Plasmid pBI121 Research Articles

Co-overexpression of chitinase and β-1,3-glucanase significantly enhanced the resistance of Iranian wheat cultivars to Fusarium

Fusarium head blight (FHB) is a devastating fungal disease affecting different cereals, particularly wheat, and poses a serious threat to global wheat production. Chitinases and β-glucanases are two important proteins involved in lysing fungal cell walls by targeting essential macromolecular components, including chitin and β-glucan micro fibrils. In our experiment, a transgenic wheat (Triticum aestivum) was generated by introducing chitinase and glucanase genes using Biolistic technique and Recombinant pBI121 plasmid (pBI-ChiGlu (-)). This plasmid contained chitinase and glucanase genes as well as nptII gene as a selectable marker. The expression of chitinase and glucanase was individually controlled by CaMV35S promoter and Nos terminator. Immature embryo explants from five Iranian cultivars (Arta, Moghan, Sisun, Gascogen and A-Line) were excised from seeds and cultured on callus induction medium to generate embryonic calluses. Embryogenic calluses with light cream color and brittle texture were selected and bombarded using gold nanoparticles coated with the recombinant pBI-ChiGlu plasmid. Bombarded calluses initially were transferred to selective callus induction medium, and later, they were transfferd to selective regeneration medium. The selective agent was kanamycin at a concentration of 25 mg/l in both media. Among five studied cultivars, A-Line showed the highest transformation percentage (4.8%), followed by the Sisun, Gascogen and Arta in descending order. PCR and Southern blot analysis confirmed the integration of genes into the genome of wheat cultivars. Furthermore, in an in-vitro assay, the growth of Fusarium graminearum was significantly inhibited by using 200 μg of leaf protein extract from transgenic plants. According to our results, the transgenic plants (T1) showed the resistance against Fusarium when were compared to the non-transgenic plants. All transgenic plants showed normal fertility and no abnormal response was observed in their growth and development.

Simplified Method for Agrobacterium-Mediated Genetic Transformation of Populus x berolinensis K. Koch.

The rapid advancement of genetic technologies has made it possible to modify various plants through both genetic transformation and gene editing techniques. Poplar, with its rapid in vitro growth and regeneration enabling high rates of micropropagation, has emerged as a model system for the genetic transformation of woody plants. In this study, Populus × berolinensis K. Koch. (Berlin poplar) was chosen as the model organism due to its narrow leaves and spindle-shaped crown, which make it highly suitable for in vitro manipulations. Various protocols for the Agrobacterium-mediated transformation of poplar species have been developed to date. However, the genetic transformation procedures are often constrained by the complexity of the nutrient media used for plant regeneration and growth, which could potentially be simplified. Our study presents a cheaper, simplified, and relatively fast protocol for the Agrobacterium-mediated transformation of Berlin poplar. The protocol involved using internode sections without axillary buds as explants, which were co-cultivated in 10 µL droplets of bacterial suspension directly on the surface of a solid agar-based medium without rinsing and sterile paper drying after inoculation. We used only one regeneration Murashige and Skoogbased medium supplemented with BA (0.2 mg·L-1), TDZ (0.02 mg·L-1), and NAA (0.01 mg·L-1). Acetosyringone was not used as an induction agent for vir genes during the genetic transformation. Applying our protocol and using the binary plasmid pBI121 carrying the nptII selective and uidA reporter genes, we obtained the six transgenic lines of poplar. Transgenesis was confirmed through a PCR-based screening of kanamycin-selected regenerants for the presence of both mentioned genes, Sanger sequencing, and tests for detecting the maintained activity of both genes. The transformation efficiency, considering the 100 explants taken originally, was 6%.

