Parthenium Plants Research Articles

Ant-treehopper mutualism affecting biocontrol of Parthenium hysterophorus by Mexican beetle, Zygogramma bicolorata Pallister

Infestation of a treehopper, Gargara malabarica Ananthasubramanian and Ananthakrishnan (Membracidae, Homoptera) on Parthenium hysterophorus L. and also a myrmicine ant, Lophomyrmex quadrispinosus (Jerdon) (Hymenoptera, Formicidae) tending these treehoppers is reported for the first time. The ant-treehopper association interferes with the biological control of P. hysterophorus by Mexican beetle, Zygogramma bicolorata Pallister (Coleoptera, Chrysomelidae). The Parthenium plants with ants supported significantly lesser number of grubs and adults of Mexican beetle compared to plants without ants. Mean number of Mexican beetle eggs was low on plants with ants, but it was non-significant. Further, the ants were observed to be disturbing the adult Mexican beetles from settling on the Parthenium plants, and this presumably led to the less Mexican beetle population.

Effectiveness of Zygogramma bicolorata Pallister (Coleoptera: Chrysomelidae) on Parthenium weed (Parthenium hysterophorus) under greenhouse condition in Ethiopia

Background Parthenium is an invasive annual weed that affects crop production, rangelands, grasslands, animals, the environment, and human health. Since its introduction into Ethiopia, different management options such as uprooting, slashing, burning, plowing, and applying synthetic herbicides have been practiced. However, these options are not sustainable in weed management. However, Zygogramma bicolorata is known to be used in different countries. Although many countries use it under field conditions, its population-based efficacy has not been well studied in Ethiopia. This study aimed to determine the effectiveness of Z. bicolorata populations on parthenium plants under greenhouse conditions. Methods This experiment was conducted at the Ambo Agricultural Research Center. Different numbers of Z. bicolorata per plant were used as treatments and were laid out in a completely randomized design with three replications. The numbers of damaged leaves, eggs, and larvae were recorded daily until the leaves were completely defoliated. The collected data and the correlation between beetle population and leaf defoliation were analyzed using SAS. Results The result revealed that all beetle populations caused damage to weed plants. A higher population of beetles completely defoliated the leaves within 12 days. However, lower numbers required 21 days to completely defoliate the weed. In contrast, a higher number of eggs (328.67) and larvae (272.33) were obtained from plants that received 20 pairs of beetles. The beetle population and exposure time were positively correlated, and the effectiveness of the bioagent was greater following the emergence of larvae. Conclusions Z. bicolorata can manage parthenium weeds, even with a lower population. However, more than 15 pairs of beetles could be suggested to manage weeds in a shorter time, and further study is needed under field conditions by considering the different agroecologies of the country.

PARTHENIUM PHYLLODY IN EASTERN UTTAR PRADESH INDIA: EPIDEMIOLOGY AND HOST RANGE OF PHYTOPLASMA WITHIN IMPORTANT CROPS CULTIVATED IN EASTERN UTTAR PRADESH, INDIA

Parthenium hysterophorus L. (family Asteraceae) is one of the 10 worst weeds in the world. This weed became the major invasive weed in both arable and grazing lands due to competitiveness and adaptability to different climates and soils. The natural occurrence of phyllody was noticed ~ 10-15% of Parthenium hysterophorus growing wildly along the roadside in Jaunpur, Azamgarh, Gorakhpur, and Varanasi districts of Uttar Pradesh, India, during summer 2010. To test whether Parthenium plants harbor phytoplasma, which may also infect important agricultural crop weeds and cultivated plants in Eastern U.P. India, phyllody symptoms were collected and assessed by polymerase chain reaction (PCR).

Role of Thrips palmi and Parthenium hysterophorus pollen in active spread of tobacco streak virus in the cotton ecosystem

