Pepino Research Articles

Effect of ripening period on composition of pepino (Solanum muricatum) fruit grown in Turkey

Pepino is a new crop for Turkey. Raw and mature pepino fruits which were grown in greenhouse in Antalya, Mediterranean region of Turkey, were used for compositional analysis. Moisture, protein, ash, oil, sugar, NDF (Neutral detergent fiber) and ADF (Acid detergent fiber) analysis were done at two stages. Moisture was determined as the main component of the fruit by 93.80 and 91.45% for raw and mature fruit respectively. Pepino fruits have fewer amounts of protein, ash and oil at two stages of raw and mature fruits (0.93, 0.78, 0.46, 0.47, 0.05 and 0.09%, respectively). Sugar is the main component of dry matter especially in mature fruit (7.03%). Also, free sugar contents were determined. The contents of glucose and fructose declined during ripening, whereas sucrose showed an increase in concentration as ripening progressed.

Characteristics of Convective Drying of Pepino Fruit (Solanum muricatum Ait.): Application of Weibull Distribution

The aim of this research was to study the behaviour of the drying kinetics of pepino fruit (Solanum muricatum Ait.) at five temperatures (50, 60, 70, 80 and 90 °C). In addition, desorption isotherms were determined at 20, 40 and 60 °C over a water activity range from 0.10 to 0.90. The Guggenheim, Anderson and de Boer model was suitable to depict the desorption data. A monolayer moisture content from 0.10 to 0.14 g water g−1 d.m. was reported. The equations of Newton, Henderson–Pabis, Modified Page, Wang–Singh, Modified Henderson–Pabis, Logarithmic as well as standardised Weibull were tested for modelling drying kinetics. Besides, Fick’s second law model was used to calculate the water diffusion coefficient which increased with temperature from 2.55 to 7.29 × 10−10 m2 s−1, with estimated activation energy of 27.11 kJ mol−1. The goodness of fit of the models was evaluated using sum squared error and chi-square statistical tests. The comparison of the experimental moisture values with respect to the calculated values showed that the standardised Weibull model presented the best goodness of fit, showing that this equation is very accurate for simulating drying kinetics for further optimisation of drying times.

Basil (Ocimum basilicum), a new host of Pepino mosaic virus

Pepino mosaic virus (PepMV), a member of the genus Potexvirus , was first described in 1980 on pepino ( Solanum muricatum ) and was later isolated from different wild species of the genus Solanum (formerly Lycopersicon ) (Soler et al ., 2002). PepMV has been reported in several European countries and in North America, causing disease in tomato. In July 2008, plants of basil ( Ocimum basilicum ) showing interveinal chlorosis on young leaves were observed in three greenhouses in Sicily, in the area where tomato plants were found to be infected by PepMV in 2005 (Davino et al ., 2006). The disease was transmitted mechanically to Nicotiana benthamiana , producing chlorotic spots and leaf deformation. Electron microscopy of negativelystained preparations from basil and N. benthamiana leaves, both with symptoms, revealed the presence of flexuous, filamentous virus particles, typical of potexviruses. Leaves from 100 plants with or without symptoms were analysed by double-antibody sandwich (DAS) ELISA using a polyclonal antibody to PepMV (Loewe Biochemica). The presence of the symptoms was correlated with positive ELISA results. Total RNA was extracted from the same samples using an RNeasy Plant Mini Kit (Qiagen) and analysed by RT-PCR using the PepMV-specific primers PepMV-TGB-F and PepMVUTR-R (Mumford & Metcalfe, 2001). The 840 bp RT-PCR product was

Investigation of Some Effective Factors on Yield Traits of Pepino (Solanum muricatum) as a New Vegetable in Iran

To find out the effects of media culture and foliar fertilization on some yield traits including the number of fruits per bush, mean weight of fruit, yield of per bush, long of fruits and diameter of fruits 9 months completely randomized factorial experiment (3 x 5) with four replications was conducted. Media culture treatments include 5 levels namely soil; mixture of soil and vermy compost; mixture of soil and sand; mixture of soil and peat moss and mixture of soil, sand and peat moss. Foliar fertilization treatments include 3 levels namely applying once a week, once a 3 week and no fertilization (control). The results showed that the media culture treatments on the whole of traits and foliar fertilization also on the whole of traits except yield of per bush had a significant difference (p < 0.01). In the foliar fertilization except yield per bush the once a 3 week fertilization caused highest increase than other treatments and in the media culture treatments, the mixture of soil and peat moss showed highest increase than other treatments.

