PCR Melting Curve Analysis Research Articles

A rapid screening program on the resistance to streptomycin and ethambutol in Mycobacterium tuberculosis isolates by PCR melting curve analysis

To evaluate the effects of PCR melting curve analysis assay on a rapid screening program regarding the resistance of Mycobacterium tuberculosis (MTB) clinical isolates to streptomycin and ethambutol. A total of 331 clinical isolates of MTB had been collected since 2007-2009 in Shenzhen. Mutations at codon 306, 378-380, 406 and 497 of embB gene, codon 43, 88 of rpsL gene, and 513-517, 905-908 region of rrs gene were detected by PCR melting curve analysis. Results were compared with that of conventional drug susceptibility test. Compared to drug susceptibility test, sensitivity, specificity and accuracy for streptomycin resistance were 78.6%, 90.1% and 86.7%, respectively while 83.0%, 93.3% and 91.8%, respectively for ethambutol resistance detected by PCR melting curve analysis. PCR melting curve method was in good agreement with drug susceptibility test. PCR melting curve analysis on genetic regions associated with resistance to streptomycin and ethambutol seemed to be a rapid, specific and closed-tube method so it could be used for detection of streptomycin and ethambutol resistance in MTB.

Rapid detection of CFH (p.Y402H) and ARMS2 (p.A69S) polymorphisms in age-related macular degeneration using high-resolution melting analysis

Age-related macular degeneration (AMD) is a complex disorder causing irreversible central vision loss. Complement Factor H (CFH) and age-related maculopathy susceptibility 2 (ARMS2) are now widely accepted as important AMD susceptibility genes. In particular, two specific variants, CFH p.Y402H and ARMS2 p.A69S, have been reported as strongly AMD associated. In order to perform the genetic screening of these single nucleotide polymorphisms (SNPs), we describe a high resolution melting analysis (HRM) as a rapid closed tube mutation scanning assay. To validate HRM genotyping, 94 DNA samples from AMD patients (previously genotyped by sequence analysis) were analyzed. PCR amplification and melting curve analysis were performed in the LightCycler 480 Real-Time PCR System. In order to evaluate the accuracy of the HRM assay, we performed a blinded study of 20 unknown independent samples. We correctly genotyped all samples. In fact, all samples corresponded to the previous genotype assignments. Early identification of individuals with genetic risk variants CFH p.Y402H and ARMS2 p.A69S is clinically important for the definition of AMD status. High-resolution DNA melting is homogenous, accurate and rapid method for CFH and ARMS2 genotyping.

CORRIGENDUM

Journal of Applied MicrobiologyVolume 112, Issue 2 p. 416-416 Free Access CORRIGENDUM This article corrects the following: Characterization of Chlamydiaceae species using PCR and high resolution melt curve analysis of the 16S rRNA gene T. Robertson, S. Bibby, D. O’Rourke, T. Belfiore, H. Lambie, A.H. Noormohammadi, Volume 107Issue 6Journal of Applied Microbiology pages: 2017-2028 First Published online: May 20, 2009 First published: 09 December 2011 https://doi.org/10.1111/j.1365-2672.2011.05201.xAboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat In Table 2 of the paper by Robertson et al. (2009), the sequence of the 5′→ 3′ 16SG forward primer should read ‘GGATGAGGCATGCAAGTC’ as opposed to the current ‘TGATGAGGCATGCAAGTC’. For clarity, the corrected table is reproduced below: Table 2. Oligonucleotide sets used in this study Name Size (bp) Target gene Direction Sequence (5′→ 3′) CTU/CTL (Denamur et al. 1991) 1070 omp1 Forward ATGAAAAAACTCTTGAAATCGG Reverse CCAGCTTTTCTAGACTTCATCTTGTT 16S rRNA (Messmer et al. 1997) 430 16S Forward ACGGAATAATGACTTCGG Reverse TACCTGGTACGCTCAATT 16SIG (Everett et al. 1999) 296 16S Forward CGGCGTGGATGAGGCAT Reverse TCAGTCCCAGTGTTGGC 16SF2/23SIG (Everett et al. 1999) 1006 16S/23S Forward CCGCCCGTCACATCATGG Reverse TGGCTCTCATGCAAAAGGCA 16SG 460 16S Forward GGATGAGGCATGCAAGTC Reverse TTACCTGGTACGCTCAAAT The authors apologize for any confusion this may have caused. Reference Robertson, T., Bibby, S., O’Rourke, D., Belfiore, T., Lambie, H. and Noormohammadi, A.H. (2009) Characterization of Chlamydiaceae species using PCR and high resolution melt curve analysis of the 16S rRNA gene. J Appl Microbiol 107, 2017– 2028. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar Volume112, Issue2February 2012Pages 416-416 ReferencesRelatedInformation

