Partial Genome Sequences Research Articles

Pharmacognosy, phytochemistry, and molecular studies of an important medicinal herb Achillea millefolium L.

Achillea millefolium L. is traditionally important medicinal herb used for the treatment of various ailments from the centuries. Recent studies showed its biological activities on hay fever, hepato-biliary disorders, and as appetite enhancing drug. It is also reported to be used for the treatments of skin inflammations, wounds, cuts, and abrasions. To investigate preliminary pharmacognostical, phytochemical, and molecular parameters of aerial parts of the drug. A. millefolium was identified and collected from the Himalaya region. The material is properly dried, macro-and microscopic evaluation, phytochemical and molecular studies as per the standard quality control and WHO guidelines. The leaves are pinnately lobed, inflorescence compound corymbose. Nonglandular trichomes are uni-seriate, multicellular, and smooth walled; glandular trichomes are bicellular, present throughout the aerial parts. The endodermis is evident in the stem and leaf mesophyll is equifacial. The partial genome sequence analysis showed similarity toward studied species, which can clearly distinguish it from other species of the genus Achillea. The best chromatographic separation was observed with ascentis express C18, 2.7 μm, 100 mm × 4.6 mm. The flavonoids and phenolic acids have shown maximum absorbance at 330 nm. The system suitability parameters such as theoretical plate, tailing factor, and resolution met the acceptance criteria with United States pharmacopeia (USP). The findings of this study will be helpful for the precise identification of the raw drug of A. millefolium from its closely allied species.

Genetic Heterogeneity among Chicken Infectious Anemia Viruses Detected in Italian Fowl.

Simple SummaryChicken infectious anemia virus (CIAV) is an immunosuppressive pathogen of chickens. In the present study field, vaccine-derived CIAV strains were reported to circulate in different types of chicken flocks. Viruses were successfully obtained from non-invasive samples such as feathers and environmental dust. Genome analysis showed that strains had heterogeneous sequences clustered into different genogroups that possessed genetic markers reported to be correlated with CIAV virulence. This survey contributes to the knowledge of field CIAV distribution maps and increases the existing information available on native isolates around the world.Chicken infectious anemia virus (CIAV) is a pathogen of chickens associated with immunosuppression and with a disease named chicken infectious anemia. The present survey reports an epidemiological study on CIAV distribution in Italian broiler, broiler breeder and backyard chicken flocks. Twenty-five strains were detected by a specifically developed nested PCR protocol, and molecularly characterized by partial VP1 gene or complete genome sequencing. Viral DNA amplification was successfully obtained from non-invasive samples such as feathers and environmental dust. Sequence and phylogenetic analysis showed the circulation of field or potentially vaccine-derived strains with heterogeneous sequences clustered into genogroups II, IIIa, and IIIb. Marker genome positions, reported to be correlated with CIAV virulence, were evaluated in field strains. In conclusion, this is the first survey focused on the molecular characteristics of Italian CIAVs, which have proved to be highly heterogeneous, implementing at the same time a distribution map of field viruses worldwide.

Molecular characterization of recombinant Bipartite begomovirus associated with mosaic and leaf curl disease of Cucumber and Muskmelon

