Molecules PD-1 Research Articles

Leucocyte-hitchhiking liposomes loading gemcitabine and pyroptosis for potentiated immunotherapy of hepatocellular carcinoma.

168 Background: Hepatocellular carcinoma (HCC), as a malignant tumor with high incidence worldwide, faces the challenge of low efficacy of traditional chemotherapy drugs and immunotherapy drugs. Pyroptosis is a type of programmed cell death that can alleviate tumor immunosuppressive microenvironment and promote systemic immune response, which has great potential in improving the efficacy of immunotherapy drugs. The selection of more effective pyroptosis-inducing drugs and immunotherapy drugs, supplemented by more precise drug delivery strategies, is one of the research focuses in the treatment of HCC. Methods: In this study, Western Blot were performed to screen suitable pyroptosis-inducing drugs. A leucocyte-hitchhiking liposome nanodrug delivery system was designed to co-deliver a pyroptosis-inducing drug and a small molecule immunotherapy drug. The ability of the nanocarrier to induce pyroptosis of liver cancer cells and to activate immune cells were investigated in vitro. The targeting ability of the nanocarrier to peripheral blood leucocytes, the function of tumor inhibition and immune activation were evaluated in vivo. Results: In this study, gemcitabine was confirmed to induce pyroptosis in liver cancer cells. E-selectin modified liposomes were designed to co-deliver gemcitabine and the small molecule PD-1/PD-L1 complex inhibitor BMS-202. In vitro experiments confirmed that the nanocarrier could induce pyroptosis in liver cancer cells and activate immune cells. In vitro experiments confirmed the targeting ability of the nanocarrier to leukocytes and its ability to inhibit tumor and activate immunity. Conclusions: Leucocyte-hitchhiking liposomes loading gemcitabine and BMS-202 was successfully synthesized. After intravenous injection, liposomes effectively adhere to the surface of peripheral blood leukocytes mediated by E-selectin, thus hitchhiking with leukocytes to achieve high accumulation at the tumor site. The released gemcitabine can evoke tumor cell pyroptosis and generate anti-tumor immunity, while BMS-202 can alleviate immune suppression by inhibiting the formation of PD-1/PD-L1 complex, further enhance gemcitabine-induced anti-tumor immunity. This leucocyte-hitchhiking dual-delivery liposomal nanoplatform might provide a promising strategy for high-efficiency immunotherapy, exhibiting a great potential for clinical translation of HCC treatment.

Targeting Potential of Innate Lymphoid Cells in Melanoma and Other Cancers.

Reinvigorating the killing function of tumor-infiltrating immune cells through the targeting of regulatory molecules expressed on lymphocytes has markedly improved the prognosis of cancer patients, particularly in melanoma. While initially thought to solely strengthen adaptive T lymphocyte anti-tumor activity, recent investigations suggest that other immune cell subsets, particularly tissue-resident innate lymphoid cells (ILCs), may benefit from immunotherapy treatment. Here, we describe the recent findings showing immune checkpoint expression on tissue-resident and tumor-infiltrating ILCs and how their effector function is modulated by checkpoint blockade-based therapies in cancer. We discuss the therapeutic potential of ILCs beyond the classical PD-1 and CTLA-4 regulatory molecules, exploring other possibilities to manipulate ILC effector function to further impede tumor growth and quench disease progression.

#5611 ASSOCIATION BETWEEN LOSS OF IMMUNE CHECKPOINT PROGRAMMED CELL DEATH PROTEIN 1 AND ACTIVE ANCA-ASSOCIATED RENAL VASCULITIS