SURVEY ON SYMPTOM EXPRESSION AND DAMAGE CAUSED BY PEPINO MOSAIC VIRUS IN COMMERCIAL TOMATO PRODUCTION IN BELGIUM

SURVEY ON SYMPTOM EXPRESSION AND DAMAGE CAUSED BY PEPINO MOSAIC VIRUS IN COMMERCIAL TOMATO PRODUCTION IN BELGIUM

First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5' GATGAAGCTGAACAACATTTC 3' and PepTGB-R: 5' GGAGCTGTATTRGGATTTGA 3'). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America).

The kind of pollination and ability to parthenocarpy of pepino (Solanum muricatum Ait.)

Abstract The objective of the research was to assess a grade of parthenocarpic fruit and fruitsetting following cross-pollination and self-pollination in pepino plants (Solanum muricatum Ait.). An experiment with six pepino clones of different origin was set up in glasshouse conditions. Experimental clones were subjected to the following treatments: self-pollination, cross-pollination, and emasculation without any control. The tested clones of pepino were self-pollinated, capable of cross pollination and facultative parthenocarpic. The differences between clones in their ability to parthenocarpic fruit formation were observed. The ripening period of pepino fruits and their weight depended on a clone.

Assessing the risks of releasing a sap-sucking lace bug, Gargaphia decoris, against the invasive tree Solanum mauritianum in New Zealand

The South American tree Solanum mauritianum Scopoli (Solanaceae), a major environmental weed in South Africa and New Zealand, has been targeted for biological control, with releases of agents restricted to South Africa. The leaf-sucking lace bug, Gargaphia decoris Drake (Tingidae), so far the only agent released, has become established in South Africa with recent reports of severe damage at a few field sites. To evaluate the insect’s suitability for release in New Zealand, host-specificity testing was carried out in South Africa in laboratory and open-field trials, with selected cultivated and native species of Solanum from New Zealand. No-choice tests confirmed the results of earlier trials that none of the three native New Zealand Solanum species are acceptable as hosts. Although the cultivated Solanum muricatum Aiton and S. quitoense Lam. also proved unacceptable as hosts, some cultivars of S. melongena L. (eggplant) supported feeding, development and oviposition in the no-choice tests. Although eggplant was routinely accepted under laboratory no-choice conditions in this and previous studies, observations in the native and introduced range of G. decoris, open-field trials and risk assessment based on multiple measures of insect performance indicate that the insect has a host range restricted to S. mauritianum. These results strongly support the proposed release of G. decoris in New Zealand because risks to non-target native and cultivated Solanum species appear to be negligible. An application for permission to release G. decoris in New Zealand will be submitted to the regulatory authority.

AFLP and DNA sequence variation in an Andean domesticate, pepino (Solanum muricatum, Solanaceae): implications for evolution and domestication

The pepino (Solanum muricatum) is a vegetatively propagated, domesticated native of the Andes, where it grows with wild relatives. We used AFLPs and a 1-kb sequence of the 3-methylcrotonyl-CoA carboxylase gene to study variation of 27 accessions of S. muricatum and 35 collections of 10 species of wild relatives (Solanum section Basarthrum). A total of 298 AFLP fragments and 29 DNA sequence haplotypes were detected. Cluster and principal coordinate analyses and other genetic parameters estimated from both types of markers, show that S. muricatum is closely related to the species from one of the series (Caripensia) of section Basarthrum and that >90% of the variation of the cultigen is also represented in that series. Pepino is highly diverse, either because it is not monophyletic or it has been subjected to regular introgression with wild species, or both. Although a continuous distribution of the genetic variation occurred within the cultivated species, three genetic clusters were recognized. Cluster 1 is mostly centered in Ecuador, cluster 2 in Ecuador and Peru, and cluster 3 in Colombia and Ecuador. Cluster 3 also includes all modern cultivars studied. These results and other evidence suggest that northern Ecuador/southern Colombia is the main center of pepino diversity and the center of origin. The high genetic variation of this cultigen indicates that domestication does not always produce a genetic bottleneck.

