PCR Replicates Research Articles

Methodological assessment for efficient collection of Schistosoma mansoni environmental DNA and improved schistosomiasis surveillance in tropical wetlands

Schistosomiasis, caused by trematodes of genus Schistosoma, is among the most seriously neglected tropical diseases. Although rapid surveillance of risk areas for Schistosoma transmission is vital to control schistosomiasis, the habitat and infection status of this parasite are difficult to assess. Environmental DNA (eDNA) analysis, involving the detection of extra-organismal DNA in water samples, facilitates cost-efficient and sensitive biomonitoring of aquatic environments and is a promising tool to identify Schistosoma habitat and infection risk areas. However, in tropical wetlands, highly turbid water causes filter clogging, thereby decreasing the filtration volume and increasing the risk of false negatives. Therefore, in this study, we aimed to conduct laboratory experiments and field surveys in Lake Victoria, Mbita, to determine the appropriate filter pore size for S. mansoni eDNA collection in terms of particle size and filtration volume. In the laboratory experiment, aquarium water was sequentially filtered using different pore size filters. Targeting >3 µm size fraction was found to be sufficient to capture S. mansoni eDNA particles, regardless of their life cycle stage (egg, miracidia, and cercaria). In the field surveys, GF/D (2.7 µm nominal pore size) filter yielded 2.5-times the filtration volume obtained with a smaller pore size filter and pre-filtration methods under the same time constraints. Moreover, a site-occupancy model was applied to the field detection results to estimate S. mansoni eDNA occurrence and detection probabilities and assess the number of water samples and PCR replicates necessary for efficient eDNA detection. Overall, this study reveals an effective method for S. mansoni eDNA detection in turbid water, facilitating the rapid and sensitive monitoring of its distribution and cost-effective identification of schistosomiasis transmission risk areas.

Scanning amplicons with CRISPR-Dx detects endangered amphibians in environmental DNA.

More efficient methods for extensive biodiversity monitoring are required to support rapid measures to address the biodiversity crisis. While environmental DNA (eDNA) metabarcoding and quantitative PCR (qPCR) methods offer advantages over traditional monitoring approaches, their large-scale application is limited by the time and labour required for developing assays and/or for analysis. CRISPR (clustered regularly interspaced short palindromic repeats) diagnostic technologies (Dx) may overcome some of these limitations, but they have been used solely with species-specific primers, restricting their versatility for biodiversity monitoring. Here, we demonstrate the feasibility of designing species-specific CRISPR-Dx assays in silico within a short metabarcoding fragment using a general primer set, a methodology we term 'ampliscanning', for 18 of the 22 amphibian species in Switzerland. We sub-selected nine species, including three classified as regionally endangered, to test the methodology using eDNA sampled from ponds at nine sites. We compared the ampliscanning detections to data from traditional monitoring at these sites. Ampliscanning was successful at detecting target species with different prevalences across the landscape. With only one visit, we detected more species per site than three traditional monitoring visits (visual and acoustic detections by trained experts), in particular more elusive species and previously undocumented but expected populations. Ampliscanning detected 25 species/site combinations compared to 12 with traditional monitoring. Sensitivity analyses showed that larger numbers of field visits and PCR replicates are more important for reliable detection than many technical replicates at the CRISPR-Dx assay level. Given the reduced sampling and analysis effort, our results highlight the benefits of eDNA and CRISPR-Dx combined with universal primers for large-scale monitoring of multiple endangered species across landscapes to inform conservation measures.

Comparative evaluation for the performance of environmental DNA and RNA analyses targeting mitochondrial and nuclear genes from ayu (Plecoglossus altivelis).