Abstract Background and Aims Immune checkpoint inhibitors (ICIs) have made an important contribution on the survival of patients with certain cancers. ICIs interrupt co-inhibitory signalling pathways mediated by programmed cell death protein 1 (PD-1), programmed cell death protein-ligand 1 (PD-L1), and cytotoxic T lymphocyte-associated antigen (CTLA-4) that result in the elimination of cancer cells by stimulating the immune system. Immune-related adverse events have also been described and attributed to an enhanced immune system activation. Recent observations have suggested dysregulation of immune checkpoints in active antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV). Therefore, we here aimed to analyze abundance of immune checkpoint molecules PD-1/PD-L1 and its implications in ANCA-associated renal vasculitis. Method We here analyzed intrarenal PD-1 and PD-L1 by immunostaining in a total number of 15 kidney biopsies with ANCA-associated renal vasculitis in correlation with glomerular and tubulointer-stitial lesions. For independent validation, publicly available datasets were analyzed for PD-1 expression (encoded by PDCD1). Results We here observed a predominant tubulointerstitial expression of PD-1 that is decreased in ANCA-associated renal vasculitis. Moreover, loss of tubulointerstitial PD-1 correlated with active ANCA-associated renal vasculitis. Consistent to the observed association with active glomerular and tubulointerstitial lesions, we identified that interstitial PD-1 correlated with tubular and/or glomerular PD-L1 positivity. Finally, PD-1 was associated with decreased local synthesis of complement factor B. Interestingly, we did not observe a correlation between PD-1 and complement C5 or its C5a receptor. Combined with our observations, this may implicate a link between im-paired PD-1/PD-L1 signalling, complement factor B, and active ANCA-associated renal vasculitis. Conclusion These findings could be of relevance because experimental data have already been described that PD-1 agonism can be used therapeutically to attenuate autoimmunity in multiple disease models. Furthermore, targeted therapy against complement C5/C5a receptor and factor B are both available and currently evolving in the treatment of AAV. Therefore, this pilot study expands our current knowledge and describes a potential interplay between immune checkpoints and the alternative complement pathway in active ANCA-associated renal vasculitis.

PD-1 Overexpression in Sézary Syndrome Is Epigenetically Regulated

PD-1 Overexpression in Sézary Syndrome Is Epigenetically Regulated

Hyperthermic Intrathoracic Chemotherapy (HITOC) Improves Malignant Pleural Mesothelioma Control Through a Tumor Specific Cytotoxic Immune Response

Abstract Background The management of malignant pleural mesothelioma (MPM) remains challenging with poor patient survival. Local therapies such as hyperthermic intrathoracic cisplatin (HITOC) have shown good tumor control in selected patients. HITOC was shown to increase MPM drug exposure while limiting systemic side effects but alternative mechanisms for HITOC are still lacking. Aims We hypothesized that HITOC induces an immune response directed against MPM which decreases cancer related mortality. Methods A perfusion circuit was downsized to administer cisplatin in the thoracic cavity of MPM bearing mice at normo (37°C, ITOC) or hyperthermic (39°C, HITOC) conditions for 30 minutes. Tumor platinum content and distribution were determined by inductively coupled plasma mass spectrometry (ICP-MS) and by laser ablation ICP-MS respectively. The impact of (H)ITOC on the MPM immune microenvironment was questioned using flow cytometry and immunohistochemistry. Tumor growth and survival was assessed in immunocompetent and T-cell deficient mice. Finally, the combination of HITOC with anti-CTLA-4 and anti-PD-1 antibodies was evaluated in immunocompetent animals. Results MPM tumor control and mouse survival were significantly improved by HITOC compared to controls (ITOC, saline 37 and 39°C). This correlated with higher tumor platinum content that was mainly located at the surface of tumors. Furthermore, HITOC enhanced MPM infiltration by cytotoxic T-cells and decreased the level of protumor (M2-like) macrophages at day 7. The beneficial impact of HITOC on tumor control and mice survival was lost in immunocompromised animals. Interestingly, HITOC significantly induced PD-1 and CTLA-4 immune checkpoint molecules expression and administration of dual immune checkpoint blockade after HITOC increased of almost two fold the median survival of the animals. Conclusions HITOC improves MPM control through a T lymphocyte immune mediated response. The potentiation of the immune checkpoint blockade response by HITOC opens new perspectives for the combination of immune checkpoint inhibitors with HITOC in clinic.