Tobacco streak virus incidence in the cotton field, cv.CO14 at Department of Cotton, Tamil Nadu Agricultural University (TNAU), Coimbatore, India was nearly 36.50 %. Cotton plants infected with TSV exhibits different types of symptoms, including necrotic spots, lesions, mosaic, purplish necrotic rings, square drying, veinal necrosis and drying of terminal shoots. The highly prevalent thrips species in this cotton ecosystem was established as Thrips palmi (60.00 %) by morphological (ESEM) and molecular methods (RT-PCR using mtCOI primers). The density of the alternate weed host, Parthenium hysterophorus, was 15.05 plants per m2 in these fields. Association of Thrips palmi with Parthenium was confirmed, when observed under environmental scanning electron microscope (ESEM), Parthenium pollen grains (i.e., average size @ 15000X =12.94 μm) were found adhering to its body. Molecular studies through RT-PCR confirmed the presence of TSV in the leaves and pollen grains of symptomatic and symptom-free Parthenium plants collected from the cotton field (cv. CO14). Therefore, the combined role of Thrips palmi and the Parthenium pollen grains in the transmission of TSV was examined; acquiring of TSV and its presence in the body of Thrips palmi instars and adults after 72 h of AAP was convincingly demonstrated using RT-PCR, NASH and qPCR. However virus acquired thrips could not transmit the virus. Pollen from TSV infected Parthenium plants when dusted on cotton (ANKUR 2110) seedlings along with virus acquired or non-acquired thrips led to symptom development 22 days after sowing. From the study it is evident that thrips only facilitate the movement of TSV borne pollen grains, and thereby contributing to active spread of the virus.

First Report of Meloidogyne hapla and M. javanica Coinfection on Parthenium hysterophorus in Kenya

Parthenium hysterophorus L. (Asteraceae) is an annual or short-lived perennial herbaceous noxious weed native to North and South America. Parthenium has spread in Kenya and has become a menace to agriculture. Stunted and wilted Parthenium plants with globular galled roots marked with profuse roots were observed in a field in Tigoni, Kiambu County (average, 15.3°C; Koeppen-Geiger Climate Classification Cfb). Nematodes were extracted from root zone soil using the Baermann tray, and population densities of infective second-stage juveniles ranged from 300 to 980 individuals per 100 cm³ of soil. Mature females and their corresponding egg masses were handpicked from a single infected plant root. The posterior part of 20 adult Meloidogyne females was used for morphological analysis and the respective anterior part stored in ethanol for molecular analysis. Analysis of perineal patterns (Eisenback et al. 1980) revealed 13 (65%) Meloidogyne hapla and 7 (35%) M. javanica. To confirm pathogenicity, infection assays with one or two species were performed. Egg masses from pure cultures each containing 410 to 530 eggs were inoculated onto individual Parthenium plants growing in sterile soil in a greenhouse maintained at ∼25°C (average). For monoinfection two egg masses from one species and for coinfection one egg mass of each species were used. Fifteen plants per treatment were inoculated. At 45 days postinfection, the number of egg masses on Parthenium inoculated with M. hapla only was 129 ± 19.5 per root system, whereas M. hapla + M. javanica coinoculation was 188 ± 23.6. On plants inoculated with M. javanica only, no egg masses or galls were observed, indicating that M. hapla facilitates infection of M. javanica on this plant. There was no clear difference in root galling on the monoinfected and coinfected plants. To confirm identification of both species, molecular analysis was performed on females extracted from the field and the greenhouse. DNA was extracted from ethanol-preserved females (n = 10), and polymerase chain reaction (PCR) was carried out using species-specific sequence-characterized amplified region primer set JMV1(5′-GGATGGCGTGCTTTCAAC-3′/JMV (5′-AAAAATCCCCTCGAAAAATCCACC-3′) for M. hapla and Fjav (GGTGCGCGATTGAACTGAGC)/Rjav (CAGGCCCTTCAGTGGAACTATAC) for M. javanica (Zijlstra et al. 2000), producing the expected fragment lengths of 440 and 670 bp, respectively. To further confirm species identification of M. hapla, the same DNA (n = 10) was amplified targeting the mitochondrial DNA region between COII and 16S rRNA gene and sequenced using primers C2F3 (GGTCAATGTTCAGAAATTTGTGG)/1108 (TACCTTTGACCAATCACGCT) (Powers and Harris 1993). Identification of M. javanica was reconfirmed by amplifying the mitochondrial NAD5 gene and sequencing using primers NAD5F2 (TATTTTTTGTTTGAGATATATTAG)/NAD5RI (CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). The PCR products (i.e., KX137039 and KY436071) were sequenced and aligned with sequences in GenBank. BLAST analysis resulted in 99 to 100% identity to M. hapla and M. javanica, respectively. From 5 of the 15 plants, 20 females were randomly sampled. Samples from individual plants were analyzed morphologically and separately for each plant. Anterior parts of 10 of the 20 females were used for PCR analysis. In total, 70% were M. hapla and 30% M. javanica. There were no differences in the appearance of the galls between the treatments. This is the first report of coinfection by M. hapla and M. javanica on Parthenium. M. hapla can infect Parthenium and facilitates infection by M. javanica. Our findings hint on complex interaction of Meloidogyne spp. and their hosts. Because Parthenium is drought tolerant and can aggressively colonize disturbed sites, it will facilitate survival and further spread of both species. Further research will study coinfections among Meloidogyne spp. and other plant parasitic nematodes to understand disease severity and the evolutionary trajectories of virulent nematode populations.

