Parallel Triple Helix Research Articles

TFOFinder: Python program for identifying purine-only double-stranded stretches in the predicted secondary structure(s) of RNA targets.

Nucleic acid probes are valuable tools in biology and chemistry and are indispensable for PCR amplification of DNA, RNA quantification and visualization, and downregulation of gene expression. Recently, triplex-forming oligonucleotides (TFO) have received increased attention due to their improved selectivity and sensitivity in recognizing purine-rich double-stranded RNA regions at physiological pH by incorporating backbone and base modifications. For example, triplex-forming peptide nucleic acid (PNA) oligomers have been used for imaging a structured RNA in cells and inhibiting influenza A replication. Although a handful of programs are available to identify triplex target sites (TTS) in DNA, none are available that find such regions in structured RNAs. Here, we describe TFOFinder, a Python program that facilitates the identification of intramolecular purine-only RNA duplexes that are amenable to forming parallel triple helices (pyrimidine/purine/pyrimidine) and the design of the corresponding TFO(s). We performed genome- and transcriptome-wide analyses of TTS in Drosophila melanogaster and found that only 0.3% (123) of total unique transcripts (35,642) show the potential of forming 12-purine long triplex forming sites that contain at least one guanine. Using minimization algorithms, we predicted the secondary structure(s) of these transcripts, and using TFOFinder, we found that 97 (79%) of the identified 123 transcripts are predicted to fold to form at least one TTS for parallel triple helix formation. The number of transcripts with potential purine TTS increases when the strict search conditions are relaxed by decreasing the length of the probe or by allowing up to two pyrimidine inversions or 1-nucleotide bulge in the target site. These results are encouraging for the use of modified triplex forming probes for live imaging of endogenous structured RNA targets, such as pre-miRNAs, and inhibition of target-specific translation and viral replication.

Binding and NMR Structural Studies on Indoloquinoline–Oligonucleotide Conjugates Targeting Duplex DNA

An 11-phenyl-indolo[3,2-b]quinoline (PIQ) was tethered through an aminoalkyl linker to the 5'-end of four pyrimidine oligonucleotides with T/C scrambled sequences at their two 5'-terminal positions. Binding to different double-helical DNA targets formed parallel triple helices with a PIQ-mediated stabilization that strongly depends on pH and the terminal base triad at the 5'-triplex-duplex junction. The most effective stabilization was observed with a TAT triplet at the 5'-junction under low pH conditions, pointing to a protonated ligand with a high triplex binding affinity and unfavorable charge repulsions in the case of a terminal C(+)GC triplet at the junction. The latter preference of the PIQ ligand for TAT over CGC is alleviated yet still preserved at higher pH. Intercalation of PIQ at the 5'-triplex-duplex junction as suggested by the triplex melting experiments was confirmed by homonuclear and heteronuclear NMR structural studies on a specifically isotope-labeled triplex. The NMR analysis revealed two coexisting species that only differ by a 180° rotation of the indoloquinoline within the intercalation pocket. NOE-derived molecular models indicate extensive stacking interactions of the indoloquinoline moiety with the TAT base triplet and CG base pair at the junction and a phenyl substituent that is positioned in the major groove and oriented almost perpendicular to the plane of the indoloquinoline.

Parallel and Antiparallel Triple Helices of Naphthyridine Oligoamides

Parallel and Antiparallel Triple Helices of Naphthyridine Oligoamides

Potent Triple Helix Stabilization by 5′,3′‐Modified Triplex‐Forming Oligonucleotides

Anthraquinone and pyrene analogues attached to the 3' and/or 5' termini of triplex-forming oligonucleotides (TFOs) by various linkers increased the stability of parallel triple helices. The modifications are simple to synthesize and can be introduced during standard solid-phase oligonucleotide synthesis. Potent triplex stability was achieved by using doubly modified TFOs, which in the most favourable cases gave an increase in melting temperature of 30 degrees C over the unmodified counterparts and maintained their selectivity for the correct target duplex. Such TFOs can produce triplexes with melting temperatures of 40 degrees C at pH 7 even though they do not contain any triplex-stabilizing base analogues. These studies have implications for the design of triplex-forming oligonucleotides for use in biology and nanotechnology.