PD-1 Carried on Small Extracellular Vesicles Leads to OSCC Metastasis

Immune checkpoint molecule PD-1, expressed on the cell surface, impairs antigen-driven activation of T cells and thus plays a critical role in tumorigenesis, progression, and the poor prognosis of oral squamous cell carcinoma (OSCC). In addition, increasing evidence indicates that PD-1 carried on small extracellular vesicles (sEVs) also mediates tumor immunity, although their contributions to OSCC are yet unclear. Here, we investigated the biological functions of sEV PD-1 in patients with OSCC. The cell cycle, proliferation, apoptosis, migration, and invasion of CAL27 cell lines treated with or without sEV PD-1 were examined in vitro. We performed mass spectrometry to investigate the underlying biological process, combined with an immunohistochemical study of SCC7-bearing mice models and OSCC patient samples. In vitro data demonstrated that sEV PD-1 induced senescence and subsequent epithelial-mesenchymal transition (EMT) in CAL27 cells by ligating with tumor cell surface PD-L1 and activating the p38 mitogen-activated protein kinase (MAPK) pathway. Comprehensive immunohistochemical analysis of the xenograft mice models and OSCC patient samples revealed a very close correlation between the level of circulating sEV PD-1 and lymph node metastasis. These results demonstrate that circulating sEV PD-1 triggers senescence-initiated EMT in a PD-L1-p38 MAPK-dependent manner, contributing to tumor metastasis. It also suggests that the inhibition of sEV PD-1 may be a promising therapeutic target for the treatment of OSCC.

Differential Effects of Anti-PD-1/PD-L1 Checkpoint Inhibitors on Adhesion Molecules and Cytokine Secretion by THP-1 Monocytes.

Immune checkpoint inhibitors have improved the treatment regimen for human cancers in recent years. Particularly, inhibitors of the checkpoint molecules PD-1/PD-L1 have emerged as promising therapeutic treatments by preventing T-cell anergy and exhaustion. However, the impact of different anti-PD-1/PD-L1 checkpoint inhibitors on human monocytes remains elusive. In this study, using the human monocyte leukemia cell line THP-1 as a model, we investigated the influence of different therapeutic anti-PD-1/PD-L1 checkpoint inhibitors on monocytic adhesion molecule expression and cytokine secretion. THP-1 monocytes were treated with the anti-PD-1 checkpoint inhibitors Nivolumab and Pembrolizumab and anti-PD-L1 checkpoint inhibitors Atezolizumab and Durvalumab. Cytokine expression patterns were evaluated using cytokine arrays and enzyme-linked immunosorbent assays (ELISA) and analysis of adhesion molecules was addressed using flow cytometry. Our data show an overall moderate apoptosis induction upon checkpoint inhibitor treatment and significantly reduced expression levels of adhesion molecules CD29, CD49d, and CX3CR1 in response to anti-PD-1 treatment. Cytokine screening revealed overall decreased secretion levels of insulin-like growth factor binding protein 2 (IGFBP2), CD147 (basigin) and CD31 (PECAM-1) as well as elevated levels of interleukin 5 (IL-5) and interferon gamma (IFNγ) in response to checkpoint inhibitor treatment. Our data indicate differential effects of anti-PD-1/PD-L1 checkpoint inhibitors on THP-1 monocytes, both by specific anti-PD-1/PD-L1 binding and unspecific antibody IgG isotype recognition. Further investigations on peripheral blood monocyte subsets in terms of their expansion and function upon checkpoint inhibitor therapy are required to better understand the individual immunological balances in cancer patients in long-term observational studies.

Beyond CTLA-4 and PD-1 Inhibition: Novel Immune Checkpoint Molecules for Melanoma Treatment.

More than ten years after the approval of ipilimumab, immune checkpoint inhibitors (ICIs) against PD-1 and CTLA-4 have been established as the most effective treatment for locally advanced or metastatic melanoma, achieving durable responses either as monotherapies or in combinatorial regimens. However, a considerable proportion of patients do not respond or experience early relapse, due to multiple parameters that contribute to melanoma resistance. The expression of other immune checkpoints beyond the PD-1 and CTLA-4 molecules remains a major mechanism of immune evasion. The recent approval of anti-LAG-3 ICI, relatlimab, in combination with nivolumab for metastatic disease, has capitalized on the extensive research in the field and has highlighted the potential for further improvement of melanoma prognosis by synergistically blocking additional immune targets with new ICI-doublets, antibody-drug conjugates, or other novel modalities. Herein, we provide a comprehensive overview of presently published immune checkpoint molecules, including LAG-3, TIGIT, TIM-3, VISTA, IDO1/IDO2/TDO, CD27/CD70, CD39/73, HVEM/BTLA/CD160 and B7-H3. Beginning from their immunomodulatory properties as co-inhibitory or co-stimulatory receptors, we present all therapeutic modalities targeting these molecules that have been tested in melanoma treatment either in preclinical or clinical settings. Better understanding of the checkpoint-mediated crosstalk between melanoma and immune effector cells is essential for generating more effective strategies with augmented immune response.

