Alzheimer's Disease Pathogenesis Research Articles

Microglial cGAS Deletion Preserves Intercellular Communication and Alleviates Amyloid-β-Induced Pathogenesis of Alzheimer's Disease.

Innate immune activation plays a crucial role in the pathogenesis of Alzheimer's disease (AD) and related dementias (ADRD). The cytosolic DNA sensing pathway, involving cGAMP synthase (cGAS) and Stimulator of Interferon Genes (STING), has emerged as a key mediator of neurodegenerative diseases. However, the precise mechanisms through which cGAS activation influences AD progression remain poorly understood. In this study, we observed significant up-regulation of cGAS-STING signaling pathway in AD. Notably, this increase is primarily attributed to microglia, rather than non-microglial cell types. Using an inducible, microglia-specific cGAS knockout mouse model in the 5xFAD background, we demonstrated that deleting microglial cGAS at the onset of amyloid-β (Aβ) pathology profoundly restricts plaque accumulation and protects mice from Aβ-induced cognitive impairment. Mechanistically, our study revealed cGAS promotes plaque-associated microglia accumulation and is essential for inflammasome activation. Moreover, we showed that restricting cGAS-mediated innate immunity is crucial for preserving inter-cellular communication in the brain and induces pleiotrophin, a neuroprotective factor. These findings offer novel insights into the specific roles of the innate immune system in AD employing a cell-type-specific approach. Theconclusions provide a foundation for targeted interventions to modulate the microglial cGAS-STING signaling pathway, offering promising therapeutic strategy for AD treatment.

Sex-specific influences of APOEε4 genotype on hippocampal neurogenesis and progenitor cells in middle-aged rats

Alzheimer's disease (AD) disproportionately and uniquely affects females, and these sex differences are further exacerbated by the presence of Apolipoprotein (APOE) ε4 alleles, the top genetic risk factor for late-onset AD. To expand our understanding about how late-onset AD risk might differentially influence males and females, this study explores how APOEε4 affects hippocampal neurogenesis and microglia, key neuroplastic markers involved in AD pathogenesis, differently by sex in middle-aged rats. A rat model expressing the humanized (h) APOEε4 allele was characterized to examine markers of adult neurogenesis (neural progenitor cells and new-born neurons) and immune cells (microglia) in the dentate gyrus of the hippocampus in 13 month-old male and female rats. We observed basal sex differences in neurogenesis at middle age, as wildtype male rats had greater densities of neural progenitor cells and new-born neurons in the dentate gyrus than wildtype female rats. Male hAPOEε4 rats exhibited fewer neural progenitor cells, fewer new-born neurons, and more microglia than male wildtype rats. On the other hand, female hAPOEε4 rats exhibited more new-born neurons than female wildtype rats. Interestingly, females had more microglia than males regardless of genotype. Correlations were conducted to further elucidate any sex differences in the relationships between these biomarkers. Notably, there was a significant positive correlation between neural progenitor cells and new-born neurons, and a significant negative correlation between new-born neurons and microglia, but only in male rats. In contrast to the clear pattern of effects of the hAPOEε4 risk factor on hippocampal neurogenesis in males, females had unaltered levels of neural progenitor cells and increased density of new-born neurons. Furthermore, relationships between neurogenesis and microglia were significantly correlated within males, and not females. This suggests that females may be presenting a compensatory response to the hAPOEε4 genotype at middle age. Collectively, these results exemplify the importance of thoroughly examining influences of sex on AD endophenotypes, as it may reveal sex-specific pathways and protective mechanisms relevant to AD.

Long Non-Coding RNAs: Crucial Regulators in Alzheimer's Disease Pathogenesis and Prospects for Precision Medicine.

Long non-coding RNAs (LncRNAs) have emerged as pivotal regulators in the pathogenesis of Alzheimer's disease (AD), a progressive neurodegenerative disorder characterized by cognitive decline and memory loss. With the capacity to modulate gene expression at various levels, LncRNAs are implicated in multiple pathological mechanisms of AD, including amyloid-beta (Aβ) accumulation, tau protein phosphorylation, neuroinflammation, and neuronal apoptosis. Recent studies have highlighted the potential of LncRNAs as diagnostic biomarkers and therapeutic targets due to their differential expression patterns in AD patients. This review synthesizes current knowledge on the role of LncRNAs in AD, focusing on their involvement in key molecular pathways and their promise as indicators for early diagnosis and prognosis. We discuss the regulatory networks of LncRNAs in the context of AD, their interaction with miRNAs, and the implications for developing novel therapeutic strategies. Despite the complexity and variability in LncRNA function, the prospect of harnessing these molecules for precision medicine in AD is gaining momentum. The translational potential of LncRNA-based interventions offers a new frontier in the quest for effective treatments and a deeper understanding of the molecular underpinnings of AD.