Muskmelon and cucumber are important vegetables grown in different parts of India. Leaf curl and mosaic diseases caused by begomovirus are economically important on these crops. Survey during 2012–2015 to assess the incidence of both leaf curl and mosaic in Mirzapur and Varanasi Districts of Eastern Uttar Pradesh, India revealed incidence of leaf curl up to 30–40% and mosaic disease up to 50–60% in both the crops. Totally, 103 leaf samples of muskmelon (58) and cucumber (45) were collected from the plants showing viral disease symptoms. These samples were tested for infection by different viruses using DAC-ELISA and PCR. A total of ten samples reacted for CGMMV, nine for PRSV-W, 25 for GBNV, 21 for CMV, 7 for ZYMV and 21 for DNA virus. Together, ELISA and PCR detected mixed infection of RNA viruses (CGMMV, CMV, PRSV-W and GBNV) and DNA virus in different combination in ten samples. The partial DNA virus genome (1.2 kb fragment) sequencing performed on samples indicated possible infection by a known bipartite begomovirus (Tomato leaf curl Palampur virus, ToLCPalV) in 21 samples. Therefore, one sample each from muskmelon (Mm-1) and cucumber (Cb-1) were used for full-length genome amplification of begomovirus genome using RCA method. Sequencing of the full-length viral genome (DNA A) and subsequent analysis using SDT program revealed that Mm-1 and Cb-1 isolates share a nucleotide (nt) identity of 90.4–92.2% and 95.9–99.1%, respectively with ToLCPalV infecting tomato and cucurbits. Similarly, analysis of full-length DNA B of Mm-1 and Cb-1 isolates indicated that they shared genome identity of 88.4–94.0% with tomato infecting ToLCPalV. Further, recombination breakpoint analysis of the viral genome indicated the recombinant nature of the virus isolates. The significance of ToLCPalV strains/variants as an emerging threat in the production of cucurbits in India is discussed.

Revisiting Orthotospovirus phylogeny using full-genome data and testing the contribution of selection, recombination and segment reassortment in the origin of members of new species.

The family Tospoviridae of the order Bunyavirales is constituted of tri-segmented negative-sense single-stranded RNA viruses that infect plants and are also able to replicate in their insect vectors in a persistent manner. The family is composed of a single genus, Orthotospovirus, whose type species is Tomato spotted wilt orthotospovirus. Previous studies assessing the phylogenetic relationships within this genus were based on partial genomic sequences, resulting in unresolved clades and a poor assessment of the roles of recombination and segment reassortment during mixed infections. Full genome sequences of members of recognized Orthotospovirus species are now available at NCBI. In this study, we examined 67 complete genome sequences from members of 22 species. Our study confirms the existence of four phylogroups (A to D), grouped in two major clades (A-B and C-D) within the genus. We found strong evidence that within-segment recombination events and reassortment of segments during mixed infections have been involved in the origin of new orthotospoviruses. Also, selection pressures were analyzed for each gene, and evidence of positive selection was found in all genes.

Update on Senecavirus A research: Epidemiology of infection, evolution of the virus and its oncolytic activity

Senecavirus A (SVA), formerly known as Seneca valley virus (SVV) (20), is a critical pathogen causing vesicular lesions in pigs and acute death of newborn piglets, resulting in very large economic losses in the pig industry. The aim of this paper was to present the current knowledge about the epidemiology and evolution of Senecavirus A, as well as the role of the virus in oncolytic therapy. From 1988 to 2005, a number of virus isolates were sporadically recovered from pigs in various regions of the United States, but without a detailed description of the clinical signs. After 2014, a sudden increase in SVA outbreaks appeared outside the United States and Canada, and SVA infection was reported in more regions of the United States, in Brazil, China, Colombia, Thailand and Vietnam with extensive distribution. After the expansion of the SVA area, complete and partial SVA genomic sequences were determined from SVA strains in most of these regions. Therefore, advances were also possible in the molecular epidemiology of the virus. A certain genetic distance has been determined between SVA strains isolated in various countries and at different times, suggesting a constant and rapid evolvement of SVA. It was shown that a combination of evolutionary processes, such as multiple mutations at variable sites and purifying selection, drove the genetic diversity and evolution of SVA. Evolutionary changes that accumulated in the SVA genome over the years may have contributed to the increased incidence of the disease. SVA is the first oncolytic picornavirus to be tested in humans and to penetrate solid tumours through the vascular system, unlike many other oncolytic viruses. SVA has a potential cytolytic activity and high selectivity for tumour cell lines with neuroendocrine properties versus adult normal cells

The Partial Chloroplast Genome of <i>Hypericum monogynum</i> L. (Guttiferae)

