the other hand, the molecular mechanisms underlying the interaction between these resistance genes and PepMoV-encoded genes remain largely unknown. Our understanding of the molecular interactions between PepMoV and host plants should be increased by reverse genetic approaches and comprehensive transcriptomic analyses of both the virus and the host genes.

Symptoms of piper yellow mottle virus in black pepper as influenced by temperature and relative humidity

The online version contains supplementary material available at 10.1007/s13337-021-00686-3.

Rapid and visual detection of tomato spotted wilt virus using recombinase polymerase amplification combined with lateral flow strips

Tomato spotted wilt virus (TSWV) is economically important in Korea as it causes significant losses to a wide range of important ornamental and vegetable crops. Therefore, a rapid detection method is imperative for TSWV diagnosis. Specific primers and probes were designed based on the conserved sequences of the TSWV coat protein gene. In this study, an isothermal reverse transcription recombinase polymerase amplification (RT-RPA) assay, combined with lateral flow strips (LFS), was established for rapid detection of TSWV in pepper infected leaves. The RT-RPA reaction was performed at an optimal condition of 38 °C for 10 min and an LFS incubation time of approximately 5 min. There was no cross-reactivity with other viruses infecting pepper such as cucumber mosaic virus, pepper mottle virus, pepper mild mottle virus, and broad bean wilt virus 2, thus confirming the specificity of RT-RPA-LFS. The sensitivity of the RT-RPA assay was similar to that of RT-PCR, and RT-RPA-LFS was successfully applied to detect TSWV in the pepper samples collected from the field. Thus, RT-RPA-LFS assay might be a promising candidate for quick diagnosis of TSWV-infected pepper plants.

Occurrence and Distribution of Major Viruses Infecting Eggplant in Lebanon and Molecular Characterization of a Local Potato Virus X Isolate

This research was carried out in order to evaluate the presence and distribution of viral infections causing severe disease in eggplant plants collected from different districts in Bekaa valley, Lebanon. Most infected plants showed virus-like symptoms consisting predominantly of leaf blotch, mottling chlorotic and ring spots; leaf twisting and plant dwarf were also observed in the visited fields. Symptomatic and asymptomatic plants were collected and screened by ELISA test for the presence of several different pathogenic viruses potentially present in the area. Results showed that potato virus Y (PVY) was the most prevalent virus found by ELISA (detected in the 15.3% of the tested plants), followed by eggplant mottled dwarf virus (EMDV, 2.9%) and cucumber mosaic virus (CMV, 1.2%), while tomato spotted wilt virus (TSWV), alfalfa mosaic virus (AMV) and pepper mottle virus (PepMoV) were not detected. Biological indexing of symptomatic ELISA-negative plants, followed by electron microscopy, indicated the presence of virus-like particles of the genus Potexvirus, which was subsequently confirmed as potato virus X (PVX) by RT-PCR and Sanger sequencing. PVX was found in 35.3% of the tested plants, all sampled in the northern Bekaa area. In a phylogenetic analysis, the partial coat protein gene sequence of a selected Lebanese isolate, PVX-AK1, clustered together with other PVX isolates from Asia. Furthermore, the 124-aa sequence of PVX-AK1 shared 100% identity with PVX-UK3, an isolate which is known as avirulent in potato genotypes carrying either Nx or Rx resistance genes. This work revealed a picture of the previously uninvestigated phytosanitary status of eggplant crops in an important horticultural area of Lebanon.

Double-stranded RNA confers resistance to pepper mottle virus in Nicotiana benthamiana

RNA interference (RNAi) is a regulatory mechanism of gene expression mediated by small RNAs. By using the RNAi technique, exogenous double-stranded RNA (dsRNA) designed to target mRNA, suppresses target gene expression levels in plants. In this study, we adopted the RNAi mechanism as a tool to protect plants from viruses. We designed and synthesized several dsRNAs targeting the pepper mottle virus (PepMoV) genes HC-Pro and NIb. When used on Nicotiana benthamiana plants, these dsRNAs protected the plant against viral infection over a specific period. By optimizing dsRNA and virus injection time, the protection efficiency of dsRNA by targeting virus genes could be maximized. It seems that exogenous dsRNA-derived RNA-induced silencing complex was able to defend the host against viral infection instantly. Furthermore, each dsRNA designed to target different regions within a transcript had varying levels of effects on virus survival in the host plants. When targeting the middle part of both the NIb and HC-Pro genes using the dsRNAs, the highest viral growth inhibitory effect was observed. An RLM-5′ RACE was performed using plant leaves infected with PepMoV after dsRNA treatment and it was observed that most of the mRNA cleavages occurred close to the 3′ part within the dsRNA target position on the mRNA. These results suggest that the dsRNA tool can be used as a plant vaccine platform for crop protection.