Multiplex Real-Time PCR Assay and Melting Curve Analysis for Identifying Mycobacterium tuberculosis Complex and Nontuberculous Mycobacteria

A multiplex real-time PCR assay and melting curve analysis for identifying 23 mycobacterial species was developed and evaluated using 77 reference strains and 369 clinical isolates. Concordant results were obtained for all 189 (100%) isolates of the Mycobacterium tuberculosis complex and 169 (93.9%) isolates of nontuberculous mycobacteria. Our results showed that this multiplex real-time PCR assay is an effective tool for the mycobacterial identification from cultures.

Rapid and specific detection of Salmonella in water samples using real-time PCR and High Resolution Melt (HRM) curve analysis

A real-time PCR assay combined with a pre-enrichment step for the specific and rapid detection of Salmonella in water samples is described. Following amplification of the invA gene target, High Resolution Melt (HRM) curve analysis was used to discriminate between products formed and to positively identify invA amplification. The real-time PCR assay was evaluated for specificity and sensitivity. The assay displayed 100% specificity for Salmonella and combined with a 16-18 h non-selective pre-enrichment step, the assay proved to be highly sensitive with a detection limit of 1.0 CFU/ml for surface water samples. The detection assay also demonstrated a high intra-run and inter-run repeatability with very little variation in invA amplicon melting temperature. When applied to water samples received routinely by the laboratory, the assay showed the presence of Salmonella in particularly surface water and treated effluent samples. Using the HRM based assay, the time required for Salmonella detection was drastically shortened to less than 24 h compared to several days when using standard culturing methods. This assay provides a useful tool for routine water quality monitoring as well as for quick screening during disease outbreaks.

Rapid single-nucleotide polymorphism-based identification of clonal Pseudomonas aeruginosa isolates from patients with cystic fibrosis by the use of real-time PCR and high-resolution melting curve analysis

Pseudomonas aeruginosa genotyping relies mainly upon DNA fingerprinting methods, which can be subjective, expensive and time-consuming. The detection of at least three different clonal P. aeruginosa strains in patients attending two cystic fibrosis (CF) centres in a single Australian city prompted the design of a non-gel-based PCR method to enable clinical microbiology laboratories to readily identify these clonal strains. We designed a detection method utilizing heat-denatured P. aeruginosa isolates and a ten-single-nucleotide polymorphism (SNP) profile. Strain differences were detected by SYBR Green-based real-time PCR and high-resolution melting curve analysis (HRM10SNP assay). Overall, 106 P. aeruginosa sputum isolates collected from 74 patients with CF, as well as five reference strains, were analysed with the HRM10SNP assay, and the results were compared with those obtained by pulsed-field gel electrophoresis (PFGE). The HRM10SNP assay accurately identified all 45 isolates as members of one of the three major clonal strains characterized by PFGE in two Brisbane CF centres (Australian epidemic strain-1, Australian epidemic strain-2 and P42) from 61 other P. aeruginosa strains from Australian CF patients and two representative overseas epidemic strain isolates. The HRM10SNP method is simple, is relatively inexpensive and can be completed in <3 h. In our setting, it could be made easily available for clinical microbiology laboratories to screen for local P. aeruginosa strains and to guide infection control policies. Further studies are needed to determine whether the HRM10SNP assay can also be modified to detect additional clonal strains that are prevalent in other CF centres.