DNA triple-helix formation at target sites containing duplex mismatches

We have studied the formation of DNA triple helices at target sites that contain mismatches in the duplex target. Fluorescence melting studies were used to examine a series of parallel triple helices that contain all 64 N.XZ triplet combinations at the centre (where N, X and Z are each of the four natural DNA bases in turn). Similar experiments were also performed with N = bis-amino-U (BAU) (for stable recognition of AT base pairs) and N = S (for recognition of TA inversions). We find that the introduction of a duplex mismatch destabilises the C +.GZ, T.AZ and G.TZ triplets. A similar effect is seen with BAU.AZ triplets. In contrast, other base combinations, based on non-standard triplets such as C.AZ, T.TZ, G.CZ and A.CZ are stabilised by the presence of a duplex mismatch. In each case S binds to sites containing duplex mismatches better than the corresponding Watson–Crick base pairs.

Site-resolved stabilization of a DNA triple helix by magnesium ions.

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson-Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+*GC triads in determining the stability of DNA triple-helical structures.

Parallel and antiparallel G*G.C base triplets in pur*pur.pyr triple helices formed with (GA) third strands

Triple helices with G*G.C and A*A.T base triplets with third GA strands either parallel or antiparallel with respect to the homologous duplex strand have been formed in presence of Na+ or Mg2+ counterions. Antiparallel triplexes are more stable and can be obtained even in presence of only monovalent Na+ counterions. A biphasic melting has been observed, reflecting third strand separation around 20°C followed by the duplex -> coil transition around 63°C. Parallel triplexes are far less stable than the antiparallel ones. Their formation requires divalent ions and is observed at low temperature and in high concentration conditions. Different FTIR signatures of G*G.C triplets in parallel and antiparallel triple helices with GA rich third strands have been obtained allowing the identification of such base triplets in triplexes formed by nucleic acids with heterogenous compositions. Only S-type sugars are found in the antiparallel triplex while some N-type sugar conformation is detected in the parallel triplex.

Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

Synthesis of modified oligonucleotides containing 4-guanidino-2-pyrimidinone nucleobases

Oligonucleotides incorporating 4-guanidino-2-pyrimidinone nucleobases have been prepared. These nucleobase analogues were designed to mimic the double hydrogen bond donor pattern of protonated cytosines in parallel triple helices. Guanidine-, N-methyl-, N,N-dimethyl-, and N,N′-dimethylguanidine-containing nucleoside H-phosphonates were used for the synthesis of oligonucleotide analogues with minor modifications in standard solid-phase procedures.

Parallel intramolecular DNA triple helix with G and T bases in the third strand stabilized by Zn(2+) ions.

We present evidence of formation of an intramolecular parallel triple helix with T*A.T and G*G.C base triplets (where * represents the hydrogen bonding interaction between the third strand and the duplex while. represents the Watson-Crick interactions which stabilize the duplex). The third GT strand, containing seven GpT/TpG steps, targets the polypurine sequence 5'-AGG-AGG-GAG-GAG-3'. The triple helix is obtained by the folding back twice of a 36mer, formed by three dodecamers tethered by hydroxyalkyl linkers (-L-). Due to the design of the oligonucleotide, the third strand orientation is parallel with respect to the polypurine strand. Triple helical formation has been studied in concentration conditions in which native gel electrophoresis experiments showed the absence of intermolecular structures. Circular dichroism (CD) and UV spectroscopy have been used to evidence the triplex structure. A CD spectrum characteristic of triple helical formation as well as biphasic UV and CD melting curves have been obtained in high ionic strength NaCl solutions in the presence of Zn(2+) ions. Specific interactions with Zn(2+) ions in low water activity conditions are necessary to stabilize the parallel triplex.