Environmental DNA and RNA (eDNA and eRNA; collectively eNA) analyses have the potential for non-invasive and cost-efficient biomonitoring compared with traditional capture-based surveys. Although various types of eNA particles, including not only mitochondrial eDNA but also nuclear eDNA and their transcripts, are present in the water, performances of eNA detection and quantification have not yet been evaluated sufficiently across multiple mitochondrial and nuclear genes. We conducted a tank experiment with ayu (Plecoglossus altivelis) to compare the detection sensitivity, yields per water sample, and quantification variability between replicates of each type of eNAs. The assay targeting the multi-copy nuclear gene exhibited a higher sensitivity than the assay targeting the mitochondrial gene, and both the target eDNA and eRNA concentrations per water sample were higher for the nuclear gene. On the contrary, variation in eRNA quantifications per sample does not necessarily correspond to that in eDNA, and the intra-sample quantification variability (represented as the CVs between PCR replicates) tended to be larger for eRNA than eDNA. Our results suggested that, even if suitable to the sensitive detection of species occurrence, the use of eRNA particularly derived from multi-copy nuclear gene may not be necessarily appropriate for the reliable assessment of species abundance. The findings in this study would help optimize eNA analyses for making biomonitoring and stock assessment in aquatic environments more efficient and reliable.

Validating post-enrichment steps in environmental RNA analysis for improving its availability from water samples.

Environmental RNA (eRNA) analysis is expected to inclusively provide the physiological information of a population and community without individual sampling, having the potential for the improved monitoring of biodiversity and ecosystem function. Protocol development for maximizing eRNA availability is crucial to interpret its detection and quantification results with high accuracy and reliability, but the methodological validation and improvement of eRNA collection and processing methods are scarce. In this study, the technical steps after eRNA extraction, including genomic DNA (gDNA) removal and reverse transcription, were focused on and their performances were compared by zebrafish (Danio rerio) aquarium experiments. Additionally, this study also focused on the eRNA quantification variabilities between replicates and compared them between the PCR and sample levels. Results showed that (i) there was a trade-off between gDNA removal approaches and eRNA yields and an excess gDNA removal could lead to the false-negative eRNA detection, (ii) the use of the gene-specific primers for reverse transcription could increase the eRNA yields for multiple mitochondrial and nuclear genes compared with the random hexamer primers, and (iii) the coefficient of variation (CV) values of eRNA quantifications between PCR replicates were substantially lower for those between samples. Including the study, further knowledge for the sensitive and precise detection of macro-organismal eRNA should be needed for increasing the reliability and robustness of eRNA-based biomonitoring.

Making waves: Establishing a modeling framework to evaluate novel targets for wastewater-based surveillance

Wastewater-based surveillance (WBS) monitoring of pathogens circulating within a community provides an improved understanding of the occurrence and spread of infectious diseases. However, the potential suitability of WBS for novel disease targets is unclear, including many emerging and neglected diseases. The current ad hoc approach of conducting wastewater detection experiments on novel disease targets to determine their suitability for WBS monitoring is resource intensive and may stall investment in this promising technology. In addition, detections, or non-detections, without the context of disease prevalence and shedding by infected individuals are difficult to interpret upon initial WBS target development. In this paper, we present a WBS feasibility analysis framework to identify which diseases are theoretically appropriate for WBS applications and to improve the initial interpretation of target detections. We then discuss five primary factors that influence the probability of detection in WBS monitoring – genome shedding rate, infection rate, per capita wastewater usage, process limit of detection (PLOD), and the number of PCR replicates. Clarifying the relationships between these factors and the likelihood of detection enhances quantitative insights into applying WBS, guiding researchers and stakeholders into mitigating inherent uncertainties of wastewater monitoring and subsequent improvements in WBS outcomes, thereby supporting future investment and expansion of WBS research, especially in novel disease targets.

Signal and noise in metabarcoding data.