Metformin plays an antitumor role by downregulating inhibitory cells and immune checkpoint molecules while activating protective immune responses in breast cancer

This study seeks to test the effect of metformin treatment on the outcomes of breast cancer in BALB/c mice bearing 4T1 breast cancer cells. The survival rate and tumor size of mice were compared, as well as evaluation of the changes of immune cells in spleens and the microenvironment of tumors using flow cytometry and ELISA. Our results demonstrate that metformin prolongs mouse survival. A significant decrease in M2-like macrophages (F4/80+CD206+) was found in mice spleen treated with metformin. The treatment also inhibited monocytic myeloid-derived suppressor cells (M-MDSCs, CD11b+Gr-1+) and regulatory T cells (Tregs, CD4+CD25+Foxp3+). Metformin treatment resulted in an increase in the level of IFN-γ and a decrease in IL-10. Expression of the immune checkpoint molecule PD-1 on T cells was inhibited following treatment. Metformin enhances local antitumor activity in the tumor microenvironment, and our data supports the drug as a candidate for evaluation in the treatment of breast cancer.

Anti-PD-1 antibodies recognizing the membrane-proximal region are agonists that can stimulate immunosuppressive activity of PD-1

Abstract The success of immunoenhancing anti-PD-1 blocking antibodies in cancer treatment indicates the biological significance of PD-1-dependent immunoregulation in the human immune system. Active stimulation of PD-1 is potentially an effective approach in treating various inflammatory disorders; however, agonistic anti-PD-1 antibodies stimulating the immunosuppressive activity are not clearly defined. Here, by assessing the biological activities of anti-human PD-1 mAbs, we have identified functional anti-PD-1 agonists in the antibody group recognizing the membrane-proximal extracellular region (MPER). MPER recognition was characteristic to anti-PD-1 agonist mAbs and distinct from blocking mAbs binding to the membrane-distal region of PD-1. The agonistic activity was mediated by Fc receptor-dependent co-ligation of PD-1 molecules. In vivo anti-inflammatory efficacy of the PD-1 agonist in murine disease models suggests its clinical potential to various inflammatory disorders including autoimmune diseases. Meiji Seika Pharma, Co., Ltd. Foundation for Biomedical Research and Innovation at Kobe

Monitoring of kinetics and exhaustion markers of circulating CAR-T cells as early predictive factors in patients with B-cell malignancies.

CAR-T cell therapy has proven to be a disruptive treatment in the hematology field, however, less than 50% of patients maintain long-term response and early predictors of outcome are still inconsistently defined. Here, we aimed to optimize the detection of CD19 CAR-T cells in blood and to identify phenotypic features as early biomarkers associated with toxicity and outcomes. In this study, monitoring by flow cytometry and digital PCR (dPCR), and immunophenotypic characterization of circulating CAR-T cells from 48 patients treated with Tisa-cel or Axi-cel was performed. Validation of the flow cytometry reagent for the detection of CAR-T cells in blood revealed CD19 protein conjugated with streptavidin as the optimal detection method. Kinetics of CAR-T cell expansion in blood confirmed median day of peak expansion at seven days post-infusion by both flow cytometry and digital PCR. Circulating CAR-T cells showed an activated, proliferative, and exhausted phenotype at the time of peak expansion. Patients with increased expansion showed more severe CRS and ICANs. Immunophenotypic characterization of CAR-T cells at the peak expansion identified the increased expression of co-inhibitory molecules PD1 and LAG3 and reduced levels of the cytotoxicity marker CD107a as predictors of a better long-term disease control. These data show the importance of CAR-T cells in vivo monitoring and identify the expression of PD1LAG3 and CD107a as early biomarkers of long-term disease control after CAR-T cell therapy.