Porphyromonas gingivalis Induces Disturbance of Kynurenine Metabolism Through the Gut-Brain Axis: Implications for Alzheimer's Disease.

Porphyromonas gingivalis is one of the major pathogens of chronic periodontitis. P. gingivalis can cause systemic inflammation, amyloid β protein deposition, and hyperphosphorylation of tau protein, leading to Alzheimer's disease (AD)-like lesions. P. gingivalis oral infection causes gut microbiota alteration, gut barrier dysfunction, and intestinal immune response and inflammation. The microbiota-gut-brain axis has a potential role in the pathogenesis of AD. Whether P. gingivalis affects AD-like lesions via the gut-brain axis needs more study. In this study, orally administered P. gingivalis induced alveolar resorption, intestinal barrier impairment, and AD-like lesions. Oral infection with P. gingivalis induced oral and gut microflora dysbiosis, imbalance of the tryptophan metabolism pathway of gut microbiota, and elevated levels of 3-hydroxykynurenine in the sera and hippocampi. The key metabolite, 3-hydroxykynurenine, suppressed Bcl2 gene expression, leading to neuronal apoptosis and promoting AD-like lesions in vivo and in vitro. These findings suggest that P. gingivalis can induce AD pathogenesis through the gut-brain axis, providing new ideas for the prevention and treatment of AD.

The impact of rare genetic variants on Alzheimer disease.

Alzheimer disease (AD) is a progressive neurodegenerative disease with a strong genetic component. Although autosomal dominant mutations and common risk variants in AD risk have been extensively studied, the genetic underpinning of polygenic AD remains incompletely understood. Rare variants could elucidate part of the missing heritability in AD. Rare variant research gained momentum with the discovery of a rare variant in TREM2, along with loss-of-function variants in ABCA7 and SORL1, and has come into full bloom in recent years. Not only has the number of rare variant discoveries increased through large-scale whole-exome and genome sequencing studies, improved imputation in genome-wide association studies and increased focus on understudied populations, the number of studies mapping the functional effects of several of these rare variants has alsosignificantly increased, leading to insights in the pathogenesis of AD and drug development. Here we provide a comprehensive overview of the known and novel rare variants implicated in AD risk, highlighting how they shine new light on AD pathophysiology and provide new inroads for drug development. We will review their impact on individual, familial and population levels, and discuss the potential and challenges of rare variants in genetic risk prediction.

Amyloid-β and heart failure in Alzheimer’s disease: the new vistas

Alzheimer’s disease (AD) is the most common cause of dementia and represents 75% of all dementia types. AD neuropathology is due to the progressive deposition of extracellular amyloid-beta (Aβ) peptide and intracellular hyperphosphorylated tau protein. The accumulated Aβ forms amyloid plaques, while the hyperphosphorylated tau protein forms neurofibrillary tangles (NFTs). Both amyloid plaques and NFTs are hallmarks of AD neuropathology. The fundamental mechanism involved in the pathogenesis of AD is still elusive, although Aβ is the more conceivable theory. Aβ-induced neurodegeneration and associated neuroinflammation, oxidative stress, endoplasmic reticulum stress (ER), and mitochondrial dysfunction contribute to the development of cognitive impairment and dementia. Of note, Aβ is not only originated from the brain but also produced peripherally and, via the blood–brain barrier (BBB), can accumulate in the brain and result in the development of AD. It has been shown that cardiometabolic conditions such as obesity, type 2 diabetes (T2D), and heart failure (HF) are regarded as possible risk factors for the development of AD and other types of dementia, such as vascular dementia. HF-induced chronic cerebral hypoperfusion, oxidative stress, and inflammation can induce the development and progression of AD. Interestingly, AD is regarded as a systemic disease that causes systemic inflammation and oxidative stress, which in turn affects peripheral organs, including the heart. Aβ through deranged BBB can be transported into the systemic circulation from the brain and accumulated in the heart, leading to the development of HF. These findings suggest a close relationship between AD and HF. However, the exact mechanism of AD-induced HF is not fully elucidated. Therefore, this review aims to discuss the link between AD and the risk of HF regarding the potential role of Aβ in the pathogenesis of HF.