Occurrence & distribution of Zygoramma bicolarata pallister (coleoptera: chrysomelidae) the biocontrol agent of Parthenium hysterophorus l. In Rahuri taluka

Parthenium hysterophorus L. is a serious weed in India, covering about 5 million ha of land. Zygogramma bicolorata Pallister the leaf beetle, Mexican was considered a safe biocontrol agent. It causes extensive damage to Parthenium plants. Its occurrences & distribution was studied in villages from Rahuri Taluka in Ahmednagar District of Maharashtra State, India. It is mainly influenced by Agricultural practices performed by Mahatma Phule Agricultural University hence it will be interesting to study the occurrence and distribution of Zygogramma on Parthenium . The adult beetles were collected during the months of June to December 2012-13. It is found to be a promising, safe biocontrol agent. Its distribution among farmers can help to control the weed. Total number of insects (Mexican beetle) collected from 15 groups / localities from Rahuri taluka (Zygogramma was collected from about 64 villages out of 80) is 4979 from June 2012 to December 2012. And it was 4915 for the year 2013. The average of the two years was 4947. The highest collection and occurrence was observed in village Kondawad. It was found to be 734 insects. Maximum collection / occurrence of insects observed were 418 and 353 in the Month of October in villages Kendal and Kondwad, respectively. Insects were not observed from January onwards as they go in to hibernation in winter season. The data on preference of food by Z. bicolorata on crop plants along with carrot weed indicate that the adults moved within about 3-15 minutes from crop plants to Parthenium hysterophorus , indicating that they are not polyphagus except sunflower. Its life cycle and morphology was studied. Duration of different life stages recorded. Foraging activity on Parthenium by Apis florae and Apis indica observed .

Post-traumatic chronic discharging orbital sinus: An interesting case report

We report a rare case of a chronic discharging orbital sinus with retained multiple pieces of wooden stem. A 50-year-old male presented with swelling and discharge of 8 months duration on the medial aspect of right upper lid following a fall. Magnetic resonance imaging (MRI) showed presence of a foreign body granuloma. Orbital exploration revealed presence of multiple fragments of plant stems. Removal of these stem pieces along with granulation tissue resulted in resolution of his symptoms. The patient, on retrospective enquiry, gave the history of presence of Parthenium plants in the area where he fell. This case report highlights the need to suspect a retained foreign body in the presence of a non-healing wound.

Case study of aspergillus flavus causing unilateral acute progressing corneal melt

Twenty-eight-year-old female patient, reported with history of acute painful loss of vision, following contact with Parthenium plants 15 days ago. Slit lamp examination showed 4-5 mm circumscribed thick plaque of slough in the central cornea with satellite infiltration and tenacious hypopyon. Ten percent potassium hydroxide (KOH) preparation of the slough revealed plenty of septate fungal hyphae. Topical Natamycin was instilled with no improvement. Ulcer debridement was done and thick plaque was subjected to microbiological examination. Fungal culture yielded Aspergillus flavus. Topical Amphotericin B was added along with Natamycin. Despite good response the condition progressed to quick melting and perforation. Crystalline lens extruded through the perforation, after several bouts of sneezing. Perforation was managed by therapeutic corneal grafting. Drug resistance, drug toxicity, corneal thinning and the strain by the patient might explain the disease progression. Factors causing corneal melt and the measures adopted to prevent the intraocular spread are presented.