Rapid genotyping of HLA-B27 among Korean population by real-time PCR melting curve analysis

Background Real-time PCR and melting curve analysis is the relatively recent method for HLA-B27 genotyping, which has advantages of being simple and rapid. Methods The accuracy of melting curve analysis for HLA-B27 was assessed in 153 clinical samples and 52 DNA samples from International Histocompatibility Workshop (IHW) cell lines, with sequence-based typing (SBT) as the reference method. We predicted melting reaction for various HLA-B27 subtypes using simulation software. Results For clinical samples, 53 HLA-B27-positive and 100 negative results by melting curve analysis were confirmed by completely concordant SBT results. The B*27:05 allele was found in 50 patients, and the B*27:04 allele in 3 patients. Among 62 known alleles, 21 alleles had differences in the target sequence, including 10 alleles having mismatches in the primer binding site. In these alleles, differences in melting points (T m) were predicted to be ≤ 1.2 °C. The predicted results were obtained when IHW samples were tested, which revealed slight lower T m for B*27:06 and negative results for B*27:07. Conclusions Genotyping of HLA-B27 by melting curve analysis was fast and reliable for routine laboratory testing for frequent alleles. In silico melting simulations provided useful information about the utility and limitation of this method for diverse HLA-B27 alleles.

Single‐step real‐time PCR to quantify hepatitis B virus and distinguish genotype D from non‐D genotypes

Hepatitis B virus (HBV) viral load and its genotype play important roles in clinical outcome, management of disease and response to antiviral therapy. In many parts of the world such as Europe or the Middle East, distinguishing HBV genotype D from non-D is most relevant for treatment decisions, because genotype D-infected patients respond poorly to interferon-based therapeutic regimens. Here, we developed an in-house real-time PCR to concordantly assess HBV genotype (D vs non-D) based on melt curve analysis and quantify the viral load. Genotype distinction was established with control plasmids of all HBV genotypes and validated with 57 clinical samples from patients infected with six different HBV genotypes. Our in-house real-time PCR assay could discriminate HBV genotype D from non-D using single-step melt curve analysis with a 2 °C difference in the melt curve temperature in all samples tested. Viral load quantification was calibrated with the WHO HBV international standard, demonstrating an excellent correlation with a commercial kit (r = 0.852; P < 0.0001) in a linear range from 3.2 × 10(2) to 3.2 × 10(10) IU/mL. In conclusion, we developed a rapid, simple and cost-effective method to simultaneously quantify and distinguish HBV genotypes D from non-D with a single-step PCR run and melt curve analysis. This assay should be a useful diagnostic alternative to aid clinical decisions about initiation and choice of antiviral therapy, especially in geographical regions with a high prevalence of HBV genotype D.

Simultaneous detection of Listeria monocytogenes and Salmonella spp. in dairy products using real time PCR-melt curve analysis

The present investigation reports development of post real time PCR (RTi-PCR) - melt curve analysis for simultaneous detection of Listeria monocytogenes and Salmonella spp. The optimal Sybr Green I (SG-I) concentration of 1.6μM resulted in two specific peaks with melting temperature (Tm) of 79.90 ± 0.39°C and 86.29 ± 0.13°C for L. monocytogenes and Salmonella spp respectively. The detection sensitivity of the assay in reconstituted non-fat dried milk (NFDM; 11%) spiked with the target pathogens at different levels was 3 log cfu per ml of each pathogen. However, the sensitivity was improved up to 1 log cfu per ml by including pre-enrichment step of 6h. On application of assay on 60 market samples, one sample each of raw milk and ice cream was detected positive for L. monocytogenes and Salmonella spp. Assay was quite specific as no cross reactivity with non target cultures could be observed. The developed assay can find valuable application in monitoring dairy products for the presence of L. monocytogenes and Salmonella spp. to ensure their microbiological quality and safety.