Sex differences in the neuroinflammatory signaling pathway: effect of miRNAs on fatty acid synthesis in microglia

BackgroundSignificant sex differences exist in the prevalence and incidence of Alzheimer’s disease (AD). Notably, testosterone has been reported to regulate cognitive functions in the brain, with low serum testosterone levels correlating with increased AD risk. However, the specific mechanisms underlying this relationship remain unclear. Recent studies have demonstrated that microglia, the primary innate immune cells in the brain, play a crucial role in AD development. Therefore, this study aimed to explore sex differences in microglial function, specifically focusing on the role of testosterone in miRNA-mediated regulation of microglial gene expression.MethodsMicroglia were isolated from pooled hippocampal tissue of five 8-month-old male and female mice. Total RNA was extracted and subjected to miRNA microarray analysis. The mouse microglial cell line MG6 was used for in vitro experiments. Following testosterone treatment, miRNA, gene, and protein expression levels were investigated. An inflammatory response was induced using lipopolysaccharide (LPS) stimulation, and subsequent p65 phosphorylation was assessed.ResultsSex-dependent differences were observed in miRNA-mediated biological processes, with males exhibiting greater changes. Male-enriched miRNAs were associated with fatty acid synthesis and metabolism pathways. In MG6 cells, testosterone treatment upregulated the expression of several miRNAs enriched in male microglia, particularly those targeting genes related to fatty acid synthesis. Additionally, testosterone significantly reduced the gene expression of fatty acid synthase (FASN). This testosterone-induced inhibition of FASN expression attenuated NF-κB/p65 phosphorylation. Consequently, the suppression of FASN expression led to reduced expression and secretion of tumor necrosis factor-alpha following LPS stimulation in MG6 cells.ConclusionsThese findings suggest that testosterone modulates inflammation in male microglia by regulating fatty acid synthesis, potentially contributing to the observed sex differences in AD pathogenesis.

Ultrasensitive and Selective Nitrogen-Doped Fluorescent Carbon Dots Probe for Quantification Analysis of Trace Cu2+ in the Aqueous Environment.

As a typical non-ferrous metal, copper is heavily used in the manufacturing and chemical industries. Copper pollution has been demonstrated to have a significant detrimental impact on the natural environment, as well as causing irreparable damage to the human body, such as elevated Cu2+ levels have been identified as a factor in the pathogenesis of AD (Alzheimer's disease). In this study, novel nanoscale carbon dots Blue-CDs (B-CDs) were obtained by the solvothermal approach in formamide solution utilizing citric acid as the carbon source and ethylenediamine as the nitrogen dopant. The particle size of B-CD was assessed to be 2.17nm, with a quantum yield (QY) of 10.28%. The B-CDs were found to be extinguished upon exposure to Cu2+, which exhibited a good fluorescence detection linear relationship within the concentration range of 0.25-10.0 µM Cu2+, showing a limit of detection (LOD) is 0.18 µM. B-CDs have been effectively used for the measurement of Cu2+ in actual aqueous systems. It is due to the chemical reactions that take place among the B-CDs and the Cu²⁺ that make the sensor highly sensitivities and highly selectivities. The results of the experiment demonstrate that the fluorescence quenching process is a consequence of Cu2+ binding to the amino groups of carbon dots, forming complexes via a non-radiative photoinduced electron transfer process. In conclusion, the described simple sensing techniques could be effectively utilized as monitoring tools for Cu2+ in environmental waters.

Contributions of Genetic Variation in Astrocytes to Cell and Molecular Mechanisms of Risk and Resilience to Late-Onset Alzheimer's Disease.

Reactive astrocytes are associated with Alzheimer's disease (AD), and several AD genetic risk variants are associated with genes highly expressed in astrocytes. However, the contribution of genetic risk within astrocytes to cellular processes relevant to the pathogenesis of AD remains ill-defined. Here, we present a resource for studying AD genetic risk in astrocytes using a large collection of induced pluripotent stem cell (iPSC) lines from deeply phenotyped individuals with a range of neuropathological and cognitive outcomes. IPSC lines from 44 individuals were differentiated into astrocytes followed by unbiased molecular profiling using RNA sequencing and tandem mass tag-mass spectrometry. We demonstrate the utility of this resource in examining gene- and pathway-level associations with clinical and neuropathological traits, as well as in analyzing genetic risk and resilience factors through parallel analyses of iPSC-astrocytes and brain tissue from the same individuals. Our analyses reveal that genes and pathways altered in iPSC-derived astrocytes from individuals with AD are concordantly dysregulated in AD brain tissue. This includes increased levels of prefoldin proteins, extracellular matrix factors, COPI-mediated trafficking components and reduced levels of proteins involved in cellular respiration and fatty acid oxidation. Additionally, iPSC-derived astrocytes from individuals resilient to high AD neuropathology show elevated basal levels of interferon response proteins and increased secretion of interferon gamma. Correspondingly, higher polygenic risk scores for AD are associated with lower levels of interferon response proteins in astrocytes. This study establishes an experimental system that integrates genetic information with a matched iPSC lines and brain tissue data from a large cohort of individuals to identify genetic contributions to molecular pathways affecting AD risk and resilience.