Epidemyology of tomato pathogen viruses in Hungary

Introduction Tomato (Lycopersicon esculentum) is an important crop on the basis of its high consumption, nutritional and cash value in temperate and tropical countries. Tomato crop production is over 4 million ha and about 110 million tonne on the world. The largest producers are in Asia because the half of the cultivation area and also the production are in these countries. In the European countries tomato is produced mainly under greenhouse. The gene centres is in the regions of the Andes in Peru, Ecuador and Chile. The cultivated tomato is a member of the Lycopersicon genus in the Solanaceae family. After the molecular characterization of Lycopersicon genus were transferred to Solanum (Marshall et al. 2001). Wild Lycopersicon species can be used in resistance breeding (Alexander and Hoover 1955). Six members (L. pimpinellifolium, L. chesmanii, L. parviflorum, L. chmielewski, L. hirsutum and L. penelii) from the Lycopersicon genus could relatively easily cross with cultivated tomato. This species could be use as sources of insect and disease resistance (Rick 1979; Taylor 1986; Tigchelar 1986; Kegler and Friedt 1993). There are about forty different viruses species are infecting Solanaceous vegetable crops, or potato (Solanum tuberosum) and tobacco (Nicotiana tabacum). Among them Potato virus Y (PVY), Tomato spotted wilt virus (TSWV) and other different Tobamoviruses (e.g. Tobacco mosaic virus) can cause severe yield losses. Pepino mosaic virus (PepMV) is a recently emerged viral pathogen in Hungary. It was first reported from pepino (Solanum muricatum) plants from Peru (Jones 1980). The PepMV has several hosts in different plant families (e.g. Amaranthaceae, Solanaceae). The virus is easily mechanically transmitted. PepMV transmitted by workers touching infected plants, and can also transmit by contact between plants. Maybe it is carried in tomato seeds and potentially can also transmit by Bombus bees. The rapid spread of PepMV was reported from European tomato cultivars in the last years (Verhoven et al. 2003). In Hungary PepMV was found first in 2004 from a glasshouse between the area Danube and Tisza Rivers (Forray et al. 2004).

Molecular characterization of two Pepino mosaic virus variants from imported tomato seed reveals high levels of sequence identity between Chilean and US isolates

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in South America on pepino (Solanum muricatum A.). Only in recent years, it was reported to infect greenhouse-grown tomatoes. Genome nucleotide sequences from several European isolates showed extensive sequence identity (>99%). Recent genome nucleotide sequences from two US isolates (US1 and US2) however showed much greater sequence divergence from that of the European PepMV isolates. My interest in characterizing virus isolates from South America was due to an active commercial tomato seed production in Chile. Through genome sequence comparison and phylogenetic analyses, we may be able to understand the source of virus infection and control this devastating disease from further spreading into new tomato growing regions of the world. Complete genome nucleotide sequences from two PepMV variants (designated as Ch1 and Ch2) were determined from a virus isolate obtained from a commercial tomato seed lot produced in Chile. Using RT-PCR-based genome walking strategy, complete genome sequences from these two variants were determined. Excluding poly (A) tails, the genomes of PepMV Ch1 and Ch2 were 6414 and 6412 nucleotides (nt), respectively. Pairwise comparisons of PepMV Ch1 and Ch2 genomes with other PepMV isolates showed that the highest nucleotide sequence identity was with two US isolates, 98.7% between PepMV Ch1 and US1, and 90.7% between Ch2 and US2. Similar to PepMV US1 and US2, the two Chilean variants were the most divergent from one another (78% nt identity). These two Chilean PepMV variants also shared only 78-86% nucleotide sequence identity to that of five European isolates. The high level of nucleotide sequence identity between Chilean and US isolates suggests a common origin. Phylogenetic analyses with various gene products generated three distinct sequence clusters (or strains): US1 and Ch1 in the first group, US2 and Ch2 in the second, and the European tomato isolates in the third. Based on the host specificity, it was previously suggested that the original pepino isolate should be considered a distinct strain from that of the tomato isolates.