Metabarcoding is a powerful molecular tool for simultaneously surveying hundreds to thousands of species from a single sample, underpinning microbiome and environmental DNA (eDNA) methods. Deriving quantitative estimates of underlying biological communities from metabarcoding is critical for enhancing the utility of such approaches for health and conservation. Recent work has demonstrated that correcting for amplification biases in genetic metabarcoding data can yield quantitative estimates of template DNA concentrations. However, a major source of uncertainty in metabarcoding data stems from non-detections across technical PCR replicates where one replicate fails to detect a species observed in other replicates. Such non-detections are a special case of variability among technical replicates in metabarcoding data. While many sampling and amplification processes underlie observed variation in metabarcoding data, understanding the causes of non-detections is an important step in distinguishing signal from noise in metabarcoding studies. Here, we use both simulated and empirical data to 1) suggest how non-detections may arise in metabarcoding data, 2) outline steps to recognize uninformative data in practice, and 3) identify the conditions under which amplicon sequence data can reliably detect underlying biological signals. We show with both simulations and empirical data that, for a given species, the rate of non-detections among technical replicates is a function of both the template DNA concentration and species-specific amplification efficiency. Consequently, we conclude metabarcoding datasets are strongly affected by (1) deterministic amplification biases during PCR and (2) stochastic sampling of amplicons during sequencing-both of which we can model-but also by (3) stochastic sampling of rare molecules prior to PCR, which remains a frontier for quantitative metabarcoding. Our results highlight the importance of estimating species-specific amplification efficiencies and critically evaluating patterns of non-detection in metabarcoding datasets to better distinguish environmental signal from the noise inherent in molecular detections of rare targets.

A Model-Based Framework to Assess the Feasibility of Monitoring Zika Virus with Wastewater-Based Epidemiology

Wastewater-based epidemiology (WBE) is a promising community-level monitoring technique used for tracking diseases with well-documented enteric transmission or shedding. However, it is less clear if WBE is feasible for monitoring vector-borne pathogens like Zika virus. Using Monte Carlo simulation, the distributions for (i) total Zika RNA shedding from infected individuals and (ii) the process limit of detection (PLOD) were generated, and the probability of detecting Zika RNA in wastewater per infection rate was calculated. Urine drives Zika RNA shedding, leading to a median total shedding of 6.73 log 10 genome copies (GC)/day. At a PLOD of 1.16 log 10 GC/L, an infection rate of 0.11% (single PCR replicate) is required for 50% probability of detection, based on typical U.S. wastewater treatment plant (WWTP) flows. From historical case data, successful Zika WBE application is unlikely in the United States but likely for Zika-endemic countries with decreased WWTP per capita flows, like Brazil and Colombia, during an outbreak as observed in 2016. The great discrepancy between true and reported clinical cases, however, suggests that Zika WBE for endemic countries may be feasible even in the absence of outbreaks. Finally, we identify future work necessary for improved assessment of Zika WBE applications.

Ancient DNA from speleothems: opportunity or challenge?

AbstractAncient environmental DNA retrieved from sedimentary records (sedaDNA) can complement fossil-morphological approaches for characterizing Quaternary biodiversity changes. PCR-based DNA metabarcoding is so far the most widely used method in environmental DNA studies, including sedaDNA. However, degradation of ancient DNA and potential contamination, together with the PCR amplification drawbacks, have to be carefully considered. Here we tested this approach on speleothems from an Alpine cave that, according to a previous palynomorphological study, have shown to contain abundant pollen grains. This offers a unique opportunity for comparing the two methods and, indirectly, trying to validate DNA-based results. The plant taxa identified by sedaDNA are fewer than those by pollen analysis, and success rate of PCR replicates is low. Despite extensive work performed following best practice for sedaDNA, our results are suboptimal and accompanied by a non-negligible uncertainty. Our preliminary data seem to indicate that paleoenvironmental DNA may be isolated from speleothems, but the intrinsic weakness of PCR-based metabarcoding poses a challenge to its exploitation. We suggest that newly developed methods such as hybridization capture, being free from PCR drawbacks and offering the opportunity to directly assess aDNA authenticity, may overcome these limitations, allowing a proper exploitation of speleothems as biological archives.

An Evaluation of the OLM CandID Real-Time PCR to Aid in the Diagnosis of Invasive Candidiasis When Testing Serum Samples.