Microglial polarization in Alzheimer's disease: Mechanisms, implications, and therapeutic opportunities.

Alzheimer's disease (AD) is a neurodegenerative disorder characterized by the accumulation of amyloid-β plaques, neurofibrillary tangles, and chronic neuroinflammation. Microglial cells, the resident immune cells in the central nervous system, play a crucial role in the pathogenesis of AD. Microglia can undergo polarization, shifting between pro-inflammatory (M1) and anti-inflammatory (M2) phenotypes in response to different stimuli. Dysregulation of microglial polarization towards the pro-inflammatory phenotype leads to the release of inflammatory cytokines, oxidative stress, and synaptic dysfunction. These processes contribute to neuronal damage and cognitive decline in AD. However, several challenges remain in this field. The complex molecular mechanisms governing microglial polarization in AD need to be further elucidated. In this review, we discuss the mechanisms underlying microglial polarization in AD and its implications in disease progression.

Alzheimer's disease: assessing the therapeutic potential of anti-Aβ (Beta-Amyloid) treatments.

One of the most common forms of dementia and a neurodegenerative illness is Alzheimer's disease (AD), which is distinguished by impaired memory and cognitive dysfunction. Decades of research have been devoted to determining its etiology, pathogenic processes, and biomarkers to facilitate early identification and clinical investigations for therapy. Neural atrophy and broken connections between neurons are the outcomes of the illness. The amyloid beta (Aβ) cascade is among the most widely recognized and important hypotheses of the numerous hypotheses regarding the pathogenesis of AD. This theory suggests that the breakdown of the amyloid precursor protein (APP) produces Aβ monomers. These monomers are then converted into hazardous oligomers, which in turn form β-sheets, fibrils, and plaques after being formed. The amyloid cascade theory was covered in this review, along with a summary of how it is used to diagnose and treat Alzheimer's. Specifically, we covered the drawbacks, potential, and significant unsolved issues with the anti-Aβ therapy that is now in use, as well as plans for more research and the creation of more workable Aβ-targeted methods to optimize AD early detection and management.

C/EBPβ in Alzheimer's Disease: An Integrative Regulator of Pathological Mechanisms.

Alzheimer's disease (AD) stands as one of the most prevalent neurodegenerative disorders, characterized by a progressive decline in cognitive function, neuroinflammation, amyloid-beta (Aβ) plaques, and neurofibrillary tangles (NFTs). With the global aging population, the incidence of AD continues to rise, yet current therapeutic strategies remain limited in their ability to significantly alleviate cognitive impairments. Therefore, a deeper understanding of the molecular mechanisms underlying AD is imperative for the development of more effective treatments. In recent years, the transcription factor C/EBPβ has emerged as a pivotal regulator in several pathological processes of AD, including neuroinflammation, lipid metabolism, Aβ processing, and tau phosphorylation. Through intricate post-translational modifications, C/EBPβ modulates these processes and may influence the progression of AD on multiple fronts. This review systematically explores the multifaceted roles of C/EBPβ in the pathogenesis of AD, delving into its crucial involvement in neuroinflammation, Aβ production, tau pathology, and lipid metabolism dysregulation. Furthermore, we critically assess therapeutic strategies targeting C/EBPβ, examining the challenges and opportunities in regulating this factor. By synthesizing the latest research findings, we offer a more comprehensive understanding of the role of C/EBPβ in AD and discuss its potential as a therapeutic intervention target.

Cuproptosis and copper as potential mechanisms and intervention targets in Alzheimer's disease.