The brain‐derived neutrophic factor val66met polymorphism and sudden unexpected infant death

Findings of hypoxia prior to death and involvement of a dysregulation of the serotonergic network in sudden infant death syndrome (SIDS) may indicate that brain-derived neutrophic factor (BDNF) also is of importance with regard to sudden unexpected infant death. Based on this, the purpose of this study was to investigate the BDNF val66met polymorphism in SIDS cases, cases of infectious death and controls. The polymorphism was investigated in 163 SIDS cases, 34 cases of infectious death and 121 controls, using real-time PCR and fluorescence melting curve analysis. There were no differences in val66met genotype distribution between neither the SIDS cases nor the cases of infectious death and controls (p = 0.95 and p = 0.52, respectively). The study indicates that the val66met polymorphism is not important for sudden unexpected infant death. However, several other SNPs in the BDNF gene, as well as in other genes involved in this pathway, including G-protein, have to be investigated to fully exclude any involvement of BDNF in SIDS.

COLD-PCR enhanced melting curve analysis improves diagnostic accuracy for KRAS mutations in colorectal carcinoma

BackgroundKRAS mutational analysis is the standard of care prior to initiation of treatments targeting the epidermal growth factor receptor (EGFR) in patients with metastatic colorectal cancer. Sensitive methods are required to reliably detect KRAS mutations in tumor samples due to admixture with non-mutated cells. Many laboratories have implemented sensitive tests for KRAS mutations, but the methods often require expensive instrumentation and reagents, parallel reactions, multiple steps, or opening PCR tubes.MethodsWe developed a highly sensitive, single-reaction, closed-tube strategy to detect all clinically significant mutations in KRAS codons 12 and 13 using the Roche LightCycler® instrument. The assay detects mutations via PCR-melting curve analysis with a Cy5.5-labeled sensor probe that straddles codons 12 and 13. Incorporating a fast COLD-PCR cycling program with a critical denaturation temperature (Tc) of 81°C increased the sensitivity of the assay >10-fold for the majority of KRAS mutations.ResultsWe compared the COLD-PCR enhanced melting curve method to melting curve analysis without COLD-PCR and to traditional Sanger sequencing. In a cohort of 61 formalin-fixed paraffin-embedded colorectal cancer specimens, 29/61 were classified as mutant and 28/61 as wild type across all methods. Importantly, 4/61 (6%) were re-classified from wild type to mutant by the more sensitive COLD-PCR melting curve method. These 4 samples were confirmed to harbor clinically-significant KRAS mutations by COLD-PCR DNA sequencing. Five independent mixing studies using mutation-discordant pairs of cell lines and patient specimens demonstrated that the COLD-PCR enhanced melting curve assay could consistently detect down to 1% mutant DNA in a wild type background.ConclusionsWe have developed and validated an inexpensive, rapid, and highly sensitive clinical assay for KRAS mutations that is the first report of COLD-PCR combined with probe-based melting curve analysis. This assay significantly improved diagnostic accuracy compared to traditional PCR and direct sequencing.

In-Gel Technology for PCR Genotyping and Pathogen Detection

This work describes the use of polyacrylamide gel and PCR reagents photopolymerized in a mold to create an array of semisolid posts that serve as reaction vessels for parallel PCR amplification of an externally added template. DNA amplification occurred in a cylindrical, self-standing 9 × 9 array of gel posts each less than 1 μL in volume. Photopolymerization of the gel with an intercalating dye added prior to polymerization permitted acquisition of real-time PCR data and melting curve analysis data without the need for any type of post-PCR staining procedures. PCR was equally efficient and reproducible when template DNA was polymerized within the gel or when exogenous template was added atop precast gel posts. PCR amplification occurred with template from purified DNA or from raw urine of patients with BK viruria. Multiple primer sets can be utilized per gel post array with no detectable cross contamination. As few as 34 BK virus templates were consistently detected by PCR in an individual gel post. Amplification of HPA1 and FGFR2 genes in human genomic DNA (gDNA) required as little as 2-5 ng of gDNA template/gel post. The device prototype includes a Peltier element for PCR thermal cycling and a CCD camera to capture fluorescence for product detection. Our technology is amenable to integration in point of care microdevices.