Parthenium dermatitis

Allergic contact dermatitis (ACD) to Parthenium hysterophorus is the most common cause of plant dermatitis in India. Parthenium dermatitis is caused by dry powder of leaves and flowers and hair-like structures (trichomes). Sesquiterpene lactones (SQLs) are the most important allergens responsible for ACD to parthenium. The different patterns include classical airborne contact dermatitis, chronic actinic dermatitis (CAD), exfoliative and widespread dermatitis. There is a definite trend towards a change from an airborne pattern to a CAD pattern in the natural history of parthenium dermatitis. In CAD, there is a reported increased sensitivity to UVB, UVA and even visible light. However, SQLs including parthenin, the major allergen in the Parthenium hysterophorus, has neither documented photoallergic nor phototoxic properties. Recently, the high photoreactivity of α-methylene-γ-butyrolactone ring toward thymidine and resulting photoadducts has been proposed as an explanation of the progressive evolution of allergic contact dermatitis toward chronic actinic dermatitis. However, more data is required to reach a conclusion on the mechanism of photosensitivity in parthenium dermatitis. Sunlight, especially UV radiation, may have a role in increasing the germination capacity and the amount of allergens in the Compositae family, especially in parthenium plants under appropriate conditions like summer and spring, which may contribute to high prevalence of parthenium dermatitis especially in northern India.

Herbicidal Potential of Drechslera spp. Culture Filtrates Against Parthenium hysterophorus L.

Herbicidal activity of culture filtrates of four Drechslera spp., namely D. australiensis (Bugnic.) Subram. & B.L. Jain, D. biseptata (Sacc. & Roum.) M.J. Richardson & E.M. Fraser, D. hawaiiensis Bugnic. ex M.B. Ellis, and D. holmii (Luttr.) Subram. & P.C. Jain, prepared in malt extract broth was investigated against parthenium weed ( Parthenium hysterophorus L.) in both laboratory bioassays and pots. In laboratory bioassays, the effect of original (100%) and diluted (50%) culture filtrates of the four Drechslera spp. was studied on parthenium germination and seedling growth in 90 mm diameter Petri plates. Original culture filtrate of all the four Drechslera species significantly reduced germination, shoot length, shoot fresh biomass, root length, and root fresh biomass of parthenium seedlings by 43 to 77%, 77 to 82%, 69 to 82%, 90 to 92%, and 67 to 83%, respectively, as compared to the control. In pot trials, foliar application of original fungal culture filtrates was carried out on 1-wk and 2-wk old parthenium seedlings. Culture filtrates of all the four Drechslera spp., except D. holmii, markedly reduced parthenium shoot dry weight. Two-week-old plants were more susceptible to foliar spray than the 1-wk old plants. There was a 13 to 55% and 28 to 65% reduction in shoot dry weight of 1-wk and 2-wk old parthenium plants, respectively, due to culture filtrates of various Drechslera spp. The present study concludes that Drechslera spp. culture filtrates can be used as alternative herbicides for parthenium weed management.

Herbicidal effects of extracts and residue incorporation of Datura metel against parthenium weed

The present study was designed to evaluate the herbicidal activity of Datura metel against the noxious weed parthenium (Parthenium hysterophorus L.). In a laboratory bioassay, the effect of aqueous, methanol and n-hexane shoot and root extracts of 5, 10, 15 and 20% w/v (on a fresh weight basis) concentration of D. metel were tested against the germination and seedling growth of parthenium. Both aqueous and methanol extracts markedly suppressed the germination and seedling growth of parthenium. Generally, the effect of shoot extracts was more pronounced than the effect of root extracts. In foliar spray bioassay, aqueous and methanol shoot extracts of 10% w/v (on dry weight bases) concentrations were sprayed on one-week and two-week-old pot-grown parthenium seedlings. Two subsequent sprays were carried out at five day intervals each. Both the aqueous as well as the methanol extracts significantly suppressed shoot length as well as shoot and root biomass of one-week and two-week-old parthenium plants. In residue incorporation bioassay, crushed shoots of D. metel were incorporated in the soil at 1, 2, … 5% w/w. Parthenium seeds were sown one week after residue incorporation and plants were harvested 40 days after sowing. Incorporation of 2–5% residues significantly reduced germination by 47–89%. Residues of 4 and 5% concentration significantly suppressed plant biomass by 90 and 97%, respectively. The present study concludes that root and shoots of D. metel contain herbicidal constituents for the management of parthenium weed.

Study on the early effects of several weed-control methods on Parthenium hysterophorus L.