​​An Agrobacterium rhizogenes Strain R1000-mediated Efficient Hairy Root Transformation Protocol for Common Bean

Background: Common bean (Phaseolus vulgaris L.) is a globally important grain and vegetable legume crop, providing a substantial portion of the diet protein and minerals for many people in the developing world. However, the genetic studies and improvement on this crop has long been impeded by its recalcitrance to Agrobacterium-mediated whole plant genetic transformation. Established Agrobacterium rhizogenes-based hairy root transformation in common bean heavily relies on the strain K599. Methods: In order to develop an efficient alternative protocol for hair transformation in common bean, the efficiency of Agrobacterium rhizogenes strain R1000 in inducing hairy roots from 6-day-old seedlings with root below cotyledons excised by the soaking and smearing method were tested. The binary plasmid pBI121 with the reporter gene GUS (pBI121-GUS) or eGFP (pBI121-eGFP) driven by the constitutive promoter was used for transformation and rapid identification of the transgenic hairy roots. Result: We established a strain R1000-based system for the induction of hairy roots in common bean. The plant receptor genotypes and infection methods were optimized, which led to a high transformation rate of hairy roots up to 60%. This method therefore provides a useful alternative means for functional genomic studies in common bean.

Purslane (Portulaca oleracea L.) as a novel green-bioreactor for expression of human serum albumin (HSA) gene.

Transgenic plants showed high potential to become a valuable and safe source of bio-compounds that can be used as therapeutics without any require for pooled human blood products. Human serum albumin (HSA) is one of the best-selling pharmaceuticals in the world because it is utilized for treating several acute illnesses, including hypovolemia, burns, and hemorrhage. This work was aimed to investigate the production of recombinant HSA (rHSA) protein in a plant-based expression platform. For this, we used in-planta and tissue culture-based Agrobacterium-mediated transformation (TCBAT) procedures to insert HSA gene into purslane (Portulaca oleracea L.) genome. The purslane seeds and leaves were infected with A. tumefaciens strain LBA4404 containing the HSA gene on pBI121 plasmid, and then regenerated into transgenic plant on MS medium. The qRT-PCR, southern hybridization, western blotting, and ELISA analysis were accomplished to corroborate the insertion and expression of HSA gene in transgenic plantlets. The molecular asses indicated that HSA gene was successfully transferred and expressed in purslane plants using in-planta and TCBAT methods. The first attempt to express rHSA in purslane resulted in a low-level accumulation of the protein in the transgenic plant shoots. Therefore, we used a synthetic 5'UTR (synJ) to enhance HSA transcript stability and translation efficiency. The results suggested that the synJ caused pronounced enhancement of rHSA expression rate. The highest amount of rHSA protein was recorded in transgenic purslane generated by TCBAT method (33.92 ± 4.31µg/g FW).

Immunological evaluation of recombinant chimeric construct from Enterotoxigenic E. coli expressed in hairy roots

Enterotoxigenic Escherichia coli is the most important bacterial agent causing traveller’s diarrhea in developing countries. Enterotoxins (LT & ST) and colonization factors (CFs) are two important factors in the ETEC pathogenesis. In the present study, a recombinant four-part fusion protein containing CFAB*ST, CFAE, and LTB (CCL) was expressed in hairy roots of Nicotiana tabacum. The synthetic gene sequence and gene order were designed based on bioinformatics analysis that predicted the best arrangement for antigenicity and stimulation of the immune response. Codon usage was optimized for expression in tobacco plant, under the control of promoter CaMV35S in plasmid pBI121. CCL was efficiently expressed in tobacco hairy roots to yield 1.11% soluble protein as determined by quantitative ELISA and Western blot. In this study, mice were immunized with purified CCL via the oral and subcutaneous route. Humoral immunity especially mucosal immunity with antigen specific IgG and IgA detected in serum and feces. The ability of CCL to elicit neutralizing antibodies was evaluated in the rabbit ileal loop model, using anti-CCL antibodies derived from immunized mice, and co-incubated with ETEC strains. A decrease in fluid accumulation in the intestinal lumen of rabbit ileal loops challenged with ETEC LT and ST positive strains, correlated with the presence of anti-CCL antibodies capable of toxin neutralization. The ability of these antibodies to neutralize toxin confirmed the recognition of epitopes, either linear or conformational, displayed by the recombinant chimeric protein expressed in transgenic tobacco hairy roots. Transgenic plants containing multivalent immunogenic vaccine candidates have the potential to be used for immunization with protection against gastrointestinal pathogens like ETEC.

Agrobacterium-Mediated Genetic Transformation of Embryogenic Callus in a Liriodendron Hybrid (L. Chinense × L. Tulipifera).