Recently study has found a new form of copper-dependent death called cuproptosis, which differs from apoptosis, ferroptosis, and necrosis. The main process of cuproptosis is copper directly combined with lipid-acetylated proteins in the TCA cycle of mitochondrial response, leading to the aggregation of lipid-acetylated proteins and the loss of Fe-S cluster proteins, resulting in mitochondrial dysfunction, and eventually causing cell death. Previous studies demonstrated that an imbalance in copper homeostasis exacerbates the pathological progression of Alzheimer's disease (AD) through the induction of oxidative stress, inflammatory response, and the accumulation of Aβ deposition and tau protein hyperphosphorylation. However, the underlying mechanisms remains to be elucidated. More importantly, research identifies the role of cuproptosis and further elucidates the underlying molecular mechanisms in AD. This review summarized the effects of copper metabolism on AD pathology, the characteristics and mechanism of cuproptosis and we discuss the significance of cuproptosis in the pathogenesis of AD.

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

Circular RNA circ_0061183 regulates microglial polarization induced by airborne ultrafine particles in HMC3 cells via sponging miR-98-5p

Airborne ultrafine particulate matter (PM0.1) can enter the brain, induce microglia activation, and promote the development of Alzheimer’s disease (AD). Circular RNAs (circRNAs) are also involved in AD pathogenesis. However, the role of AD-related circRNAs in PM0.1-induced microglia activation remains unclear. Therefore, we explore cytotoxicity, microglia activation, and AD-associated circRNA expression in human microglial HMC3 cells treated with PM0.1, and further examined circRNA expression in mice and cognitively impaired individuals. The results revealed that PM0.1 exposure decreased cell viability, increased lactate dehydrogenase activity, caused microglia activation, elevated microglial M1 maker expression, downregulated microglial M2 maker expression, and reduced AD-related circ_0061183 expression in vitro. Functionally, circ_0061183 silencing enhanced microglia activation and microglial M1 polarization, but inhibited microglial M2 polarization. Mechanistically, circ_0061183 can bind to miR-98-5p to co-regulate M2 microglial-related IL10 expression, which may affect transforming growth factor-β signaling to regulate PM0.1-inhibited microglial M2 polarization. Moreover, circ_0061183 downregulation was observed in the brain of PM2.5-exposed mice and AD mice and in the blood of cognitively impaired individuals. Furthermore, circ_0061183 was positively related to mini–mental state examination scores and amyloid-β42 peptide expression in elderly individuals. Overall, the current work offers epigenetic insights into the regulatory mechanisms of circRNAs on microglial activation caused by environmental pollutants.

Abstract TP393: Reducing Neutrophil Sialic Acid Residues Alleviates Cerebral Hypoperfusion in Alzheimer’s Models

Dysregulation of the immune system is a contributing factor in the progression of Alzheimer’s Disease (AD), likely by increased vascular inflammation triggered by brain or peripheral inflammation. Our research has demonstrated that neutrophils play a role in causing hypoperfusion by adhering to and obstructing blood vessels, as seen in both mouse models for and patients with AD. Notably, protein glycosylation of membrane proteins is essential for regulating the adhesion properties of neutrophils to immune cells and the vasculature. Here, we utilize lectin blots to show that sialic acid residues, which are the terminal caps of glycosylation chains, are increased on neutrophil membrane proteins from an amyloidosis Alzheimer’s mouse model. Furthermore, we evaluated the efficacy of the sialyltransferase inhibitor alpha 2,3 sialyltransferase-IN-1 by lectin blot analyses, identifying it to be an effective compound for removing sialic acid from neutrophil membrane proteins. Notably, we performed in vivo multiphoton imaging of cerebral blood flow and capillary stalling in AD mice injected with alpha 2,3 sialyltransferase-IN-1. Our findings demonstrated that reducing sialic acid residues on neutrophils improved cerebral blood flow and capillary stalling. This work suggests that the altered glycosylation pattern, specifically aberrant sialylation residues of neutrophil glycoproteins, are a significant contributing factor to the hypoperfusion observed in AD mouse models and patients. Modulating the glycosylation profile may present a potential therapeutic approach for improving the vascular dysfunction associated with AD pathogenesis.

Distinct disruptions in CA1 and CA3 place cell function in Alzheimer's disease mice.

The hippocampus, a critical brain structure for spatial learning and memory, is susceptible to neurodegenerative disorders such as Alzheimer's disease (AD). Utilizing APPswe/PSEN1dE9 (APP/PS1) mice, we investigated neurophysiological mechanisms underlying AD-associated cognitive impairments by assessing place cell activities in CA1 and CA3 hippocampal subregions, which have distinct yet complementary computational roles. Analyses revealed significant deterioration in spatial representation capabilities of APP/PS1 relative to wild-type (WT) mice. Specifically, CA1 place cells exhibited reduction in coherence and spatial information, while CA3 place cells displayed reduction in place field size. Place cells in both subregions showed disruption in stability and burst firing properties. Furthermore, theta rhythm was significantly attenuated in CA1 place cells of APP/PS1 mice. These findings elucidate that distinct physiological perturbations in CA1 and CA3 place cells, coupled with disrupted hippocampal theta rhythmicity in CA1, potentially orchestrate the impairment of hippocampal-dependent spatial learning and memory in AD pathogenesis.