We carried out a trial in the Hluhluwe-iMfolozi Park comparing three herbicides and two manual control techniques for controlling the annual weed Parthenium hysterophorus L. The herbicides 2,4-D amine (480 g ai l−1), metsulfuron methyl (600 g kg−1) and picloram (240 g l−1) were tested at three levels each. Manual control comprised hoeing and pulling out parthenium plants by hand. Treatments were applied in mid-December 2006. Surveys were conducted prior to treatment and again in March 2007. The untreated control had a mean mortality of 16% at the end of the growing season, attributed to self thinning. Parthenium mortalities above 80% were achieved with metsulfuron methyl 18–75 g ai ha−1, picloram 270–360 g ai ha−1 and both manual control techniques. Broadleaf species, 10 out of 15 of which were alien, were severely affected by herbicides but alien forbs appeared to benefit by the selective removal of parthenium in the manual control treatments. Native grasses filled the space vacated by broadleaf species in the plots treated with herbicide. However, none of the treatments offered lasting control because parthenium regeneration density a year later was no different to densities at the start of the trial. Successful management of parthenium rests on a strong commitment to follow-up spraying until alternative vegetation has covered and stabilised areas under treatment.

<i>Puccinia melampodii</i> Diet. and Holow. as a Biological Control Agent of <i>Parthenium hysterophorus</i>

Parthenium hysterophorus is an annual, extremely prolific weed of Asteraceae that causes severe economic losses, health problems and habitat destruction in many tropical and sub tropical countries. In Sri Lanka, it was first observed in Vavuniya district in 1999 and subsequently it has spread to many areas of the country.The fungus Puccinia melampodii, introduced from Australia, was evaluated for its efficacy as bio control agent against P . hysterophorus under local conditions to use as a component of integrated pest management programme. Life cycle studies revealed that P . melampodii completes its life cycle within 8-11 days at 25°C night and 28°C day temperature. Continuous fungal infection resulted complete destruction of Parthenium plants within 30 days. In vitro studies to determine the effect of temperature on teliospore germination of P . melampodii indicated that it occurs over a wide range of temperatures from 5 to 30°C. The optimum temperature was 25°C and the fungus did not survive at 35°C after an inoculation period of 24 h and 48 h.Host specific studies of P . melampodii showed that, of 30 different plant taxa in 14 plant families tested, only P. hysterophorus were susceptible to the infection. Fungal infection at different growth stages of the Parthenium; rosette, preflowering and flowering stages, suppressed the plant growth, especially the leaf and flower production. Results revealed that the fungus P . melampodii can be effectively used as a potential bio-control agent against the Parthenium weed. Key words : Parthenium weed; Puccinia melampodii ; teliospore germination; mycelium DOI: 10.4038/jfa.v1i1.1835 Journal of Food and Agriculture Vol.1(1) 2008 pp.13-19

Effect of aqueous extracts of allelopathic crops on germination and growth of Parthenium hysterophorus L.

Herbicidal effects of aqueous root and shoot extracts of three allelopathic crops, viz. sunflower (Helianthus annuus L.), sorghum (Sorghum bicolor L.) and rice (Oryza sativa L.) were evaluated against germination and growth of the noxious alien weed Parthenium hysterophorus L. The study, carried out in petri dishes using 5, 10, 15, 20 and 25% (w/v) aqueous root and shoot extracts of fresh plant materials of the test crops, indicated insignificant effects on shoot length and seedling biomass while germination and root length were significantly reduced by extracts of all the test crops. In a foliar spray bioassay, aqueous shoot extracts of 50 and 100% w/v (on a fresh weight basis) of sunflower and sorghum were applied to 10 day old Parthenium plants. The root biomass of Parthenium plants was significantly suppressed by 50 and 100% extracts of both the test allelopathic extracts. Both concentrations of sorghum extracts significantly reduced shoot biomass, but sunflower extract was effective only at the lower concentration.

Herbicidal activity of volatile oils from Eucalyptus citriodora against Parthenium hysterophorus

Summary The herbicidal effect of volatile oils from leaves of Eucalyptus citriodora against the noxious weed Parthenium hysterophorus was tested. In a laboratory bioassay, seed germination and seedling length, chlorophyll content and respiratory activity of Parthenium decreased with increased concentration of eucalypt oils from 0.2 to 5.0 nL mL –1 . Germination was completely inhibited at 5.0 nL mL –1 eucalyptus oils. Further, for 4-week-old plants of Parthenium sprayed with different concentrations of volatile oils, visible damage increased and chlorophyll content and respiratory activity decreased with increased concentration from 0 to 100 µL mL –1 , the week after spraying. At concentrations up to 50 µL mL –1 , plants showed some recovery over time but plants sprayed with 75 and 100 µL mL –1 died 2 weeks after treatment. Plants sprayed with 50 µL mL –1 and higher concentrations of eucalypt oils were desiccated and wilted in appearance. At concentrations of 5–75 µL mL –1 , eucalypt oils caused a rapid electrolyte leakage from the Parthenium plants thereby indicating an effect on membrane integrity. It is concluded that volatile oils from E. citriodora possess weed-suppressing ability and could be used as a potential bioherbicide for future weed management programmes.