Background: Treatment for invasive candidiasis (IC) is time-critical, and culture-based tests can limit clinical utility. Nonculture-based methods such as Candida PCR represent a promising approach to improving patient management but require further evaluation to understand their optimal role and incorporation into clinical algorithms. This study determined the performance of the commercially available OLM CandID real-time PCR when testing serum and developed a diagnostic algorithm for IC. Methods: The study comprised a retrospective performance evaluation of the CandID real-time PCR assay when testing surplus serum (n = 83 patients, 38 with IC), followed by a prospective consecutive cohort evaluation (n = 103 patients, 24 with IC) post incorporation into routine service. A combined diagnostic algorithm, also including (1-3)-β-D-Glucan testing, was generated. Results: Prospective CandID testing generated a sensitivity/specificity of 88%/82%, respectively. Specificity was improved (>95%) when both PCR replicates were positive and/or the patient had multiple positive samples. When combining CandID with (1-3)-β-D-Glucan testing, the probability of IC when both were positive or negative was >69% or <1%, respectively. Conclusions: The CandID provides excellent performance and a rapid time-to-result using methods widely available in generic molecular diagnostic laboratories. By combining nonculture diagnostics, it may be possible to accurately confirm or exclude IC.

Experimental methods modestly impact interpretation of the effect of environmental exposures on the larval zebrafish gut microbiome

Rapidly growing fields, such as microbiome science, often lack standardization of procedures across research groups. This is especially the case for microbiome investigations in the zebrafish (Danio rerio) model system, which is quickly becoming a workhorse system for understanding the exposure-microbiome-physiology axis. To guide future investigations using this model system, we defined how various experimental decisions affect the outcomes of studies on the effects of exogenous exposure on the zebrafish gut microbiome. Using a model toxicant, benzo[a]pyrene (BaP), we assessed how each of two dissection methods (gut dissection vs. whole fish), three DNA extraction kits (Qiagen Blood & Tissue, Macherey–Nagel NucleoSpin, and Qiagen PowerSoil), and inclusion of PCR replicates (single vs. pooled triplicate reactions) affected our interpretation of how exposure influences the diversity and composition of the gut microbiome, as well as our ability to identify microbiome biomarkers of exposure. We found that inclusion of PCR replicates had the smallest effect on our final interpretations, and the effects of dissection method and DNA extraction kit had significant effects in specific contexts, primarily in the cases of identifying microbial biomarkers.

An efficient early‐pooling protocol for environmental DNA metabarcoding

AbstractEnvironmental DNA (eDNA) metabarcoding, a method that applies high‐throughput sequencing and universal primer sets to eDNA analysis, has been a promising approach for efficient, comprehensive biodiversity monitoring. However, significant money‐, labor‐, and time‐costs are still required for performing eDNA metabarcoding. In this study, we assessed the performance of an “early‐pooling” protocol (a protocol based on 1st PCR tagging) to reduce the experimental costs of library preparation for eDNA metabarcoding. Specifically, we performed three experiments to investigate the effects of 1st PCR‐tagging and 2nd PCR‐indexing protocols on the community composition revealed by eDNA metabarcoding, the effects of post‐1st PCR exonuclease purification on tag jumping (corresponds to index hopping in 2nd PCR indexing), and the effects of the number of PCR replicates and the eDNA template volume on the number of detected OTUs. Analyses of 204 eDNA libraries from three natural aquatic ecosystems and one mock eDNA sample showed that (i) 1st PCR tagging does not cause clear biases in the outcomes of eDNA metabarcoding, (ii) post‐1st PCR exonuclease purification reduces the risk of tag jumping, and (iii) increasing the eDNA template volume may increase the number of detected OTUs and reduce variations in the detected community compositions, similar to increasing the number of 1st PCR replicates. Our results show that an early‐pooling protocol with post‐1st PCR exonuclease purification and an increased amount of the DNA template reduces the risk of tag jumping, the costs for consumables and reagents (except for many tagged 1st PCR primers), and the handling time in library preparation, and produces similar results to a 2nd PCR‐indexing protocol. Therefore, once a target metabarcoding region is selected and a set of tagged‐1st PCR primers is prepared, the early‐pooling protocol provides a cost, labor, and time‐efficient approach for processing a large number of samples.