New Polish Isolate of Pepino mosaic virus Highly Distinct from European Tomato, Peruvian, and US2 Strains

Pepino mosaic virus (PepMV, genus Potexvirus) was first described on pepino (Solanum muricatum) in Peru during 1980. Since 1999, the virus was reported in several European countries and in North and South America as an agent of viral disease of tomato crops. In Poland in 2002, the PepMV-SW isolate that was genetically similar to European isolates (approximately 99% identity) was identified (3). In November 2005, in the western part of the Wielkopolska Region, a virus with flexuous filamentous particles approximately 500 nm long was isolated from tomato fruits exhibiting symptoms of discoloration. Crude sap from Nicotiana benthamiana leaves was used for mechanical inoculation of indicator plants. The virus caused symptoms on N. benthamiana, N. clevelandii, Datura inoxia, and Lycopersicon esculentum. Symptomless infection on N. tabacum cv. Xanthi nc, N. tabacum cv. White Burley, and N. debneyi was confirmed by back-inoculation on N. benthamiana. The virus did not infect N. glutinosa, Physalis floridana, Petunia hybrida, Capsicum annuum, Chenopodium quinoa, Cucumis sativus, or Phaseolus vulgaris. The virus was initially identified using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with polyclonal antiserum against PepMV (DSMZ, Braunschweig, Germany). Positive serological reactions were obtained with sap from inoculated N. benthamiana, L. esculentum, and N. clevelandii plants. The serological identification was confirmed using a reverse transcription-polymerase chain reaction (RT-PCR) with primers generated from a sequence of the RNA polymerase region of an isolate of PepMV reported in the United Kingdom (1). Sequence information obtained from the amplified fragment of the virus designated PepMV-PK (GenBank Accession No. DQ387870), showed only 81% nt identity and 89% amino acid identity with PepMV-SW (GenBank Accession No. DQ387869). PepMV isolates can be divided into three strains including European tomato, Peruvian, and US2 based on their genetic diversity (2). The PepMV-PK isolate resulted in nucleotide identities ranging from 79 to 81% with isolates of the European tomato strain (GenBank Accession Nos. AJ438767, AF340024, AF484251, AJ271991, AJ606359, and AJ290424), 81% with the Peruvian strain (GenBank Accession Nos. AM109896 and AJ606361), and 78% identity with each of the U.S. isolates US1 (GenBank Accession No. AY509926) and US2 (GenBank Accession No. AY509927). These results show that the new Polish isolate is distinct from all other PepMV isolates reported to date.

Pepino ( Solanum muricatum Aiton): Breeding in Israel for better taste and aroma

New pepino (Solanum muricatum Aiton) cultivars with improved flavor were bred in Israel in recent years. Various parental lines with attractive fruit appearance and promising horticultural traits, but not necessarily with very high soluble solid concentration (SSC) levels or with good flavor, were used for crosses. Selection was performed in the segregating populations in search of new genotypes with good horticultural attributes combined with improved flavor. Individual clones with improved flavor were selected among the progeny populations, indicating that flavor is mediated through specific gene combinations. ‘Pepo’, the first locally bred cultivar, has been grown in modest quantities during the last seven years, mainly for the local market and occasionally for export to Europe. The crop is grown in greenhouses from September through July, yielding up to five tons of fruits per 1000 m2. ‘Pepo’ has been well received both locally and abroad. The fruit has a pleasant mild flavor, and due to its low calor...

Genetic Structure of the Population of Pepino mosaic virus Infecting Tomato Crops in Spain

ABSTRACT The population structure of Pepino mosaic virus (PepMV), which has caused severe epidemics in tomato in Spain since 2000, was analyzed. Isolates were characterized by the nucleotide sequence of the triple gene block and coat protein gene and, for a subset of isolates, a part of the RNA-dependent RNA polymerase gene. The full-length sequence of the genomic RNA of a Solanum muricatum isolate from Peru also was determined. In spite of high symptom diversity, the Spanish population of PepMV mostly comprised highly similar isolates belonging to the strain reported in Europe (European tomato strain), which has been the most prevalent genotype in Spain. The Spanish PepMV population was not structured spatially or temporally. Also, isolates highly similar to those from nontomato hosts from Peru (Peruvian strain) or to isolate US2 from the United States (US2 strain) were detected at lower frequency relative to the European strain. These two strains were detected in peninsular Spain only in 2004, but the Peruvian strain has been detected in the Canary Islands since 2000. These results suggest that PepMV was introduced into Spain more than once. Isolates from the Peruvian and US2 strains always were found in mixed infections with the European tomato strain, and interstrain recombinants were detected. The presence of different strains of the virus, and of recombinant isolates, should be considered for the development of control strategies based on genetic resistance.