A highly efficient genetic transformation system of Liriodendron hybrid embryogenic calli through Agrobacterium-mediated genetic transformation was established and optimized. The Agrobacterium tumefaciens strain EHA105, harboring the plasmid pBI121, which contained the ß-glucuronidase (GUS) gene and neomycin phosphotransferase II (npt II) gene under the control of the CaMV35S promoter, was used for transformation. Embryogenic calli were used as the starting explant to study several factors affecting the Agrobacterium-mediated genetic transformation of the Liriodendron hybrid, including the effects of various media, selection by different Geneticin (G418) concentrations, pre-culture period, Agrobacterium optical density, infection duration, co-cultivation period, and delayed selection. Transformed embryogenic calli were obtained through selection on medium containing 90 mg L−1 G418. Plant regeneration was achieved and selected via somatic embryogenesis on medium containing 15 mg L−1 G418. The optimal conditions included a pre-culture time of 2 days, a co-culture time of 3 days, an optimal infection time of 10 min, and a delayed selection time of 7 days. These conditions, combined with an OD600 value of 0.6, remarkably enhanced the transformation rate. The results of GUS chemical tissue staining, polymerase chain reaction (PCR), and southern blot analysis demonstrated that the GUS gene was successfully expressed and integrated into the Liriodendron hybrid genome. A transformation efficiency of 60.7% was achieved for the regenerated callus clumps. Transgenic plantlets were obtained in 5 months, and the PCR analysis showed that 97.5% of plants from the tested G418-resistant lines were PCR positive. The study of the Liriodendron hybrid reported here will facilitate the insertion of functional genes into the Liriodendron hybrid via Agrobacterium-mediated transformation.

Establishment of efficient callus genetic transformation system for Pyrus armeniacaefolia

The purpose of the present study was to establish an efficient and stable callus genetic transformation system for Pyrus armeniacaefolia. Fruits 15 days after flowering were used for callus inducing. Major factors that influence growth state of callus (concentrations of plant growth regulators, subculture cycle) and transformation (Agrobacterium tumefaciens concentration, infection time, co-culture time, AS and kanamycin concentrations) were examined. The results showed that the optimum mediums for callus induction was MS supplemented with 3.0 mgL−1 2,4-Dichlorophenoxyacetic acid (2, 4-D) and 0.5 mgL−1 6-Benzylaminopurine (6-BA). The appropriate proliferation medium was MS containing 2.5 mgL−1 2,4-D and 0.5 mgL−1 6-BA with 21 d subculture cycle. Transformation was successfully achieved using the following protocol: callus were soaked in A. tumefaciens strain EHA105 (OD600 = 0.8) harboring pBI121 plasmid for 15 min. After 3 d co-culture on proliferation medium supplemented with 20 mgL−1 AS, the callus were then screened on the selection medium (proliferation medium containing 25 mgL−1 kanamycin and 200 mgL−1 cefotaxime) to select the resistant callus. The GUS-positive rate was 96%. And the GUS-positive callus were further identification at DNA and transcription levels. We believe that the present study provides technical support for functional researches on fruit quality related genes.

Analysis of MeEf1A6 Gene Promoter Activity with In-vitro and In-vivo using Transient and Stable Expression Techniques in Tobacco Plant (Nicotiana tabacum)

The promoter is a part of the gene that functions in carrying out the gene expression, and its work activity becomes a matter of concern to ensure that expression works effectively. MeEF1A6 (Manihot esculenta Elongation Factor 1 Alfa - 6) is a promoter derived from cassava plants (Manihot esculenta). In previous studies, the MeEF1A6 promoter was successfully isolated, introduced, and characterized into the pBI121 plasmid, replacing the CaMV35S promoter. This study aims to analyze the activity of MeEF1A6 promoters in-vivo and in-vitro by using transient and transgenic techniques in tobacco plants. The pBI121 plasmid containing the MeEF1A6 promoter was introduced into Agrobacterium tumefaciens strain AGL1 and LBA4404. The promoter's work was then analyzed by the result of introducing it into the tobacco plant using the transient and stable transformation. The whole part of explants was used for transient study and tested in a minimum of two biological replicates. Sixty sheets of explant leaves that have been cut were used for stable transformation. The promoter work analysis was carried out with the GUS gene expression that integrated with the promoter with histochemical GUS assay. The transient produced a blue color in the roots, stems, and leaves on the whole repetition. The transverse incision in the stem shows the blue color on the epidermis and procambium tissue. Stable transformation using AGL1 as vector produced 43 shoots from 40 calli. A total of 43 shoots were selected with antibiotics and produced 27 plantlets that were successfully grown. Some plantlets are then reacted with x-gluc as histochemical GUS assay substrat and produced a blue color in the explants, indicating that the MeEF1A6 promoter has been successfully introduced. The results indicate that the MeEF1A6 promoter could work on plant tissue in roots, stems, leaves, and tissues that connect meristems such as procambium in tobacco plants. This reinforces the suspicion that the MeEF1A6 promoter performs work constitutionally as a constitutive promoter.