CHARACTERIZING TUBERCULOSIS PROGRESSION IN WILD MEERKATS (SURICATA SURICATTA) FROM FECAL SAMPLES AND CLINICAL SIGNS.

Tuberculosis (TB) is an increasing threat to wildlife, yet tracking its spread is challenging because infections often appear to be asymptomatic, and diagnostic tools such as blood tests can be invasive and resource intensive. Our understanding of TB biology in wildlife is therefore limited to a small number of well-studied species. Testing of fecal samples using PCR is a noninvasive method that has been used to detect Mycobacterium bovis shedding amongst badgers, yet its utility more broadly for TB monitoring in wildlife is unclear. We combined observation data of clinical signs with PCR testing of 388 fecal samples to characterize longitudinal dynamics of TB progression in 66 wild meerkats (Suricata suricatta) socially exposed to Mycobacterium suricattae between 2000 and 2018. Our specific objectives were 1) to test whether meerkat fecal samples can be used to monitor TB; 2) to characterize TB progression between three infection states (PCR-negative exposed, PCR-positive asymptomatic, and PCR positive with clinical signs); and 3) estimate individual heterogeneity in TB susceptibility, defined here as the time between TB exposure and detection, and survival after TB detection. We found that the TB detection probability once meerkats developed clinical signs was 13% (95% confidence interval 3-46%). Nevertheless, with an adapted test protocol of 10 PCR replicates per sample we detected hidden TB infections in 59% of meerkats before the onset of clinical signs. Meerkats became PCR positive approximately 14 mo after initial exposure, developed clinical signs approximately 1 yr after becoming PCR positive, and died within 5 mo of developing clinical signs. Individual variation in disease progression was high, with meerkats developing clinical signs from immediately after exposure to 3.4 yr later. Overall, our study generates novel insights into wildlife TB progression, and may help guide adapted management strategies for TB-susceptible wildlife populations.

Seed quantity affects the fungal community composition detected using metabarcoding

Pest introductions via trade in tree seed may result from a lack of adequate survey and validation protocols. Developing better diagnostic protocols to identify potentially harmful pests and pathogens in forest tree seed is of critical importance. High-throughput sequencing-based barcoding and metabarcoding provide effective tools for screening potentially harmful organisms in various plant materials, including seeds. However, the sample size needed to detect the total microorganism diversity of a community is a major challenge in microbiome studies. In this work, we examined how increasing sample size (ranging between 100 and 1000 seeds) influences diversity of fungal communities detected by high throughput sequencing in Pinus sylvestris seeds. Our results showed that as sample size increased, fungal alpha diversity also increased. Beta-diversity estimators detected significant differences between the mycobiota from different samples. However, taxonomic and functional diversity were not correlated with sample size. In addition, we found that increasing the number of PCR replicates resulted in a higher abundance of plant pathogens. We concluded that for the purpose of screening for potentially harmful pathogens using HTS, greater efforts should be made to increase the sample size and replicates when testing tree seed.

Characterization of fungal mycobiome in bladder cancer.