The programmed cell death protein 1 (PD1) and the programmed cell death ligand 1 (PD-L1) are significantly downregulated on macrophages and Hofbauer cells in the placenta of preeclampsia patients

Preeclampsia is a pregnancy-specific disease which is characterized by abnormal placentation, endothelial dysfunction, systemic inflammation and disruption of the immune system. The goal of this study was to characterize the PD-1/PD-L1 system, an important immune checkpoint system, on macrophages and Hofbauer cells (HBC) in the placenta of preeclamptic patients. The expression of the macrophage markers CD68 and CD163 as well as the proteins PD1 and PD-L1 in the placenta of preeclamptic patients was examined by immunohistochemistry and immunofluorescence in comparison to the placenta of healthy pregnancies. The numbers of CD68-positive and CD163-positive macrophages were significantly downregulated in the decidua (p = 0.021 and p = 0.043) and in the chorionic villi (p < 0.001 and p < 0.001) of preeclamptic patients. The majority of macrophages in the decidua and the chorionic villi were identified to be CD163-positive, indicating a predominantly M2-polarisation. The expression of PD1 on maternal macrophages of the decidua (p < 0.001) and on Hofbauer cells (p < 0.001) was shown to be significantly lower in preeclampsia. Looking at the protein PD-L1 the expression was proven to be downregulated on maternal macrophages in the decidua of preeclamptic patients (p = 0.043). This difference was only caused by a downregulation of PD-L1 expression in male offspring (p = 0.004) while there was no difference in female offspring (p = 0.841). The variation of the immune checkpoint molecules PD1 and PD-L1 in preeclampsia might play an important role in the development of inflammation seen in preeclamptic patients. It might thereby be an important target in the therapy of preeclampsia.

Abstract 6556: A gene signature of DNA damage response pathway is predictive of patient clinical outcomes and is associated with tumor immune microenvironment of lung adenocarcinoma

Abstract DNA damage response (DDR) is crucial to prevent the accumulation of DNA lesions that can lead to genomic instability and promote tumorigenesis. Dysregulation of DDR pathways also provides therapeutic opportunities for new cancer therapy. Given that lung cancer displays a high level of genetic mutation and genomic instability, a comprehensive understanding of the dysregulation of DDR genes in lung cancer, especially non-small cell lung cancer (NSCLC) which accounts for 85% of all lung cancer cases, will be critical for identifying new genes contributing to tumorigenesis and novel targets for lung cancer therapy. The goal of this study is to identify novel targets for lung cancer treatment through a comprehensive analysis of DDR genes and its association with patient survival, genomic mutation/instability, tumor immune microenvironment (TIME), and tumor proliferation ability. To this end, we have comprehensively characterized the expression of 276 DDR genes using the Cancer Genome Atlas (TCGA) and other publicly available data of lung adenocarcinoma (LUAD), the most common NSCLC. We found that 36 out of 276 DDR genes are dysregulated with majority being upregulated in tumors and are associated with patient overall survival (OS) and progression free survival (PFS) based on the TCGA LUAD cohort. A gene expression signature, i.e., DDR gene expression dysregulation score (DDRDS), was constructed based on the geometric mean of the differentially expressed genes that were also associated with patient OS. Patients with a higher DDRDS showed significantly worse OS and PFS, more advanced tumor stage, a higher tumor mutational burden (TMB), neoantigen load, and homologous recombination deficiency (HRD) score. In addition, tumors with higher DDRDS displayed an increase in CD4+ activated memory T-cells, CD8+ T- cells, M0 and M1 macrophage, and NK cells, but a decrease in B cells, CD4+ resting memory T-cells, monocytes, and dendritic cells in TIME. Further, these tumors also showed a higher expression of immune check point molecules PD1 and PD-L1. Lastly, gene set enrichment analysis demonstrated that these tumors had significantly increased nuclear division, DNA replication, chromosome segregation, and cell cycles, reflecting the aggressiveness of the disease. Hence, despite the previous studies demonstrating that mutation and deletion defects in DDR genes are frequent in tumors, we found that the dysregulated DDR genes are mainly upregulated, and DDRDS based on the dysregulated expression of DDR genes is associated with the alteration in TMB/HRD/TIME, tumor aggressiveness, and ultimately patient outcomes. These results suggested that patients with a higher tumor DDRDS are associated with poor prognosis but might benefit from immune checkpoint blockade-associated immunotherapy. Citation Format: Xiaoli Zhang, Junran Zhang. A gene signature of DNA damage response pathway is predictive of patient clinical outcomes and is associated with tumor immune microenvironment of lung adenocarcinoma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 6556.