Transient expression of fusion and hemagglutinin-neuraminidase epitopes of Newcastle disease virus in maize as a potent candidate vaccine.

PurposeNewcastle disease (ND) represents a major viral disease across the world which imposes high costs to poultry producers for vaccination. Hemagglutinin-neuraminidase (HN) and fusion (F) proteins are the major immunogenic epitopes of Newcastle disease virus and hence, have been the main targets for development of anti-ND vaccines. This paper reports transient expression of a synthetic gene composing of four tandem repeats of HN and three tandem repeats of F epitopes in maize leaves as initial step toward production of recombinant vaccine against ND.Materials and MethodsThe synthetic gene was cloned in pBI121 plasmid to yield an expression vector. The vector was sophisticated by the addition of AUG codon, polyhistidine-tag, tobacco mosaic virus omega sequence, stop codon, and restriction sites. Leaf transformation was conducted by the agroinfiltration method. Molecular detection assays including polymerase chain reaction, reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay (ELISA) were carried out to evaluate transgene expression in infiltrated leaves of the corn plant.ResultsThe result obtained in this research revealed that the transgene was transcribed and translated in maize leaves only 48 hours after infiltration. In the second phase of the experiment, the expressed protein was injected into rabbits. The result of the ELISA assay indicated induction of immune response in the rabbits after injection with the heterologous protein.ConclusionThese results confirm the feasibility of agroinfiltration for transient gene expression of viral epitopes in monocot plants which naturally resist stable transformation by Agrobacterium tumefaciens. Practical implications of this finding are discussed in detail and some recommendations for future studies are proposed.

Agrobacterium-mediated transformation of Persian walnut using BADH gene for salt and drought tolerance

ABSTRACT Transgenic walnuts (Juglans regia L.) were produced in the presence of the Agrobacterium strain LBA4404 and the plasmid pBI121. This plasmid contains a BADH gene driven by a CaMV 35S promoter. It further includes an NPTII gene as a selectable marker which, in turn, is driven by a NOS promoter. Somatic embryos of the walnut cultivar ‘Chandler’ were inoculated using an Agrobacterium suspension. Secondary embryos that developed on a selection medium were driven towards germination so as to develop micro-shoot cultures. The regeneration rate was 5.5%. PCRand southern blot analysis were used for confirming that the BADH transgene is successfully integrated into the plant genome. Transgenic and wild-type plants raised from somatic embryos were exposed to four osmotic stress levels (i.e. 0%, 2%, 4%, and 8% PEG) and four salinity levels (i.e. 0, 50, 100, and 200 mM NaCl). After 21 days, the transgenic plants grew almost vigorously in saline and drought-stress conditions, whereas the wild-type ones showed retarded levels of growth and did not survive after the cradle stage. These results show that the BADH gene can be expressed effectively in transgenic plantlets of walnut and can be used for breeding walnuts against drought and salinity.

Creating a tobacco line with a weaker antifeedant property against colorado potato beetle