542 Background: Bacterial dysbiosis accompanies carcinogenesis in malignancies such as colon, breast and pancreatic cancer. However, the role of fungal mycobiome has not been evaluated in bladder cancer. With the sexual dimorphism that exists within bladder cancer (Bca) prevalence and survival, our study aims to characterize fungal mycobiome composition in Bca. Methods: This is a single site, non-randomized, prospective study of patients with the diagnosis of muscle invasive bladder cancer (MIBC) undergoing cystectomy from September 2020 to May 2021. Stool samples were collected during surgery using aseptic technique. We utilized the ITS1 region from DNA sample extracts, which was amplified in triplicate using primers with high specificity for ascomycete fungi (fluorescently-labeled forward primer ITS1F (CTTGGTCATTTAGAGGAAGTAA) and unlabeled reverse primer ITS2 (GCTGCGTTCTTCATCGATGC). Fungal PCR products were separated on the SCE 9610 capillary DNA sequencer (Spectrumedix LLC, State College, PA) using GenoSpectrum software to convert fluorescent output into electropherograms. Hierarchical clustering by Bray-Curtis distance was performed using hclust2. Mean normalized abundance for each amplicon was calculated from the three PCR replicates of each sample, excluding means below 1%. Results: A total of 29 patients (17 males and 12 females) were enrolled. The median (IQR) age was 74 yo (63-77), males, and 68.5 yo (58-78), females. Per figure 1, Saccharomycecales dominated the fungal community at order level with mean relative abundance of 36.35% females, and 21.20%, males. (Figure 1D) Tremellales was the second most notable order, composing 8.22% and 5.13% of male and female samples. There were no differences seen in alpha and beta diversity (Figure 1C) (Figure 1A, C), notable differences were seen across orders. The greatest difference between sexes in LDA( M:F) were noted in Saccharomycecales (log change -4.686, p=0.001/ padj= 0.01), Tremellales (log change 5.119, p=0.001/padj= 0.01), and Sporidiobolales (log change 4.839, p=0.001 padj= 0.03). (Figure 1B). Female bladder cancer patients demonstrating an increase abundance of Saccharomycecale. When assessing differences in fungal composition in patients with history of neoadjuvant therapy( NAC) (receipt vs none), patients with history of NAC exhibited a 3.48 increase in Saccharomycecale (padj= 0.015 ), 4.81 increase Tremalles (padj= 0.009) and 4.37 increase Pleosporales(padj= 0.009) . Conclusions: Mycobiome is an integral part of gut microbiota, with fungal elements relatively poorly studied. Nevertheless, the association between fungal dysbiosis and carcinogenesis across multiple cancers exists. Our study is the first to characterize fungal profile in bladder cancer patients, stratified by sex and receipt of NAC, with results highlighting key fungal players: Saccharomycecale, Tremallales, Pleosoporales.

Towards harmonization of DNA metabarcoding for monitoring marine macrobenthos: the effect of technical replicates and pooled DNA extractions on species detection

DNA-based monitoring methods are potentially faster and cheaper compared to traditional morphological benthic identification. DNA metabarcoding involves various methodological choices which can introduce bias leading to a different outcome in biodiversity patterns. Therefore, it is important to harmonize DNA metabarcoding protocols to allow comparison across studies and this requires a good understanding of the effect of methodological choices on diversity estimates. This study investigated the impact of DNA and PCR replicates on the detection of macrobenthos species in locations with high, medium and low diversity. Our results show that two to three DNA replicates were needed in locations with a high and medium diversity to detect at least 80% of the species found in the six DNA replicates, while three to four replicates were needed in the location with low diversity. In contrast to general belief, larger body size or higher abundance of the species in a sample did not increase its detection prevalence among DNA replicates. However, rare species were less consistently detected across all DNA replicates of the location with high diversity compared to locations with less diversity. Our results further show that pooling of DNA replicates did not significantly alter diversity patterns, although a small number of rare species was lost. Finally, our results confirm high variation in species detection between PCR replicates, especially for the detection of rare species. These results contribute to create reliable, time and cost efficient metabarcoding protocols for the characterization of macrobenthos.

Rapid Molecular Determination of Sex for Western North American Chub (Gila spp.)