Hypericum monogynum L. is an important medicinal and ornamental plant which belongs to the genus Hypericum in the Guttiferae family. The partial chloroplast genome sequence of H. monogynum has been presented in this study. The assembled partial chloroplast genome (cpDNA) was 120,005 bp in size, with an overall 36.96% GC content. It is 70 genes that are included in the chloroplast genome of Hypericum monogynum in this study, which are consisted of 33 protein-coding genes, 30 transfer RNA genes, as well as 7 ribosomal RNA genes. Phylogenetic analysis with the reported chloroplast genomes revealed that Hypericum monogynum is separated to other species in Guttiferae family, and it might well function as an external group of Guttiferae family.

Identification of Cucumber mosaic virus from Arisaema heterophyllum Blume in China.

Arisaema heterophyllum Blume is a valuable medicinal plant in the Araceae family. The dried tuber of A. heterophyllum is used in the traditional Chinese medicine, Rhizoma Arisaematis, which is used to treat convulsions, inflammation and cancer. In 2017, typical mosaic virus-like symptoms were observed in A. heterophyllum in Jilin province, China. To further identify the pathogens, we conducted RT-PCR using virus- and genus-specific primers to amplify partial genome sequences of Cucumber mosaic virus (CMV), Tobamovirus and Potyvirus, respectively. The CMV primers showed specific amplification, but the Tobamovirus and Potyvirus primers did not. We further cloned and sequenced the 2b, MP and CP genes of the CMV-Ah isolate. Phylogenetic analysis showed the CMV-Ah isolate belonged to subgroup IB. To our knowledge, this is the first report of CMV infecting A. heterophyllum in China. Keywords: Cucumber mosaic virus; Arisaema heterophyllum Blume; subgroup IB; phylogenetic analysis.

The presence of Apicomplexan parasites in king scallops (Pecten maximus) in Scottish waters

The king scallop (Pecten maximus) is a commercially important species found around the United Kingdom coast. The association of an Apicomplexan-like parasite with mass mortality of Icelandic scallop (Chlamys islandica) in Iceland and the presence of identical parasites in king scallop (Pecten maximus) and queen scallop (Aequipecten opercularis) in Scotland raised serious concerns regarding the health of Scottish king scallops. Marine Scotland Science (MSS) conducted a survey in 2016 to assess the prevalence and the intensity of parasite infection in king scallops. King scallops were collected and sampled during the annual scallop dredge surveys in the Shetland Isles and the east and west coast of Scotland. The king scallop adductor muscle was macroscopically examined and tissue imprints taken to grade the intensity of infection. The parasite was present in the majority of the king scallops sampled in all surveyed areas: Shetland Isles 87.1%, east coast 76.0% and west coast of Scotland 64.1%. However, the parasitic infestations were light in intensity with the majority of the king scallops graded as 1 (≤20 zoites per microscopic field). No macroscopic changes in the adductor muscle were observed and histopathology examination revealed minor localized fiber degeneration of adjacent fibers to parasite clusters. The results suggested the parasite to be widespread around the Scottish coast and it appears to be able to live within the king scallop at low intensity of infection without causing significant downgrade of the adductor muscle (in terms of colour or texture) or mortality. The partial genome sequence of the parasite in king scallops from Scottish waters was identical to the one reported by Kristmundsson and Freeman (2018) in the Icelandic scallop in Icelandic waters.

Genetic Analysis of Cachavirus-Related Parvoviruses Detected in Pet Cats: The First Report From China

In this study, members of the Carnivore chaphamaparvovirus species 1, closely related to a virus previously reported in dog feces named cachavirus was identified for the first time in feces of Chinese cats. Screening tests using rectal swabs from 171 diarrheic and 378 healthy cats collected from Henan, Anhui, and Zhejiang provinces in China revealed two samples from diarrheic cats that were positive for cachavirus, but statistical analysis indicated no association between the presence of the virus and clinical signs (p > 0.05). Subsequently, two partial genome sequences [from nucleotides 479–4123, according to the strains from dogs (cachavirus)] of the two strains from cats (cachavirus-cat1 and -cat2) were amplified. The NS1 and VP1 sites of cachavirus-cat1 and -cat2 shared a high identity of 91.9 and 97.0% with reported cachaviruses, respectively, but lower identity of 74.8 and 73.2% with another carnivore chaphamaparvovirus named fechaviruses detected in cats, respectively, indicated the two strains might origin from dogs. These findings improve our understanding of the diversity and tropism of viruses in Carnivore chaphamaparvovirus species 1 which now include both dogs and now cats viruses.