Background . Genetic modification of plants is one of the promising strategies to increase their resistance to insect pests. The development of metabolic or RNA interference systems for plant protection requires appropriate models of host-insect interactions. Nicotiana tabacum L. is a classical model plant used in molecular and metabolic engineering. We consider tobacco as a model for developing protective strategies against Colorado potato beetle ( Leptinotarsa decemlineata Say, CPB). Normally, tobacco is toxic for CPB due to high content of nicotine and related alkaloids in leaves. Modification of the tobacco genome could provide tobacco genotypes with altered metabolism suitable for CPB feeding. It is known that different mutations in Berberine Bridge-Like (BBL) genes cause different alterations in tobacco leaf alkaloid levels. In the current study, the Cas9/gRNA system targeting members of the BBL gene family of tobacco was used to create a line which can serve as a diet for CPB. Results . In order to obtain tobacco with modified alkaloid content, two gRNAs matching target sequences in six BBL genes were selected. Each gRNA was cloned into a gRNA/Cas9 generic vector. The created constructs were mixed and used for biolistic transformation of tobacco leaf explants together with the pBI121 plasmid harboring the kanamycin resistance gene nptII and the reporter E.coli betaglucuronidase (GUS) gene. Regenerants were selected on 100 mg/l of kanamycin and checked for transgene presence by histochemical GUS-assay. Unexpectedly, the regenerated plants displayed a variety of adverse phenotypic effects including different degree of growth and rooting inhibition, early flowering, increased number of internodes, changes in leaf shape, fusion of flowers, longostyly, and partial sterility. Only one from seven obtained calli produced a population of regenerated plants without severe phenotypic abnormalities. The NtaBBL5-14 line of clonally propagated plants was selected from this population and used for a CPB feeding experiment. It was shown that CPB larvae consume the leaves of NtaBBL5-14 line ten times more efficiently than the leaves of control plants (97±0.5% vs. 9±3% in 24 h respectively). Conclusion . The NtaBBL5-14 tobacco line is suitable for CPB feeding and can be further used as a model for studies in plant-pest interaction. The modification of other genes regulating nicotine metabolism can be a promising strategy to obtain tobacco plants edible for CPB with less pleiotropic effects.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

In vitro Regeneration and Agrobacterium-mediated Genetic Transformation of Local Varieties of Mungbean (Vigna radiata (L). Wilczek)

An efficient Agrobacterium-mediated transformation compatible in vitro regeneration protocol was developed for two important varieties of mungbean (Vigna radiata (L.) Wilczek) cultivated in Bangladesh, namely Binamoog-5 and BARI Mung-6. Two different zygotic embryo derived explants, such as cotyledonary node (CN) and cotyledon attached decapitated embryo (CADE) were used for direct organogenesis of shoot. MS supplemented with 4.0 μM BAP was found to be the best for the development of highest number of multiple shoots from CADE in both the varieties of mungbean. While in case CN the best shoot formation was achieved on MS containing 4.0 μM BAP and 0.5 μM NAA in both varieties. Half strength of MS with 2.0 μM IBA was found to be most effective for producing healthy root from regenerated shoots. Following root induction, the in vitro raised plantlets were successfully transplanted to soil for their establishment. Considering overall responses, genetic transformation efficiency was found to be better with CADE explant using Agrobacterium tumefaciens strain LBA4404 harboring the binary plasmid pBI121 conferring GUS and nptII genes. Different factors influencing transformation was optimized during this study. Selection of transformed shoots was carried out by gradually increasing the concentration of kanamycin and such transformed shoots were eventually selected using 200 mg/l kanamycin. Stable expression of the GUS gene was detected in various parts of regenerated transformed plantlets. Transformed shoots were rooted on half strength MS containing 2.0 μM IBA and 100 mg/l ticarcillin. Rooted transformed plantlets were successfully transferred to soil. Stable integration of GUS and nptII genes in the putative transformed shoots was confirmed through PCR analysis.
 Plant Tissue Cult. & Biotech. 29(1): 81-97, 2019 (June)

Isolation and characterization of a novel seed-specific promoter from peanut (Arachis hypogaea L.).

Peanut, whose seeds are ideal bioreactors for the production of recombinant proteins and/or nutrient metabolites, is one of the most important crop species worldwide. As important molecular tools, seed-specific promoters (SSPs) can direct the expression of foreign proteins specifically in seeds to avoid constitutive expression that can damage plants. However, few SSPs have been identified from this species. In this study, we isolated a novel SSP (we named it AHSSP2) from peanut. Several cis-acting elements commonly found in SSPs, including 3 copies of RYREPEAT elements, were dispersed throughout the 1970-bp sequence of AHSSP2. The sequence was then substituted in place of the 35S promoter sequence in a pBI121 plasmid, which was subsequently transformed into Arabidopsis. Beta-glucuronidase (GUS) staining showed that AHSSP2 can drive GUS gene expression in the mature seeds of transgenic Arabidopsis, excluding within the testa. The cotyledons and hypocotyls of the germinating seeds of transgenic Arabidopsis seedlings also exhibited GUS activity, even after the seedlings became adult plants. No GUS activity was detected in nontransformed Arabidopsis at any stage. These results strongly suggested that AHSSP2 could drive the expression of foreign genes in a seed-specific manner. This study enriched SSP resources, and the results showed that AHSSP2 could be potentially utilized in peanut and other crop species to improve seed quality, such as modifications to seed oil content.

