First Report of Meloidogyne hapla and M. javanica Coinfection on Parthenium hysterophorus in Kenya

Abstract

Parthenium hysterophorus L. (Asteraceae) is an annual or short-lived perennial herbaceous noxious weed native to North and South America. Parthenium has spread in Kenya and has become a menace to agriculture. Stunted and wilted Parthenium plants with globular galled roots marked with profuse roots were observed in a field in Tigoni, Kiambu County (average, 15.3°C; Koeppen-Geiger Climate Classification Cfb). Nematodes were extracted from root zone soil using the Baermann tray, and population densities of infective second-stage juveniles ranged from 300 to 980 individuals per 100 cm³ of soil. Mature females and their corresponding egg masses were handpicked from a single infected plant root. The posterior part of 20 adult Meloidogyne females was used for morphological analysis and the respective anterior part stored in ethanol for molecular analysis. Analysis of perineal patterns (Eisenback et al. 1980) revealed 13 (65%) Meloidogyne hapla and 7 (35%) M. javanica. To confirm pathogenicity, infection assays with one or two species were performed. Egg masses from pure cultures each containing 410 to 530 eggs were inoculated onto individual Parthenium plants growing in sterile soil in a greenhouse maintained at ∼25°C (average). For monoinfection two egg masses from one species and for coinfection one egg mass of each species were used. Fifteen plants per treatment were inoculated. At 45 days postinfection, the number of egg masses on Parthenium inoculated with M. hapla only was 129 ± 19.5 per root system, whereas M. hapla + M. javanica coinoculation was 188 ± 23.6. On plants inoculated with M. javanica only, no egg masses or galls were observed, indicating that M. hapla facilitates infection of M. javanica on this plant. There was no clear difference in root galling on the monoinfected and coinfected plants. To confirm identification of both species, molecular analysis was performed on females extracted from the field and the greenhouse. DNA was extracted from ethanol-preserved females (n = 10), and polymerase chain reaction (PCR) was carried out using species-specific sequence-characterized amplified region primer set JMV1(5′-GGATGGCGTGCTTTCAAC-3′/JMV (5′-AAAAATCCCCTCGAAAAATCCACC-3′) for M. hapla and Fjav (GGTGCGCGATTGAACTGAGC)/Rjav (CAGGCCCTTCAGTGGAACTATAC) for M. javanica (Zijlstra et al. 2000), producing the expected fragment lengths of 440 and 670 bp, respectively. To further confirm species identification of M. hapla, the same DNA (n = 10) was amplified targeting the mitochondrial DNA region between COII and 16S rRNA gene and sequenced using primers C2F3 (GGTCAATGTTCAGAAATTTGTGG)/1108 (TACCTTTGACCAATCACGCT) (Powers and Harris 1993). Identification of M. javanica was reconfirmed by amplifying the mitochondrial NAD5 gene and sequencing using primers NAD5F2 (TATTTTTTGTTTGAGATATATTAG)/NAD5RI (CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). The PCR products (i.e., KX137039 and KY436071) were sequenced and aligned with sequences in GenBank. BLAST analysis resulted in 99 to 100% identity to M. hapla and M. javanica, respectively. From 5 of the 15 plants, 20 females were randomly sampled. Samples from individual plants were analyzed morphologically and separately for each plant. Anterior parts of 10 of the 20 females were used for PCR analysis. In total, 70% were M. hapla and 30% M. javanica. There were no differences in the appearance of the galls between the treatments. This is the first report of coinfection by M. hapla and M. javanica on Parthenium. M. hapla can infect Parthenium and facilitates infection by M. javanica. Our findings hint on complex interaction of Meloidogyne spp. and their hosts. Because Parthenium is drought tolerant and can aggressively colonize disturbed sites, it will facilitate survival and further spread of both species. Further research will study coinfections among Meloidogyne spp. and other plant parasitic nematodes to understand disease severity and the evolutionary trajectories of virulent nematode populations.