Abstract 6380: Ultrasensitive detection of circulating human PD-1 and PD-L1 using Single Molecule Counting (SMC) technology

Abstract Immune checkpoint proteins are key regulators of the immune system and potential drug targets for cancer immunotherapy. Cancer immunotherapy targeting immune checkpoint, like programmed cell death protein-1 (PD-1) and programmed cell death ligand 1 (PD-L1) inhibitors has shown treatment efficacy for a broad spectrum of human cancers. Immune checkpoint molecules PD-1 and PD-L1 are expressed on the cell surface of immune cells and tumor cells. Recent studies have also reported these immune checkpoint proteins may undergo alternative splicing or proteolytic cleavage to produce soluble checkpoint proteins. Multiple molecular forms of soluble PD-1 (sPD-1) and PD-L1 (sPD-L1) are detectable in patient sera of multiple types of cancer, and these soluble checkpoint proteins have been reported as putative liquid biopsy biomarkers in the diagnosis and prognosis of oncological disease. Though the clinical significance of circulating soluble immune checkpoint protein profiles as predictive biomarkers has yet to be fully explored and validated, we have committed to develop better and more reliable bioassays to further this research. With that, we have developed 2 Luminex-based multiplex immunoassays for simultaneous quantitation of 48 immune checkpoint proteins, including PD-1 and PD-L1, for patient sera and tumor lysate samples. Here we report the development of 2 novel Single Molecule Counting (SMC) technology-based ultrasensitive single-plex immune checkpoint immunoassays for the detection of sPD-L1 and sPD-1 in human serum and plasma samples. Comparative studies demonstrate these SMC ultrasensitive assays possesses at least 10-100-fold higher sensitivity as compared with the Luminex-based immunoassays. Using these novel ultrasensitive assays, we have validated the detection of significant increases in sPD-L1 and sPD-1 in cancer serum samples as compared with the levels in healthy controls. We have also applied these high sensitivity assays to measure human PD-L1 and PD-1 biomarkers in other sample types including urine, tumor lysates and exosomes. In conclusion, we envision that these PD-1 and PD-L1 SMC assays may overcome a major limitation in biomarker utility and enable the ultrasensitive detection of sPD-1 and sPD-L1 in liquid biopsy and blood biomarker research. Citation Format: Laila Faramarzi, Wen-Rong Lie, Rick Wiese, Jared Fiske. Ultrasensitive detection of circulating human PD-1 and PD-L1 using Single Molecule Counting (SMC) technology [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 6380.

Abstract 5862: ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC)

Abstract ATP-binding cassette member B5 (ABCB5) identifies cancer-initiating cells (CICs) in multiple malignancies, including malignant melanoma, colorectal cancer, glioblastoma, and hepatocellular carcinoma (HCC). In human melanoma, ABCB5-positive CIC subpopulations have been shown to preferentially express the immune checkpoint molecules PD-1 and PD-L1, and tumor-intrinsic PD-1 receptor functions have been found to promote tumor growth, even in mice lacking adaptive immunity. In HCC, where ABCB5 mediates CIC chemoresistance, PD-1 expression has also recently been identified. However, whether ABCB5 regulates tumor-intrinsic PD-1 expression in HCC or other malignancies is currently unknown. Here, we employed RNA interference in Hep G2 HCC cells with high endogenous ABCB5 expression to study the potential role of ABCB5 in regulating PD-1 expression, utilizing the ABCB5 shRNA target sequence GCTGGAAAGATAGCAACTGAA for ABCB5 knockdown (KD) as described previously. Endogenous ABCB5 levels in ABCB5-KD cells were successfully reduced by 92.8% compared to controls. Investigation of the effects of ABCB5-KD on tumor-intrinsic immune checkpoint molecule expression and on expression of the HCC-CIC marker GRN revealed that ABCB5-KD significantly reduced PD-1 expression by 98.0%, and PD-L1 expression by 62.8% compared to controls. Expression of GRN was also significantly reduced in ABCB5-KD cells by 78.8% compared to controls, suggesting ABCB5 KD-dependent loss of CIC phenotype. Injection of ABCB5-KD cells in NSG mice showed 32.3% reduction in tumor size at endpoint (6 weeks) compared to controls (728.7 ± 199.3mm3 vs 1076.0 ± 450.9 mm3, mean ± SD; p&amp;lt;0.005, repeated measures ANOVA) and 8.53% reduction in tumor weight at endpoint (0.47 ± 0.21g vs 0.51 ± 0.21g, mean ± SD). These results provide initial evidence in an HCC cell line model system that ABCB5 functionally regulates tumor-intrinsic PD-1 and PD-L1 expression. They therefore suggest that ABCB5 blockade represents a novel therapeutic strategy for targeted inhibition of pro-tumorigenic tumor-intrinsic PD-1/PD-L1 expression, with important additional implications for immune checkpoint-targeted cancer immunotherapy. Citation Format: Chun Philip Yeung, Brian J. Wilson, Yuzuru Sasamoto, Ana Maria Waaga-Gasser, Svetlana Karpova, Qin Guo, Natasha Y. Frank, Markus H. Frank. ABCB5 knockdown suppresses tumor-intrinsic expression of immune checkpoint regulators PD-1 and PD-L1 in hepatocellular carcinoma (HCC) [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 5862.