Study of different factors affecting Agrobacterium- mediated genetic transformation in lentil (Lens culinaris Medik.)

The present work was aimed to study the various factors affecting Agrobacterium tumefaciens mediated genetic transformation of three BARI masur variety of lentil (Lens culinaris Medik.), namely, BM-4, BM-5 and BM-6. Agrobacterium strain LBA4404 containing plasmid pBI121 which carrying gus and nptII as screenable and selectable marker genes, respectively, was used for transformation. Factors affecting transformation efficiency, such as, type of explants, bacterial density, incubation time and co-cultivation period were studied. The result showed that decapitated embryo (DE) explants of BM-6 variety of lentil inoculated in Agrobacterium suspensions at density of 1.0 (OD600) for 45 minutes and co-cultivated on MS medium with hormones in the dark for 3 days gave the highest transient expression of gus gene (86.90%). The lowest percentage (15.00%) of GUS +ve explants observed in cotyledonary node (CN) of BM-5 variety of lentil when they were inoculated in Agrobacterium suspensions at density of 0.5 (OD600) for 15 minutes. Using this protocol agronomical and economically important trait could be transfer to the locally grown lentil varieties.

Over Expression of p5cs Gene to Increase Cold Stress Tolerance in Iranian Species of Petunia

In order to examine the relationship between proline and cold stress in Iranian (local) genotype of petunia, p5cs gene was transferred to petunia through Agrobacterium-mediated transformation. The leaf discs from four weeks and shoot apices from 7-day-old petunia in vitro plants were co-cultivated with Agrobacterium strain LBA4404 harboring a plasmid pBI121 as the vector system for transformation of petunia. pBI121 plasmid containing β-glucuronidase (gus) gene as a reporter gene and Δ1-pyrroline-5-carboxylate synthetase (p5cs) gene and neomycin phosphotransferase (nptII) gene were used as a selectable marker. The co-cultivated leaf discs and shoot apices were transferred to the selective medium and thereafter to proliferation medium respectively. To confirm transformation, regenerated plants were subjected to the polymerase chain reaction (PCR), GUS histochemical and proline assays. The results confirmed the presence of the gus and p5cs gene in the genome of all transformants and the transformed plants were more tolerant (674.87 μg/g fresh leaves) than the wild types under stress conditions.Plant Tissue Cult. & Biotech. 28(1): 35-44, 2018 (June)

Gene transfer utilizing pollen-tubes of Albuca nelsonii and Tulbaghia violacea

Abstract Developing a tissue culture-independent genetic transformation system would be an interesting technique for gene transfer in valuable medicinal and horticultural plants. Efficient gene delivery (Agrobacterium tumefaciens strain LBA 4404: harbouring PBI121 plasmid) was achieved with Km-resistant pollen grains (pollen tube technique) and were found to be GUS-positive for Albuca nelsonii (31.3%) and Tulbaghia violacea (32.6%). The Km-resistance (95.6% for A. nelsonii and 86.7% for T. violacea) and GUS-positive (100% for A. nelsonii and 97.5% for T. violacea) putative transgenic seedlings in vitro were obtained with 200 mg L-1 Km. The in vitro plants were obtained from leaf explants of putative transgenic seedlings and were confirmed to be Km-resistant and GUS-positive (T. violacea, 73.7% and A. nelsonii, 80.5%). The plants were successfully acclimatized in the greenhouse. We describe a tissue culture-independent gene transfer technique with high efficiency clonal transgenic plant production for A. nelsonii and T. violacea. This can also be applied to biotechnological crop improvement of the same species and potentially to other plants.