Genomic and phylodynamic analysis of sapoviruses isolated in Henan Province, China.

In this study, we determined the near-complete and partial genome sequences of ten SaV isolates. Phylogenetic analysis based on full-length VP1 and RdRp nucleotide sequences indicated that nine isolates were of GI.1 and one was GII.3. Evolutionary dynamics analysis indicated that GI.1 and GII.3 SaVs evolved at different rates, the latter evolving more rapidly. Cluster analysis indicated that distantly related GI.1 SaVs were more similar in their amino acid compositions than were GII.3 SaVs. The data provided in this study may facilitate studies on SaV genomic diversity and epidemiological patterns in China and worldwide.

Genetic Analysis of African Swine Fever Virus From the 2018 Outbreak in South-Eastern Burundi.

African swine fever (ASF) is a contagious viral disease that causes high mortality, approaching 100%, in domestic pigs and wild boars. The disease has neither a cure nor a vaccine, and it is caused by an ASF virus (ASFV), the only member of the family Asfarviridae, genus Asfivirus, and the only known DNA arbovirus. Twenty-four genotypes of ASFV have been described to date, and all of them have been described in Africa. ASF is endemic in Burundi, and several outbreaks have been reported in the country; the disease continues to economically impact on small-scale farmers. This study aimed at genetic characterization of ASFV that caused an ASF outbreak in the Rutana region, Burundi, in the year 2018. Tissue samples from domestic pigs that died as a result of a severe hemorrhagic disease were collected in order to confirm the disease using polymerase chain reaction (PCR) and to conduct partial genome sequencing. Nucleotide sequences were obtained for the B646L (p72) gene, the intergenic fragment between the I73R and I329L genes, and the central variable region (CVR) of the B602L gene. Phylogenetic analysis of the Burundian 2018 ASFV grouped the virus within B646L (p72) genotype X and clustered together with those reported during the 1984 and 1990 outbreaks in Burundi with high nucleotide identity to some ASFV strains previously reported in neighboring East African countries, indicating a regional distribution of this ASFV genotype. Analysis of the intergenic fragment between I73R and I329L genes showed that the Burundian 2018 ASFV described in this study lacked a 32–base pair (bp) fragment present in the reference genotype X strain, Kenya 1950. In addition, the strain described in this study had the signature AAABNAABA at the CVR (B602L) gene and showed 100% amino acid sequence identity to viruses responsible for recent ASF outbreaks in the region. The virus described in this study showed high genetic similarities with ASFV strains previously described in domestic pigs, wild suids, and soft ticks in East African countries, indicating a possible common wild source and continuous circulation in domestic pigs in the region.

Mitochondrial Sequencing of Missing Persons DNA Casework by Implementing Thermo Fisher's Precision ID mtDNA Whole Genome Assay.

The advent of massively parallel sequencing (MPS) in the past decade has opened the doors to mitochondrial whole-genome sequencing. Mitochondrial (mt) DNA is used in forensics due to its high copy number per cell and maternal mode of inheritance. Consequently, we have implemented the Thermo Fisher Precision ID mtDNA Whole Genome panel coupled with the Ion Chef™ and Ion S5™ for MPS analysis in the California Department of Justice, Missing Persons DNA Program. Thirty-one mostly challenging samples (degraded, inhibited, low template, or mixed) were evaluated for this study. The majority of these samples generated single source full or partial genome sequences with MPS, providing information in cases where previously there was none. The quantitative and sensitive nature of MPS analysis was beneficial, but also led to detection of low-level contaminants. In addition, we found Precision ID to be more susceptible to inhibition than our legacy Sanger assay. Overall, the success rate (full single source hypervariable regions I and II (HVI/HVII) for Sanger and control region for MPS result) for these challenging samples increased from 32.3% with Sanger sequencing to 74.2% with the Precision ID assay. Considering the increase in success rate, the simple workflow and the higher discriminating potential of whole genome data, the Precision ID platform is a significant improvement for the CA Department of Justice Missing Persons DNA Program.