Evaluation of Chilli Genotypes against Pepper Mottle Virus under Artificial Conditions

Evaluation of Chilli Genotypes against Pepper Mottle Virus under Artificial Conditions

Tobamoviruses of two new species trigger resistance in pepper plants harbouring functional L alleles.

Tobamoviruses are often referred to as the most notorious viral pathogens of pepper crops. These viruses are not transmitted by invertebrate vectors, but rather by physical contact and seeds. In this study, pepper plants displaying mild mottle and mosaic symptoms were sampled in four different regions of Peru. Upon double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) tests, seven samples cross-reacted weakly with antibodies against pepper mild mottle virus (PMMoV), suggesting the presence of tobamoviruses. When employing RT-PCR, conserved primers amplified cDNA fragments of viruses from two putative new tobamovirus species in the samples. The complete genome of two representative isolates were, therefore, sequenced and analysed in silico. These viruses, which were tentatively named yellow pepper mild mottle virus (YPMMoV) and chilli pepper mild mottle virus (CPMMoV), shared highest nucleotide genome sequence identities of 83 and 85 % with bell pepper mottle virus (BpeMV), respectively. Mechanical inoculation of indicator plants with YPMMoV and CPMMoV isolates did not show any obvious differences in host ranges. These viruses were also inoculated mechanically on pepper plants harbouring different resistance L alleles to determine their pathotypes. Pepper plants carrying unfunctional L alleles (L0) to tobamoviruses were infected by all isolates and presented differential symptomatology for YPMMoV and CPMMoV. On the other hand, pepper plants carrying L1, L2, L3 and L4 alleles were resistant to all isolates, indicating that these viruses belong to pathotype P0.

Mycotoxin Contamination of Stored Maize in Kenya and the Associated Fungi

Ethiopian pepper mottle virus is one of the major constraints of pepper production in the central rift valley region of Ethiopia. The present study was conducted to determine optimum netting duration for efficient protection of pepper from vector infestation and subsequent viral infection. For this purpose, an experiment was carried out in the central rift valley of Ethiopia (i.e. Meki and Hawassa districts).

Operative Therapy of Achilles Tendon Rupture - A Critical Questioning of the Actual Literature

Ethiopian pepper mottle virus is one of the major constraints of pepper production in the central rift valley region of Ethiopia. The present study was conducted to determine optimum netting duration for efficient protection of pepper from vector infestation and subsequent viral infection. For this purpose, an experiment was carried out in the central rift valley of Ethiopia (i.e. Meki and Hawassa districts).

Effect of Netting Duration on Ethiopian Pepper Mottle Virus (EPMV) Infection and Aphid Infestation of Hot Pepper (Capsicum annuum L.) in Central Rift Valley Region of Ethiopia

Ethiopian pepper mottle virus is one of the major constraints of pepper production in the central rift valley region of Ethiopia. The present study was conducted to determine optimum netting duration for efficient protection of pepper from vector infestation and subsequent viral infection. For this purpose, an experiment was carried out in the central rift valley of Ethiopia (i.e. Meki and Hawassa districts).

Genome Editing of eIF4E1 in Tomato Confers Resistance to Pepper Mottle Virus.

Many of the recessive virus-resistance genes in plants encode eukaryotic translation initiation factors (eIFs), including eIF4E, eIF4G, and related proteins. Notably, eIF4E and its isoform eIF(iso)4E are pivotal for viral infection and act as recessive resistance genes against various potyviruses in a wide range of plants. In this study, we used Clustered Regularly Interspaced Palindromic Repeats/CRISPR-associated protein 9 (CRISPR/Cas9)-mediated targeted mutagenesis to test whether novel sequence-specific mutations at eIF4E1 in Solanum lycopersicum (tomato) cv. Micro-Tom could confer enhanced resistance to potyviruses. This approach produced heritable homozygous mutations in the transgene-free E1 generation. Sequence analysis of eIF4E1 from E0 transgenic plants expressing Cas9 and eIF4E-sgRNA transcripts identified chimeric deletions ranging from 11 to 43 bp. Genotype analysis of the eIF4E1-edited lines in E0, E1, and E2 transgenic tomato plants showed that the mutations were transmitted to subsequent generations. When homozygous mutant lines were tested for resistance to potyviruses, they exhibited no resistance to tobacco etch virus (TEV). Notably, however, several mutant lines showed no accumulation of viral particles upon infection with pepper mottle virus (PepMoV). These results indicate that site-specific mutation of tomato eIF4E1 successfully conferred enhanced resistance to PepMoV. Thus, this study demonstrates the feasibility of the use of CRISPR/Cas9 approach to accelerate breeding for trait improvement in tomato plants.

Inhibitory Effect of Cheese Whey on Cucumber Mosaic Virus and Pepper Mottle Virus in Capsicum annuum

Inhibitory Effect of Cheese Whey on Cucumber Mosaic Virus and Pepper Mottle Virus in Capsicum annuum