Detection of IDH1 and IDH2 Mutations by Fluorescence Melting Curve Analysis as a Diagnostic Tool for Brain Biopsies

Novel mutations in the isocitrate dehydrogenase 1 (IDH1) and 2 (IDH2) genes have been identified in a large proportion of diffuse gliomas. Tumors with IDH1/2 mutations have distinctive clinical characteristics, including a less aggressive course. The aim of this study was to develop and evaluate the performance of a novel real-time PCR and post-PCR fluorescence melting curve analysis assay for the detection of IDH1 and IDH2 mutations in routine formalin-fixed, paraffin-embedded tissues of brain biopsies. Using the established assay, we tested 67 glial neoplasms, 57 non-neoplastic conditions that can often mimic gliomas (eg, radiation changes, viral infections, infarctions, etc), and 44 noncentral nervous system tumors. IDH1 and IDH2 mutations were detected in 72% of lower grade diffuse gliomas and in 17% of glioblastomas. The IDH1 mutation was the most common (93%), with the most frequent subtype being R132H (88%). These mutations were not identified in non-neoplastic glioma mimickers and in noncentral nervous system tumors including thyroid carcinomas. The results of this assay had a 100% correlation with the results obtained by conventional sequencing. In summary, we report here the real-time PCR/fluorescence melting curve analysis assay that provides rapid and sensitive detection of IDH mutations in formalin-fixed, paraffin-embedded tissues, and is therefore useful as a powerful adjunct diagnostic tool for refining histopathological diagnosis of brain lesions and guiding patient management.

Single-tube real-time multiple allele-specific PCR for genotyping chicken Mx gene G2032A SNP

1. A non-synonymous, single nucleotide polymorphism (G to A) at position 2032 (Ser 631 Asn) of the chicken Mx gene has been demonstrated to be related to resistance to antiviral activity. This study developed a new real-time PCR-based allelic discrimination assay for the rapid genotyping of the chicken Mx gene G2032A SNP. The distribution of the Mx gene G2032A SNP genotypes and the allele frequencies of A and G alleles among different chicken breed populations were screened with the use of this method. 2. We combined previously described allele-specific PCR and SYBR Green I-based real-time PCR melting curve analysis with a novel primer design strategy. A pair of outer nested primers was designed to amplify a fragment containing the SNP site, and two 3′-specific, allele-specific primers were combined with the outer primers to amplify SNP-specific fragments. Genotypes were identified based on the characteristic melting temperature of the SNP-specific fragments. 3. Genotyping assignments were successfully performed on samples from 8 chicken breeds, which were analysed by agarose gel electrophoresis of the PCR products and compared with results obtained from the direct sequencing of the outer primer amplicon. Five native breeds from Southern China carried a relatively higher frequency of the resistant A allele than the three commercial chicken lines. 4. This single-tube real-time multiplex allele-specific PCR assay is rapid, reliable, sensitive and easy to perform. It is appropriate for high-throughput sample analysis in large population-based Mx SNP genotyping studies.

Detection of Vancomycin-resistant Enterococci using Multiplex Real-time PCR Assay and Melting Curve Analysis

We developed and evaluated the utility of a multiplex real-time PCR assay that uses melting curve analysis and allows simultaneous identification of vancomycin-resistant genotypes and clinically relevant enterococci. The specificity of the assay was tested using 4 reference strains of vancomycin-resistant enterococci (VRE) and 2 reference strains of vancomycin-susceptible enterococci. Ninety-three clinical isolates of enterococci with different glycopeptide-resistant phenotypes were genotyped and identified using a multiplex real-time PCR assay and melting curve analysis. Representative melting curves were obtained for Enterococcus faecium, Enterococcus faecalis, vanA-containing E. faecium, vanB-containing E. faecalis, Enterococcus gallinarum, and Enterococcus casseliflavus. Phenotypic and genotypic analysis of the isolates revealed same results for 82 enterococcal isolates, while in 4 isolates, the glycopeptide-resistant phenotypes were inconsistent with the glycopeptide-resistant genotypes and in the 4 other isolates, species could not be accurately identified. Three isolates with mixed strains, which were detected by the PCR assay, could not be correctly identified using phenotypic methods. VRE genotyping and identification of clinically relevant enterococci were rapidly and correctly performed using multiplex real-time PCR assay and melting curve analysis.