AbstractGathering sex data is frequently a complicated matter for fish species that lack sexually dimorphic traits. Secondary sexual characteristics are cryptic or nonexistent in many minnows (Cyprinidae) during early life stages or outside of the breeding season, which may require lethal methods for determining sex. This complicates many conservation actions and population genetic studies, including (1) the development of hatchery broodstocks for threatened and endangered species, (2) sex ratio determination in wild populations, (3) the influence of sex ratio on the effective population size estimates, and (4) limitations on the implementation of genetic tagging and parentage assignment in wild populations. Here, we remedy this issue for four western North American chub species (Gila spp.) through restriction‐site‐associated DNA sequencing of Bonytail G. elegans, which identified a single locus indicating an XY sex determination system and no candidate loci consistent with a WZ system. This locus cross‐amplified in three additional Gila species (Chihuahua Chub G. nigrescens, Virgin Chub G. seminuda, and White River Chub G. jordani), although species‐specific differences necessitated the development of three novel primer/probe sets. Real‐time PCR with hydrolysis probe assays was used to genotype sex‐linked single‐nucleotide polymorphisms for each species. The measurement of endpoint fluorescence in a real‐time PCR thermal cycler allowed for rapid and accurate sex genotyping of these species, with accuracy &gt;97% relative to phenotypic sex identification when three PCR replicates were employed. These assays provided high precision, with unanimous results across &gt;87% of the replicates and a majority consensus genotype for 98.6% of the samples. The locus identified herein was conserved across all of the Gila species that we tested (n = 6) and other western North American cyprinids; however, sex‐linked polymorphisms were found only in the four species that are named above. Consequently, this locus has promise for the identification and development of sex‐linked assays for other Gila and closely related cyprinids.

Fish eDNA metabarcoding from aquatic biofilm samples: Methodological aspects

Fish eDNA metabarcoding is usually performed from filtered water samples. The volume of filtered water depends on the study scope and can rapidly become time consuming according to the number of samples that have to be processed. To avoid time allocated to filtration, passive DNA samplers have been used to recover fish eDNA from marine environments faster. In freshwater ecosystems, aquatic biofilms were used to catch eDNA from macroinvertebrates. Here, we test the capacity of aquatic biofilms to entrap fish eDNA in a large lake and, therefore, the possibility to perform fish eDNA metabarcoding from this matrix compared to the traditional fish eDNA approach from filtered water samples. Methodological aspects of the use of aquatic biofilms for fish eDNA metabarcoding (e.g. PCR replicates, biological replicates, bioinformatics pipeline, reference database and taxonomic assignment) were validated against a mock community. When using biofilms from habitats sheltered from wind and waves, biofilm and water approach provided similar inventories. Richness and diversity were comparable between both approaches. Approaches differed only for rare taxa. Our results illustrate the capacity of aquatic biofilms to act as passive eDNA samplers of fish eDNA and, therefore, the possibility to use biofilms to monitor fish communities efficiently from biofilms. Furthermore, our results open up avenues of research to study a diversity of biological groups (among which bioindicators as diatoms, macroinvertebrates and fish) from eDNA isolated from a single environmental matrix reducing sampling efforts, analysis time and costs.

Automated genotyping of microsatellite loci from feces with high throughput sequences.

Ecological and conservation genetic studies often use noninvasive sampling, especially with elusive or endangered species. Because microsatellites are generally short in length, they can be amplified from low quality samples such as feces. Microsatellites are highly polymorphic so few markers are enough for reliable individual identification, kinship determination, or population characterization. However, the genotyping process from feces is expensive and time consuming. Given next-generation sequencing (NGS) and recent software developments, automated microsatellite genotyping from NGS data may now be possible. These software packages infer the genotypes directly from sequence reads, increasing throughput. Here we evaluate the performance of four software packages to genotype microsatellite loci from Iberian wolf (Canis lupus) feces using NGS. We initially combined 46 markers in a single multiplex reaction for the first time, of which 19 were included in the final analyses. Megasat was the software that provided genotypes with fewer errors. Coverage over 100X provided little additional information, but a relatively high number of PCR replicates were necessary to obtain a high quality genotype from highly unoptimized, multiplexed reactions (10 replicates for 18 of the 19 loci analyzed here). This could be reduced through optimization. The use of new bioinformatic tools and next-generation sequencing data to genotype these highly informative markers may increase throughput at a reasonable cost and with a smaller amount of laboratory work. Thus, high throughput sequencing approaches could facilitate the use of microsatellites with fecal DNA to address ecological and conservation questions.