High TOX expression on CD8+ T cells in pure red cell aplasia.

Thymocyte selection-associated high-mobility group box protein (TOX) is an important molecule regulating the development and exhaustion of T lymphocytes. Our aim is to investigate the role of TOX in the immune pathogenesis of pure red cell aplasia (PRCA). TOX expression of CD8+ lymphocytes from the peripheral blood of patients with PRCA was detected by flow cytometry. Additionally, the expression of immune checkpoint molecules PD1 and LAG3 and cytotoxic molecules perforin and granzyme B of CD8+ lymphocytes was measured. The quantity of CD4+CD25+CD127low T cells was analyzed. TOX expression on CD8+ T lymphocytes in PRCA patients was significantly increased (40.73 [Formula: see text] 16.03 vs. 28.38 [Formula: see text] 12.20). The expression levels of PD1 and LAG3 on CD8+ T lymphocytes in PCRA patients were significantly higher than those in the control group (34.18 [Formula: see text] 13.26 vs. 21.76 [Formula: see text] 9.22 and 14.17 [Formula: see text] 13.74 vs. 7.24 [Formula: see text] 5.44, respectively). The levels of perforin and granzyme in CD8+ T lymphocytes of PRCA patients were 48.60 [Formula: see text] 19.02 and 46.66 [Formula: see text] 25.49, respectively, which were significantly higher than those of the control group (31.46 [Formula: see text] 7.82 and 16.17 [Formula: see text] 4.84, respectively). The number of CD4+CD25+CD127low Treg cells in PRCA patients was significantly decreased (4.30 [Formula: see text] 1.27 vs. 1.75 [Formula: see text] 1.22). In PRCA patients, CD8+ T cells were activated and exhibited overexpression of TOX, PD1, LAG3, perforin, and granzyme B, while regulatory T cells decreased. These findings suggest that T cell abnormality plays a critical role in the pathogenesis of PRCA.

Beyond antibody fucosylation: α-(1,6)-fucosyltransferase (Fut8) as a potential new therapeutic target for cancer immunotherapy.

Aberrant post-translational glycosylation is a well-established hallmark of cancer. Altered core fucosylation mediated by α-(1,6)-fucosyltransferase (Fut8) is one of the key changes in tumor glycan patterns that contributes to neoplastic transformation, tumor metastasis, and immune evasion. Increased Fut8 expression and activity are associated with many types of human cancers, including lung, breast, melanoma, liver, colorectal, ovarian, prostate, thyroid, and pancreatic cancer. In animal models, inhibition of Fut8 activity by gene knockout, RNA interference, and small analogue inhibitors led to reduced tumor growth/metastasis, downregulation of immune checkpoint molecules PD-1, PD-L1/2, and B7-H3, and reversal of the suppressive state of tumor microenvironment. Although the biologics field has long benefited tremendously from using FUT8 -/- Chinese hamster ovary cells to manufacture IgGs with greatly enhanced effector function of antibody-dependent cellular cytotoxicity for therapy, it is only in recent years that the roles of Fut8 itself in cancer biology have been studied. Here, we summarize the pro-oncogenic mechanisms involved in cancer development that are regulated by Fut8-mediated core fucosylation, and call for more research in this area where modifying the activity of this sole enzyme responsible for core fucosylation could potentially bring rewarding surprises in fighting cancer, infections, and other immune-related diseases.