Utilization of genetic resources for the introduction and adaptation of exotic vegetable crops: The case of pepino (Solanum muricatum)

Pepino (Solanum muricatum), a vegetatively propagated plant from the Andean region used for its edible fruits, has been identified as a potential crop for greenhouse cultivation in Mediterranean regions. However, attempts for introducing it have been unsuccessful, either because of the low yield, poor fruit quality, or both. Screening of germplasm under Mediterranean conditions showed that sources of variation for high yield existed in the cultivated genepool and that wild species S. caripense and S. tabanoense could contribute to a considerable improvement of soluble solids content (SSC) of pepino. Progenies obtained after crossing genetically distant (AFLP-based) parental clones were heterotic for yield, and allowed the selection of clones with an improved combination of yield and SSC. As a result of this intraspecific programme, two new improved cultivars (‘Turia’ and ‘Valencia’), which outperform the rest of cultivars available, have been selected for cultivation in Mediterranean conditions. The interspecific programme involved the selection of clones with high yield and SSC in backcross generations. The results show that introgression of genes from the wild species can contribute to improve the SSC of pepino. The backcross programme is in an advanced stage and new cultivars derived from the interspecific crosses are expected to be released in a near future. New prospects for the future in pepino breeding include the genetic transformation, the establishment of a genetic map, and the use of the genomic information from related Solanaceae important crops. All the information obtained is illustrative for the breeding for adaptation of vegetatively propagated crops.

Postharvest quality of pepino (Solanum muricatum Ait.) fruit in controlled atmosphere storage

Fruit quality of pepino (Solanum muricatum Ait.) at two ripening stages (mature and ripe) was evaluated under different controlled atmosphere storage conditions (CA) at 5°C and 10°C for up to 21 days. The effect of continuous or varying CA treatments on changes in chroma and pigments was depending on the physiological fruit age. In addition, the cell wall carbohydrates were affected by fruit maturation. In mature fruits, the content of insoluble pectin decreased, while the increase in water-soluble pectin was tendentiously more suppressed by the continuous and varying CA treatments after 21 days of storage, and resulted in a higher retention of fruit firmness. Changes of water-soluble pectin in ripe fruits were inhibited by the CA conditions during storage. Mono- and disaccharides were hardly not affected by CA treatments. Therefore, for shipping purposes and subsequent market distribution, the applied CA treatments used here are suitable for maintaining the quality of mature pepino fruits. However, ripe pepino fruits should be distributed only to local fresh markets as a ready-to-eat-fruit.

(257) Pepino Mosaic Virus: Variability in U.S. Isolates

Pepino mosaic virus (PepMV) was first found in pepino (Solanum muricatum) growing in coastal Peru in 1974 and described in 1980; it reappeared in protected tomato (Lycopersiconesculentum) in the Netherlands in 1999. Since then, it has been reported to occur in tomato in several countries including Austria, Belgium, Canada, France, Germany, Italy, Peru, Spain and the Canary Islands, the United Kingdom, and in 11 states within the United States. Three strains of PepMV found in the United States have been cloned and sequenced. Full-length genomic sequences were obtained for two strains, PepMV-US1 and PepMV-US2, from co-infected tomato plant samples from Arizona. The 3'-end sequence of PepMV-US3 came from infected tomato fruits from Maryland. The genome organization, motifs and domains typical of the genus Potexvirus, and of other PepMV isolates, were found in full-length sequences of both US1 and US2 isolates. Direct comparison of US1 and US2 at the nucleotide level revealed an 86.3% identity; whereas, when individually compared to the French and Spanish isolates, which share ∼99% identity at the nucleotide level, US1 and US2 had 82% and 79% identities to each, respectively. Pair-wise gene-for-gene comparisons between United States and European isolates revealed a similar trend. While unique, US1 is more closely related to the previously reported European isolates than is US2. The CP of US3 is nearly identical to the European isolates at the amino acid level. None of 18 tomato germplasm accessions or 10 cultivars were resistant to mechanical inoculation with US3; in contrast, no infection was detected in nine pepper cultivars or four germplasm accessions. Plants grown from seeds of infected tomato fruits did not test positive for PepMV.

PEPINO FRUITS RESPIRATION RATE

Pepino fruits cachun (Solanum muricatum Ait.) were harvested at mature green stage and kept at room temperature during 4 weeks. Postharvest respiration rate, ethylene production and color were measured daily during this period. Pulp firmness and soluble solids were measured at the beginning and at the end of respiration period. Results confirm the non climacteric type of respiratory activity during postharvest period and ethylene production was not detectable. Nevertheless fruits showed a color evolution from a green stage to a normal ripe, light yellow green color.