Revisiting the effect of PCR replication and sequencing depth on biodiversity metrics in environmental DNA metabarcoding.

Environmental DNA (eDNA) metabarcoding is an increasingly popular tool for measuring and cataloguing biodiversity. Because the environments and substrates in which DNA is preserved differ considerably, eDNA research often requires bespoke approaches to generating eDNA data. Here, we explore how two experimental choices in eDNA study design—the number of PCR replicates and the depth of sequencing of PCR replicates—influence the composition and consistency of taxa recovered from eDNA extracts. We perform 24 PCR replicates from each of six soil samples using two of the most common metabarcodes for Fungi and Viridiplantae (ITS1 and ITS2), and sequence each replicate to an average depth of ~84,000 reads. We find that PCR replicates are broadly consistent in composition and relative abundance of dominant taxa, but that low abundance taxa are often unique to one or a few PCR replicates. Taxa observed in one out of 24 PCR replicates make up 21–29% of the total taxa detected. We also observe that sequencing depth or rarefaction influences alpha diversity and beta diversity estimates. Read sampling depth influences local contribution to beta diversity, placement in ordinations, and beta dispersion in ordinations. Our results suggest that, because common taxa drive some alpha diversity estimates, few PCR replicates and low read sampling depths may be sufficient for many biological applications of eDNA metabarcoding. However, because rare taxa are recovered stochastically, eDNA metabarcoding may never fully recover the true amplifiable alpha diversity in an eDNA extract. Rare taxa drive PCR replicate outliers of alpha and beta diversity and lead to dispersion differences at different read sampling depths. We conclude that researchers should consider the complexity and unevenness of a community when choosing analytical approaches, read sampling depths, and filtering thresholds to arrive at stable estimates.

Beyond fish eDNA metabarcoding: Field replicates disproportionately improve the detection of stream associated vertebrate species

Fast, reliable, and comprehensive biodiversity monitoring data are needed for environmental decision making and management. Recent work on fish environmental DNA (eDNA) metabarcoding shows that aquatic diversity can be captured fast, reliably, and non-invasively at moderate costs. Because water in a catchment flows to the lowest point in the landscape, often a stream, it can collect traces of terrestrial species via surface or subsurface runoff along its way or when specimens come into direct contact with water (e.g., when drinking). Thus, fish eDNA metabarcoding data can provide information on fish but also on other vertebrate species that live in riparian habitats. This additional data may offer a much more comprehensive approach for assessing vertebrate diversity at no additional costs. Studies on how the sampling strategy affects species detection especially of stream-associated communities, however, are scarce. We therefore performed an analysis on the effects of biological replication on both fish as well as (semi-)terrestrial species detection. Along a 2 km stretch of the river Mulde (Germany), we collected 18 1-L water samples and analyzed the relation of detected species richness and quantity of biological replicates taken. We detected 58 vertebrate species, of which 25 were fish and lamprey, 18 mammals, and 15 birds, which account for 50%, 22.2%, and 7.4% of all native species to the German federal state of Saxony-Anhalt. However, while increasing the number of biological replicates resulted in only 24.8% more detected fish and lamprey species, mammal, and bird species richness increased disproportionately by 68.9% and 77.3%, respectively. Contrary, PCR replicates showed little stochasticity. We thus emphasize to increase the number of biological replicates when the aim is to improve general species detections. This holds especially true when the focus is on rare aquatic taxa or on (semi-)terrestrial species, the so-called ‘bycatch’. As a clear advantage, this information can be obtained without any additional sampling or laboratory effort when the sampling strategy is chosen carefully. With the increased use of eDNA metabarcoding as part of national fish bioassessment and monitoring programs, the complimentary information provided on bycatch can be used for biodiversity monitoring and conservation on a much broader scale.