AGROBACTERIUM-MEDIATED TRANSFORMATION OF TOMATO (LYCOPERSICON ESCULENTUM Mill.) USING A SYNTHETIC Cry1Ab GENE FOR ENHANCED RESISTANCE AGAINST TUTA ABSOLUTA (Meyrick)

The effect of different plant hormones on in vitro regeneration of tomato (Lycopersicon esculentum Mill.) two cultivars Castle Rock and Super strain B, obtained from hypocotyls and cotyledons of cultured in vitro seedlings was examined. The optimal concentrations of plant growth regulators were the MS medium containing 3 mg L-1 of zeatin and 0.1 mg L-1 of NAA of cotyledon and hypocotyl explants of Super strain B cultivar. While, the best regeneration medium was the MS medium containing 1 mg L-1 ZEA, 0.5 mg L-1 BAP and 0.1 mg L-1 IAA of cotyledon and hypocotyl explants of Castle Rock cultivar. Agrobacterium‐mediated genetic transformation system has been expanded of tomato cultivar Super strain B. Transformation efficiency of hypocotyl explants was studied with Agrobacterium tumefaciens strain GV3101 harboring binary vector pICBV19, containing gus and bar genes. Transformed tomato shoots were obtained from hypocotyls explants on MS medium contained with 3 mg L-1 ZEA and 0.1 mg L-1 NAA. The gene expression of gus and bar genes was tested in the putatively transformed tomato plantlets through GUS histochemical and leaf painting assays. The plasmid pBI121 containing an insect resistance gene (cry1Ab) and kanamycin gene (nptII) as a plant selectable marker were introduced into these explants. Putatively transformed plantlets were examined by PCR and southern blot analysis. The expression of cry1Ab gene was tested through insect bioassay. For insect bioassay, experiments were conducted to determine the mortality percentage of Cry1Ab toxin protein against Tuta absoluta (Meyrick). The results indicated that Cry1Ab toxin protein expressed in transformed tomato plants showed 100% instars larval mortality was obtained after feeding for 4–5 days.

Transcriptional properties of eight synthetic pathogen-inducible promoters in transgenic Arabidopsis thaliana

Synthetic pathogen-inducible promoters (SPIP) hold a great promise to meet the demands for a desired temporal and spatial regulation of transgenes. Four pathogen-inducible cis-elements (F-box, S-box, Gst1-box, and W-box) and the minimal cauliflower mosaic virus 35S (CaMV 35S) promoter (-46 to +8 TATA box) were used to design SPIP. Eight SPIP were synthesized and named FSGW, FSWG, GWFS, GWSF, SFGW, SFWG, WGFS, and WGSF according to the order of cis-element dimers. They were used to replace the CaMV 35S promoter in the plasmid pBI121 to control expression of the β-glucuronidase (gus) gene. The transcriptional properties of each SPIP were evaluated in homozygous T3 lines of transgenic Arabidopsis thaliana by histochemical staining gus expression and real time quantitative PCR. FSGW and FSWG had a very low basal level and a poor inducibility. The other six SPIP showed different levels of background and inducibility. Using Ralstonia solanacearum, the spores of Phytophthora capsici, and salicylic acid as inducing factors, GWSF showed the advantages of a low basal expression, rapid response, and efficient transcriptional activity in the rosette leaves of five-week-old plants. The results indicate that the permutation and combination of the cis-elements had important effects on transcriptional activities of SPIP. Synthetic pathogen-inducible promoters like GWSF are valuable because it can potentially be further improved to apply to plant genetic engineering for disease resistance.

Agrobacterium?mediated Genetic Transformation of Two Varieties of Brassica juncea (L.) Using Marker Genes

Protocol for Agrobacterium?mediated genetic transformation using hypocotyl and cotyledonary leaf with petiole from two local varieties of Brassica juncea was established by optimizing various factors influencing transformation. GUS histochemical assay revealed that the cotyledonary leaf with petiole and hypocotyl explants had positive interaction with the Agrobacterium strain LBA4404 containing the binary plasmid pBI121 which has marker genes like, GUS and nptII. Maximum transformation was obtained with bacterial suspension having an optical density of 0.8 at 600 nm, 30 min of incubation and 72 hours of co?cultivation. The transient and stable integration of the marker genes were confirmed through histochemical GUS assay, as well as PCR analysis.Plant Tissue Cult. & Biotech. 26(1): 55-65, 2016 (June)