A single-arm, open-label, phase II study investigating anti-HER2 ADC plus anti-PD-1 antibody in patients with unresectable locally advanced or metastatic BTC with HER2 overexpression.

TPS619 Background: 1. Biliary tract cancer (BTC) accounts for 4% of all digestive tract cancers. In 2016-2020, the incidence of BTC has gradually increased worldwide. In China, gallbladder carcinoma accounted for 1.7% of all tumors and 1.9% of deaths in some regions. 2. The standard second-line treatment regimen is mFOLFOX, with an ORR of 5%, PFS of 2 months and OS of 6.2 months. Methods: This is a single-arm, open-label, phase II study, approximately 31 patients of unresectable locally advanced or metastatic BTC with HER2 overexpression will be enrolled. Each treatment cycle is 14 days. Therapeutic regimen: Disitamab Vedotin 2.5mg/kg IV, D1, Q2W + Zimberelimab 240mg IV, D1, Q2W All patients treated until a loss of clinical benefit or unacceptable toxicity is observed by the investigator. Objective: to evaluate the efficacy and safety of Disitamab Vedotin + Zimberelima in patients with unresectable locally advanced or metastatic BTC with HER2 overexpression Disitamab Vedotin: Vedecitumab is an antibody-drug conjugate (ADC), with a humanized antibody conjugated to four tubulin inhibitor molecules (DAR=4) Zimberelimab: Zimberelimab is a fully human IgG4 monoclonal antibody that specifically binds to PD-1 molecules on the surface of lymphocytes. This drug is approved for r/r cHL and is also effective in the cervical cancer. Clinical trial information: NCT05540483 .

Anti-PD-1 antibodies recognizing the membrane-proximal region are PD-1 agonists that can down-regulate inflammatory diseases.

The PD-1 receptor triggers a negative immunoregulatory mechanism that prevents overactivation of immune cells and subsequent inflammatory diseases. Because of its biological significance, PD-1 has been a drug target for modulating immune responses. Immunoenhancing anti-PD-1 blocking antibodies have become a widely used cancer treatment; however, little is known about the required characteristics for anti-PD-1 antibodies to be capable of stimulating immunosuppressive activity. Here, we show that PD-1 agonists exist in the group of anti-PD-1 antibodies recognizing the membrane-proximal extracellular region in sharp contrast to the binding of the membrane-distal region by blocking antibodies. This trend was consistent in an analysis of 81 anti-human PD-1 monoclonal antibodies. Because PD-1 agonist antibodies trigger immunosuppressive signaling by cross-linking PD-1 molecules, Fc engineering to enhance FcγRIIB binding of PD-1 agonist antibodies notably improved human T cell inhibition. A PD-1 agonist antibody suppressed inflammation in murine disease models, indicating its clinical potential for treatment of various inflammatory disorders, including autoimmune diseases.

Prognostic importance of PD-L1 expression in bladder cancer patients.

PD-L1/PD-1 molecules are known as important mediators in immune-escape mechanisms of tumors. PD-L1 is highly expressed in various malignancies, including bladder cancer. However, the prognostic value of PD-L1 in bladder cancer patients remains controversial. To investigate the prognostic significance of PD-L1 expression in tumor tissues of bladder cancer patients. RNA was isolated from FFPE tumor tissues of 48 bladder cancer patients using the monophasic phenol and guanidine isothiocyanate method. Total RNA was converted to cDNA and gene expression levels were analyzed by qRT-PCR. The differential expression levels of the PD-L1 gene between tumor grade and cancer stage groups were analyzed by independent student's t-test and one-way ANOVA. Statistically significantly increased PD-L1 expression was observed in the high-grade tumor group (p < 0.05). No significant difference in PD-L1 expression was found among pTa, pT1, and pT2 groups. In addition, the difference in overall survival was not significantly different between groups. The results showed that high PD-L1 expression in bladder cancer was associated with tumor aggressiveness and grade. Despite the inability of the qRT-PCR to show the PD-L1 expression at different locations of tumor tissue, evaluation of PD-L1 mRNA expression by qRT-PCR, which is a highly sensitive and specific assay, appears to be a robust approach. Furthermore, these findings may contribute to a rationale for recommending anti-PD-L1 immunotherapy as an alternative to standard therapy for bladder cancer patients who are most likely to benefit from it.