Variation among Solanaceae crops in cadmium tolerance and accumulation

Plantlets of cape gooseberry (Physalis peruviana), pepino (Solanum muricatum), pepper (Capsicum annuum), tobacco (Nicotiana tabacum) and tomato (Lycopersicon esculentum) were watered with several nutrient solutions containing cadmium (Cd) at doses ranging from 0 to 500 mg.L -1 (cape gooseberry) or 0 to 200 mg.L -1 (rest of the crops). Cadmium depressed the growth of roots, stems and leaves and caused a reduction in dry matter and chlorophyll concentration, especially at the higher doses. Crops most affected by Cd were tobacco, tomato and pepper. Significant differences among crops for Cd accumulation in the leaves were detected. Thus, Cd concentrations in cape gooseberry leaves were much lower than in the other crops. Cape gooseberry and pepino grow relatively well under high Cd concentrations, though they accumulate low (cape gooseberry) and high (pepino) Cd concentrations.

`Valencia': A New Pepino (Solanum muricatum) Cultivar with Improved Fruit Quality

Pepino (Solanum muricatum Aiton), also known as melon-pear, is a vegetatively propagated vegetable crop grown for its juicy and aromatic fruit. Great variation in fruit weight, shape, and color can be found among cultivars of pepino (Anderson et al., 1996; Heiser, 1985). Despite being an important crop in Pre-Columbian times in the Andean region, it has not achieved the same relevance as other New World cultivated Solanaceae such as tomato, pepper or potato (Prohens et al., 1996). However, during the last two decades, its cultivation has spread to many countries as a crop for diversifying greenhouse horticultural production. Two types of pepino cultivars can be distinguished: sweet fruit with at least 8% soluble solids concentration (SSC) and a fruity intense aroma appropiate for use as a dessert fruit for which fruit sweetness is a key factor (El-Zeftawi et al., 1988); cultivars producing less sweet but more fi rm-fl eshed fruit with a grassy (green) aroma suitable for use in salads in the same way as cucumber (Cucumis sativus L.). In several areas of the Mediterranean region, pepino (in particular sweet cultivars) is being introduced as a new crop (Prohens et al., 2000). The main limitation to pepino production is the availability of sweet pepino cultivars with combined high yield and good fruit quality. Clones producing fruit with high SSC (8% to 10%) suited for use as a dessert fruit, usually have a low yield ( 40 t·ha) have an unacceptably SSC (<7%) (Rodriguez-Burruezo et al., 2002). A research group of the Centro de Conservacion y Mejora de la Agrodiversidad Valenciana (COMAV) of the Universidad Politecnica de Valencia has conducted a pepino breeding program since the early 1990s. The clonal hybrid cultivar Valencia is a result of this program. ‘Valencia’ has a higher fruit yield and better fruit quality than other current sweet pepino cultivars, and is adapted to a wide range of environmental conditions. either parental clone (Table 1) and, occasionally, close to the high yielding ‘Puzol’. Fruit of ‘Valencia’ ripen earlier than other pepino cultivars. The time elapsed between transplanting and fi rst harvest ranges between 23 and 25 weeks in the autumn-winter growing season. ‘Valencia’ fruit weigh between 125 and 250 g (Table 1), adequate for dessert fruit. Fruit shape is elongated (Fig. 2), with a length/width ratio of 2.0 to 2.2 (1.3 for Sm-26 and 3.0 for ‘Sweet Long’). Both attributes (medium size and elongated shape) favor fruit packing and optimize box space. Fruit are attractive, with a golden color and narrow purple stripes covering less than 10% of fruit surface. The fl esh also exhibits an intense yellow color (Fig. 2). The fl avor of ‘Valencia’ is appropriate for a dessert fruit. SSC levels of ‘Valencia’ fruit range from 8.6 to 10.0%, values that are higher and statistically signifi cant in most cases than those of Sm-26 and ‘Sweet Long’. Furthermore, ascorbic acid concentration (AAC) levels are high, (between 400 and 600 mg·kg) (Table 1). Titratable acidity (TA, mmol·kg citric acid) values are comparable to the usual values for this species and always signifi cantly lower than Sm-26 (Nuez and Ruiz, 1996). Most trials were conducted under autumnwinter growing season conditions (Prohens et al., 2000), since this is the best growing season for good fruit quality and yield (RodriguezOrigin