A PCR-based genetic sex identification method in spotted mandarin fish (Siniperca scherzeri) and big eye mandarin fish (Siniperca kneri)

Sex-specific markers are extremely important for unisexual breeding and understanding of sex determination mechanisms. Spotted mandarin fish (Siniperca scherzeri) and big eye mandarin fish (Siniperca kneri) are economically important freshwater fish in China. Here, for the first time, we successfully identified three male-specific markers in the two species. Through genome sequencing and bioinformatic analysis of three males, three females, one male mixed pool and one female mixed pool of spotted mandarin fish, we screened 27 potential male-specific sequences. After PCR validation, three male-specific markers were further identified. Moreover, these markers could also be used to identify genetic sex of spotted mandarin fish from different populations with 100 % accuracy. In addition, these markers were also successfully used in the identification of genetic sex of big eye mandarin fish. Notably, the sequences of male-specific markers were highly similar in the two species and the corresponding sequence of one marker was highly similar to partial genome sequence of amhy gene in mandarin fish (Siniperca chuatsi). In all, the verified male-specific markers suggested XY sex determination system existed in spotted mandarin fish and big eye mandarin fish and would play an important role in future work of sex control breeding.

Draft Genome Sequence of Streptomyces mexicanus Strain Q0842, Isolated from Human Skin.

In 2003, Streptomyces mexicanus was reported as a novel xylanolytic bacterial species isolated from soil; a partial genome sequence was determined. In 2019, a strain from the same species was isolated from a hand skin swab sample from a healthy French woman. Genome sequencing revealed an 8,011,832-bp sequence with a GC content of 72.5%.

First report of Ageratum latent virus in Veronica species and in New Zealand

A new strain of Ageratum latent virus (AGLV) was found in symptomless leaves of Veronica bollonsii, V. breviracemosa and V. dieffenbachii - the native shrubs in New Zealand. The partial genome sequence of the AGLV from V. bollonsii has 85.9–89.1% amino acid similarity to the Australian isolate AGLV-1998. This is the first record of the AGLV in Veronica species and in New Zealand.

Fecal, oral, blood and skin virome of laboratory rabbits.

Here, we investigated the fecal, oral, blood, and skin virome of 10 laboratory rabbits using a viral metagenomic method. In the oral samples, we detected a novel polyomavirus (RabPyV), and phylogenetic analysis based on the large T antigen, VP1 and VP2 regions indicated that the novel strain might have undergone a recombination event. Recombination analysis based on related genomes confirmed that RabPyV is a multiple recombinant between rodent-like and avian-like polyomaviruses. In fecal samples, three partial or complete genome sequences of viruses belonging to the families Picobirnaviridae, Parvoviridae, Microviridae and Coronaviridae were characterized, and phylogenetic trees were constructed based on the predicted amino acid sequences of viral proteins. This study increases the amount of genetic information on viruses present in laboratory rabbits.Electronic supplementary materialThe online version of this article (10.1007/s00705-020-04808-y) contains supplementary material, which is available to authorized users.