Missense mutations of the ephrin receptor EPHA1 associated with Alzheimer's disease disrupt receptor signaling functions.

Missense mutations in the EPHA1 receptor tyrosine kinase have been identified in Alzheimer's patients. To gain insight into their potential role in disease pathogenesis, we investigated the effects of four of these mutations. We show that the P460L mutation in the second fibronectin type III (FN2) domain drastically reduces EPHA1 cell surface localization while increasing tyrosine phosphorylation of the cell surface-localized receptor. The R791H mutation in the kinase domain abolishes EPHA1 tyrosine phosphorylation, indicating abrogation of kinase-dependent signaling. Furthermore, both mutations decrease EPHA1 phosphorylation on S906 in the kinase-SAM linker region, suggesting impairment of a noncanonical form of signaling regulated by serine/threonine kinases. The R492Q mutation, also in the FN2 domain, has milder effects than the P460L mutation while the R926C mutation in the SAM domain increases S906 phosphorylation. We also found that EPHA1 undergoes constitutive proteolytic cleavage in the FN2 domain, generating a soluble 55kDaN-terminal fragment containing the ligand-binding domain and a transmembrane 60kDaC-terminal fragment. The 60kDa WT fragment is phosphorylated on both tyrosine residues and S906, suggesting signaling functions. The P460L mutant 60kDa fragment undergoes proteasomal degradation and the R791H mutant fragment lacks tyrosine phosphorylation and has decreased S906 phosphorylation. These findings advance our understanding of EPHA1 signaling mechanisms and support the notion that alterations in EPHA1 signaling due to missense mutations contribute to Alzheimer's disease pathogenesis.

NLRP3-mediated glutaminolysis controls microglial phagocytosis to promote Alzheimer's disease progression.

Activation of the NLRP3 inflammasome has been implicated in the pathogenesis of Alzheimer's disease (AD) via the release of IL-1β and ASC specks. However, whether NLRP3 is involved in pathways beyond this remained unknown. Here, we found that Aβ deposition invivo directly triggered NLRP3 activation in APP/PS1 mice, which model many features of AD. Loss of NLRP3 increased glutamine- and glutamate-related metabolism and increased expression of microglial Slc1a3, which was associated with enhanced mitochondrial and metabolic activity. The generation of α-ketoglutarate during this process impacted cellular function, including increased clearance of Aβ peptides as well as epigenetic and gene transcription changes. This pathway was conserved between murine and human cells. Critically, we could mimic this effect pharmacologically using NLRP3-specific inhibitors, but only with chronic NLRP3 inhibition. Together, these data demonstrate an additional role for NLRP3, where it can modulate mitochondrial and metabolic function, with important downstream consequences for the progression of AD.

Gut microbiota in Alzheimer's disease: Understanding molecular pathways and potential therapeutic perspectives.

Accumulating evidence suggests that gut microbiota (GM) plays a crucial role in Alzheimer's disease (AD) pathogenesis and progression. This narrative review explores the complex interplay between GM, the immune system, and the central nervous system in AD. We discuss mechanisms through which GM dysbiosis can compromise intestinal barrier integrity, enabling pro-inflammatory molecules and metabolites to enter systemic circulation and the brain, potentially contributing to AD hallmarks. Additionally, we examine other pathophysiological mechanisms by which GM may influence AD risk, including the production of short-chain fatty acids, secondary bile acids, and tryptophan metabolites. The role of the vagus nerve in gut-brain communication is also addressed. We highlight potential therapeutic implications of targeting GM in AD, focusing on antibiotics, probiotics, prebiotics, postbiotics, phytochemicals, and fecal microbiota transplantation. While preclinical studies showed promise, clinical evidence remains limited and inconsistent. We critically assess clinical trials, emphasizing challenges in translating GM-based therapies to AD patients. The reviewed evidence underscores the need for further research to elucidate precise molecular mechanisms linking GM to AD and determine whether GM dysbiosis is a contributing factor or consequence of AD pathology. Future studies should focus on large-scale clinical trials to validate GM-based interventions' efficacy and safety in AD.