The applicability of the plant vigor and resource regulation hypotheses in explaining Epiblema gall moth–Parthenium weed interactions

AbstractA basic question in insect–plant interactions is whether the insects respond to, or regulate plant traits, or a complex mixture of the two. The relative importance of the directions of the influence in insect–plant interactions has therefore been articulated through both the plant vigor hypothesis (PVH) and the resource regulation hypothesis (RRH). This study tested the applicability of these hypotheses in explaining the interactions between Parthenium hysterophorus L. (Asteraceae) and its stem‐galling moth, Epiblema strenuana Walker (Lepidoptera: Tortricidae). Parthenium plants exposed to galling were sampled at three sites in north Queensland, Australia, over a 2‐year period, and the relationship between gall abundance and plant vigor (plant height, biomass, flowers per plant, and branches per plant) was studied. To test the predictions of PVH and RRH, the vigor of parthenium plants protected from galling using insecticides was compared to galled plants and plants that escaped from galling. The vigor of ungalled plants was less than the vigor of galled plants. The higher plant vigor in galled plants was not due to galling, as was evident from insecticide exclusion trials. The insect seemed to preferentially gall the more vigorous plants. These findings support the predictions of the PVH and are contrary to those of RRH. Since gall abundance is linked to plant vigor, galling may have only a limited impact on the vigor of parthenium. This has implications for weed biological control. If the objective of biological control is to regulate the population of a plant by a galling insect, a preference for more vigorous plants by the insect is likely to limit its ability to regulate plant populations. This may explain the paucity of successes against biocontrol of annual weeds using gall insects.

First Report of Lasiodiplodia theobromae as a Foliar Pathogen of Parthenium hysterophorus.

Parthenium (Parthenium hysterophorus L.) has been a target of weed researchers in India for more than four decades. The weed is attacked by many pathogens, some of which have been tried as mycoherbicides with mixed results (1). In an effort to identify more pathogens of parthenium, surveys were conducted in different regions. A typical foliar disease was frequently observed in several districts of Karnataka State, especially during the winter months of 1996 to 1998. The primary symptoms were circular to irregular, light brown to gray leaf spots, ranging from 2 to 8 mm in diameter. Careful observation of diseased plants revealed that the development of several lesions in close proximity resulted in a rapid necrosis and withering of the entire leaf. The suspected causal organism, which was a dark, chocolate-brown fungus, grew well on potato-dextrose agar at 25°C and a 12-h photoperiod. It produced slowly maturing conidia (20 to 27 × 12 to 14 μm), which were dark brown, ellipsoid, thick-walled, and single-septate with longitudinal striations. A dense conidial suspension (108 conidia per ml) of the fungus was evenly applied (250 μl per leaf) on detached, surface-sterilized, healthy parthenium leaves (N = 10), and infection was ascertained after 4 days of incubation at 26 ± 2°C in petri dishes lined with moist cotton. When 45-day-old pot-grown parthenium plants (N = 50) were similarly inoculated and maintained above 95% RH for at least 48 h, typical symptoms resembling those of naturally infected plants were visible on 88% of the plants within 3 weeks of incubation at 28 ± 2°C. Whereas the fungus was consistently isolated from diseased leaves of inoculated plants, with 80% frequency of reisolation, uninoculated controls neither displayed symptoms nor yielded the pathogen. The experiment was performed three times with similar results, satisfying Koch's postulates. The identity of one of the virulent isolates, WF(Ph)8 (ex Siddeswaranadurga, Chitradurga district, December 1997), was confirmed as Lasiodiplodia theobromae (Pat.) Griffon. & Maubl. (=Botryodiplodia theobromae Pat.) (IMI 378919a) at CABI Bioscience, UK Centre (Egham). Although it is a ubiquitous tropical and subtropical plant pathogen that occurs between 40°N and 40°S (2), it was not previously recorded as a cause of leaf disease on parthenium. Investigations on the possible use of the pathogen as a mycoherbicide have given encouraging results.