Structural and antigenic investigation of Usutu virus envelope protein domain III

The mosquito-borne flavivirus Usutu virus (USUV) has recently emerged in birds and humans in Europe. Symptoms of a USUV infection resemble those of West Nile virus (WNV); further, the close antigenic relationship of domain III (DIII) of the USUV and WNV envelope (E) proteins has prevented the development of a reliable serological test to distinguish USUV from WNV. To begin to address this deficiency, we identified ten different sequence groups of DIII from 253 complete and 80 partial USUV genome sequences. We solved the DIII structures of four groups, including that of the outlying CAR-1969 strain, which shows an atypical DIII structure. Structural comparisons of the USUV DIII groups and the DIII of WNV bound to the neutralizing antibody E16 revealed why the E16 failed to neutralize all USUV strains tested except for USUV CAR-1969. The analyses allowed predictions to be made to engineer an antibody specific for USUV CAR-1969.

First report of grapevine associated jivivirus 1 infecting grapevines in Brazil.

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5'GGACGAAGTCACAACCAACACAGTTT3') and R (5'CGCGAGTAGGTCTGACAACTTTCATTAT3'), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary.

Few amino acid signatures distinguish HIV-1 subtype B pandemic and non-pandemic strains.

The Human Immunodeficiency Virus Type I (HIV-1) subtype B comprises approximately 10% of all HIV infections in the world. The HIV-1 subtype B epidemic comprehends a pandemic variant (named BPANDEMIC) disseminated worldwide and non-pandemic variants (named BCAR) that are mostly restricted to the Caribbean. The goal of this work was the identification of amino acid signatures (AAs) characteristic to the BCAR and BPANDEMIC variants. To this end, we analyzed HIV-1 subtype B full-length (n = 486) and partial (n = 814) genomic sequences from the Americas classified within the BCAR and BPANDEMIC clades and reconstructed the sequences of their most recent common ancestors (MRCA). Analysis of contemporary HIV-1 sequences revealed 13 AAs between BCAR and BPANDEMIC variants (four on Gag, three on Pol, three on Rev, and one in Vif, Vpu, and Tat) of which only two (one on Gag and one on Pol) were traced to the MRCA. All AAs correspond to polymorphic sites located outside essential functional proteins domains, except the AAs in Tat. The absence of stringent AAs inherited from their ancestors between modern BCAR and BPANDEMIC variants support that ecological factors, rather than viral determinants, were the main driving force behind the successful spread of the BPANDEMIC strain.

Genetic profile of African swine fever virus responsible for the 2019 outbreak in northern Malawi

BackgroundAfrican swine fever (ASF) is an infectious transboundary animal disease which causes high mortality, approaching 100% in domestic pigs and it is currently considered as the most serious constraint to domestic pig industry and food security globally. Despite regular ASF outbreaks within Malawi, few studies have genetically characterized the causative ASF virus (ASFV). This study aimed at genetic characterization of ASFV responsible for the 2019 outbreak in northern Malawi. The disease confirmation was done by polymerase chain reaction (PCR) followed by molecular characterization of the causative ASFV by partial genome sequencing and phylogenetic reconstruction of the B646L (p72) gene, nucleotide alignment of the intergenic region (IGR) between I73R and I329L genes and translation of the central variable region (CVR) coded by B602L gene.ResultsAll thirteen samples collected during this study in Karonga district in September 2019 were ASFV-positive and after partial genome sequencing and phylogenetic reconstruction of the B646L (p72) gene, the viruses clustered into ASFV p72 genotype II. The viruses characterized in this study lacked a GAATATATAG fragment between the I173R and the I329L genes and were classified as IGR I variants. Furthermore, the tetrameric amino acid repeats within the CVR of the B602L gene of the 2019 Malawian ASFV reported in this study had the signature BNDBNDBNAA, 100% similar to ASFV responsible for the 2013 and 2017 ASF outbreaks in Zambia and Tanzania, respectively.ConclusionsThe results of this study confirm an ASF outbreak in Karonga district in northern Malawi in September 2019. The virus was closely related to other p72 genotype II ASFV that caused outbreaks in neighboring eastern and southern African countries, emphasizing the possible regional transboundary transmission of this ASFV genotype. These findings call for a concerted regional and international effort to control the spread of ASF in order to improve nutritional and food security.