Differentiation of Mycoplasma gallisepticum strains using PCR and high-resolution melting curve analysis

Mycoplasma gallisepticum (MG) is an economically important pathogen of poultry worldwide, causing chronic respiratory disease in chickens and turkeys. Differentiation of MG strains is critical, especially in countries where poultry flocks are vaccinated with live vaccines. In this study, oligonucleotide primers were designed based on a region preceding the trinucleotide repeat of a member of the vlhA gene family, and amplicons of 145-352 bp were generated from cultures of 10 different MG strains, including the ts-11, F and 6/85 vaccine strains. High-resolution melting (HRM) curve analysis of the resultant amplicons could differentiate all MG strains. Analysis of the nucleotide sequences of the amplicons from each strain revealed that each melting curve profile related to a unique DNA sequence. The HRM curve profiles (for ts-11) remained consistent after at least five passages under laboratory conditions. PCR-HRM curve analysis of 33 DNA extracts derived from respiratory swabs, or mycoplasma cultures grown from respiratory swabs, of ts-11-vaccinated commercial or specific pathogen-free chickens identified all these specimens, according to their sequences, as ts-11. The potential of the PCR-HRM curve analysis was also shown in the genotyping of 30 additional MG isolates from Europe, the USA and Israel. The results presented in this study indicate that PCR followed by HRM curve analysis provides a rapid and robust technique for genotyping of MG isolates/strains using both MG cultures and clinical swabs.

Quantitative and qualitative effects of bioaugmentation on ammonia oxidisers at a two-step WWTP

Large waste water treatment plants (WWTP) often operate nitrification in two different process environments: the cold-dilute sewage is treated in the mainstream nitrification/denitrification system, while the high strength ammonia liquors from sludge dewatering are treated in a separate high temperature reactor (SBR). This study investigates transfer from nitrifier biomass into a two-stage WWTP, commonly referred to as bioaugmentation. Besides the quantitation of ammonia oxidising bacteria (AOB), community differences were analysed with two techniques, denaturing gradient gel electrophoresis and real-time PCR melt curve analysis. It was shown that, without bioaugmentation, two distinct AOB communities establish in the mainstream and in the SBR, respectively. A gradual shift of the two AOB communities with increasing pump rates between the systems could be demonstrated. These molecular findings support process engineering experience, that cycling of waste activated sludge improves the ability of AOB to adapt to different process environments.

A quantitative real time PCR method to analyze T cell receptor Vβ subgroup expansion by staphylococcal superantigens

BackgroundStaphylococcal enterotoxins (SEs), SE-like (SEl) toxins, and toxic shock syndrome toxin-1 (TSST-1), produced by Staphylococcus aureus, belong to the subgroup of microbial superantigens (SAgs). SAgs induce clonal proliferation of T cells bearing specific variable regions of the T cell receptor β chain (Vβ). Quantitative real time PCR (qRT-PCR) has become widely accepted for rapid and reproducible mRNA quantification. Although the quantification of Vβ subgroups using qRT-PCR has been reported, qRT-PCR using both primers annealing to selected Vβ nucleotide sequences and SYBR Green I reporter has not been applied to assess Vβ-dependent expansion of T cells by SAgs.MethodsHuman peripheral blood mononuclear cells were stimulated with various SAgs or a monoclonal antibody specific to human CD3. Highly specific expansion of Vβ subgroups was assessed by qRT-PCR using SYBR Green I reporter and primers corresponding to selected Vβ nucleotide sequences.ResultsqRT-PCR specificities were confirmed by sequencing amplified PCR products and melting curve analysis. To assess qRT-PCR efficiencies, standard curves were generated for each primer set. The average slope and R2 of standard curves were -3.3764 ± 0.0245 and 0.99856 ± 0.000478, respectively, demonstrating that the qRT-PCR established in this study is highly efficient. With some exceptions, SAg Vβ specificities observed in this study were similar to those reported in previous studies.ConclusionsThe qRT-PCR method established in this study produced an accurate and reproducible assessment of Vβ-dependent expansion of human T cells by staphylococcal SAgs. This method could be a useful tool in the characterization T cell proliferation by newly discovered SAg and in the investigation of biological effects of SAgs linked to pathogenesis.