Airborne Compositae dermatitis: monoterpenes and no parthenolide are released from flowering Tanacetum parthenium (feverfew) plants.

The air around intact feverfew (Tanacetum parthenium) plants was examined for the presence of airborne parthenolide and other potential allergens using a high-volume air sampler and a dynamic headspace technique. No particle-bound parthenolide was detected in the former. Among volatiles emitted from the aerial parts of feverfew plants and collected by the dynamic headspace technique a total of 41 compounds, mainly monoterpenes, were identified and quantified by GC and GC-MS. Alpha-Pinene, camphene, limonene, gamma-terpinene, (E)-beta-ocimene, linalool, p-cymene, (E)-chrysanthenol, camphor and (E)-chrysanthenyl acetate were the predominant monoterpenes accounting for nearly 88% of the total volatiles emitted. The average total yield of volatiles emitted over 24 h was 18,160 ng/g fresh weight of leaves and flowers, corresponding to the emission of approximately 8 mg volatiles per day from one full-grown feverfew plant. No parthenolide or other sesquiterpene lactones were detected. The present investigation does not support the theory of airborne sesquiterpene lactone-containing plant parts or of direct release of sesquiterpene lactones from living plants as the only explanations for airborne Compositae dermatitis. Potential allergens were found among the emitted monoterpenes and their importance in airborne Compositae dermatitis is discussed.

Phytotoxicity of sesquiterpene lactone parthenin on aquatic weeds

The sesquiterpene lactone parthenin, one of the major toxins in an obnoxious weed, parthenium (Parthenium hysterophorus L.), was toxic at 50 ppm to the floating aquatic weeds pistia (Pistia stratiotes L.) and lemna (Lemna pausicostata Hegelm.) and at 100 ppm to water hyacinth (Eichhornia crassipes Mart Solmns.), salvinia (Salvinia molesta Mitchell), azolla (Azolla nilotica Decne.), and spirodella (Spirodella polyrhiza L. Schleid). The lethal dose for the submerged weeds najas (Najas graminea Del.), ceratophyllun (Ceratophyllum demersun L.), and hydrilla (Hydrilla verticillata L. f. Royle) was 25 ppm. The submerged aquatic weeds were more sensitive to parthenin. Water hyacinth was used as a representative for studying the phytotoxicity of parthenin on aquatic weeds. Inhibition of water hyacinth by parthenin was associated with decline in water use, root dysfunction, excessive leakage of solutes from roots indicative of massive damage to cellular membranes, loss of dehydrogenase activity in the roots, and loss of chlorophyll in the leaves. Plant death occurred in a period of one to two weeks. Parthenin phytotoxicity is gradually lost in an aquatic environment as a lethal dose became nonlethal in about 30 days under outdoor conditions. Possible buildup of a toxin concentration may affect population dynamics and a shift in the aquatic weed flora in the immediate area of parthenium stands. Accumulation of the toxin in an aquatic environment, however, at a level sufficient to produce such changes in a natural ecosystem as a consequence of rain washing parthenium plants and leaching of toxin from their residue appears to be unlikely.

Host specificity testing and assessment of the pathogenicity of the rust, Puccinia abrupta var. partheniicola, as a biological control agent of Parthenium weed (Parthenium hysterophorus)

Parthenium hysterophorus, a native of Central America, is a problem weed of Australian rangeland, particularly in Queensland. Following field surveys in Mexico, the rust fungus Puccinia abrupta var. partheniicola was selected as a potential biological control agent. One isolate was chosen for further investigation after infection studies with one Kenyan and five Mexican isolates. Assessment of inoculation conditions showed that temperatures of less than 20° C and dew periods of more than 6 hours were required for abundant pustule production. Infection with the rust hastened leaf senescence, significantly decreased the life span and dry weight of Parthenium plants, and reduced flower production 10‐fold. Subsequent host‐range studies against 120 species and varieties, with further screening against a limited number of species conducted under a range of environmental regimes, indicated the rust to be sufficiently host‐specific to be considered for introduction. Additional host‐range tests against sunflowers demonstrated that resistance to P. abrupta var. partheniicola was not modified by prior inoculation with P. helianthi.