Variation in the human soluble epoxide hydrolase gene and risk of restenosis after percutaneous coronary intervention

BackgroundRestenosis represents the major limiting factor for the long-term efficacy of percutaneous coronary intervention (PCI). Several genetic factors involved in the regulation of the vascular system have been described to play a role in the pathogenesis of restenosis. We investigated whether the EPHX2 K55R polymorphism, previously linked to significantly higher risk for coronary heart disease (CHD), was associated with the occurrence of restenosis after PCI. The association with incident CHD should have been confirmed and a potential correlation of the EPHX2 K55R variant to an increased risk of hypertension was analysed.MethodsAn overall cohort of 706 patients was studied: This cohort comprised of 435 CHD patients who had undergone successful PCI. Follow-up coronary angiography in all patients was performed 6 months after intervention. Another 271 patients in whom CHD had been excluded by coronary angiography served as controls. From each patient EDTA-blood was drawn at the baseline ward round. Genomic DNA was extracted from these samples and genotyping was performed by real-time PCR and subsequent melting curve analysis.ResultsIn CHD patients 6 month follow-up coronary angiography revealed a restenosis rate of 29.4%, classified as late lumen loss as well as lumen re-narrowing ≥ 50%.Statistical analysis showed an equal genotype distribution in restenosis patients and non-restenosis patients (A/A 82.0% and A/G + G/G 18.0% versus A/A 82.1% and A/G + G/G 17.9%). Moreover, neither a significant difference in the genotype distribution of CHD patients and controls nor an association with increased risk of hypertension was found.ConclusionThe results of the present study indicate that the EPHX2 K55R polymorphism is not associated with restenosis after PCI, with incidence of CHD, or with an increased risk of hypertension and therefore, can not serve as a predictor for risk of CHD or restenosis after PCI.

Mutation scanning of exon 20 of the BRCA1 gene by high-resolution melting curve analysis

Objectives 5382insC frameshift mutation along with 5331G>A (G1738R) missense mutation, both found in exon 20 of the BRCA1 gene, are relatively frequent among the Greek breast and ovarian cancer population (46%). Our goal was to develop a novel, reliable and rapid genotyping/scanning method for mutation detection of the exon 20 of the BRCA1 gene, using high-resolution melting curve analysis. Design and methods The developed methodology was based on real-time PCR and high-resolution melting curve analysis in the presence of LCGreen I dye. Two amplicons on the exon 20 of BRCA1 gene were designed (157 bp and 100 bp), one flanking the exon's boundaries, and one embracing the 5382insC mutation. Our methodology was first optimized and validated by using genomic DNA samples with the 5382insC and 5331G>A (G1738R) mutations and wild-type. In total, the developed methodology was applied on 90 peripheral blood and 127 formalin-fixed paraffin-embedded breast tissue samples. Results Sensitivity studies with gDNA isolated from peripheral blood showed that mutated DNA could be reliably detected in the presence of wild-type DNA at 5% and 0.5% ratio with the larger and the smaller amplicon, respectively. By using the developed methodology we successfully identified 5382insC, 5331G>A and 5370C>T (R1751X) mutations, in genomic DNA isolated from peripheral blood samples and 5382insC mutation in two breast tumors, as verified by DNA sequencing. Conclusions The combination of real-time PCR and high-resolution melting curve analysis provides a cost-efficient, simple and rapid approach to successfully scan exon 20 of BRCA1 gene for these clinically important and frequent mutations.