Spectroscopic Studies on Ethidium Bromide Binding to Intramolecular Parallel and Antiparallel Triple Helices Containing T*A:T and G*G:C Triplets

The interaction of ethidium bromide (EB), a DNA intercalator, with two intramolecular triplexes 5′d(G4A4G4-[T4]-C4T4C4-[TJ-G4T4G4), 5′d(G4T4G4-[T4]-G4A4G4-[T4]-C4T4C4) ([T4]represents a stretch of 4 thymine residues) and their precursor duplexes has been investigated by circular dichroism, fluorescence and UV absorption spectroscopy. Binding of EB induces a circular dichroism band in the region around 310 nm which is positive for the duplex forms but negative for the triplex forms. We observed that the binding of EB to the duplex form does not induce the formation of the triplex structures. Thermal denaturation experiments demonstrate that EB stabilizes more the parallel triple helix than the antiparallel one. Analysis of the binding process from fluorescence measurements shows that binding constants to the triple helical forms and to the hairpin reference duplex [T4]-G4A4G4-[T4]-C4T4C4) are close. However the binding site size is larger for the triplexes (4–6 base triplets) than for the duplex (2 base pairs).

Synthesis and triple helix-forming ability of oligonucleotides with N,N-dimethylaminoethyl phosphoramidate linkages

Two oligonucleotides, partially modified with N,N-dimethylaminoethyl phosphoramidate groups, were obtained by an optimized solid-phase synthesis cycle based on H-phosphonate chemistry. Their use as third strands in parallel triple helices was shown to produce a decrease in stability with respect to all-phosphodiester oligonucleotide complexes, most probably due to unfavourable steric effects. Phosphoramidate-modified oligonucleotides were shown to be notably stable to exonucleases.

A Molecular Model for RecA-Promoted Strand Exchange via Parallel Triple-Stranded Helices

A number of studies have concluded that strand exchange between a RecA-complexed DNA single strand and a homologous DNA duplex occurs via a single-strand invasion of the minor groove of the duplex. Using molecular modeling, we have previously demonstrated the possibility of forming a parallel triple helix in which the single strand interacts with the intact duplex in the minor groove, via novel base interactions (Bertucat et al., J. Biomol. Struct. Dynam. 16:535–546). This triplex is stabilized by the stretching and unwinding imposed by RecA. In the present study, we show that the bases within this triplex are appropriately placed to undergo strand exchange. Strand exchange is found to be exothermic and to result in a triple helix in which the new single strand occupies the major groove. This structure, which can be equated to so-called R-form DNA, can be further stabilized by compression and rewinding. We are consequently able to propose a detailed, atomic-scale model of RecA-promoted strand exchange. This model, which is supported by a variety of experimental data, suggests that the role of RecA is principally to prepare the single strand for its future interactions, to guide a minor groove attack on duplex DNA, and to stabilize the resulting, stretched triplex, which intrinsically favors strand exchange. We also discuss how this mechanism can incorporate homologous recognition.

Parallel and antiparallel triple helices with G,A-containing third strands

Parallel and antiparallel triple helices with G,A-containing third strands

Solution conformation of a parallel DNA triple helix with 5' and 3' triplex-duplex junctions.

Polypurine x polypyrimidine sequences of DNA can form parallel triple helices via Hoogsteen hydrogen bonds with a third DNA strand that is complementary to the purine strand. The triplex prevents transcription and could therefore potentially be used to regulate specific genes. The determination of the structures of triplex-duplex junctions can help us to understand the structural basis of specificity, and aid in the design of optimal antigene oligonucleotides. The solution structures of the junction triplexes d(GAGAGACGTA)-X-(TACGTCTCTC)-X-(CTCTCT) and d(CTCTCT)-X-(TCTCTCAGTC)-X-(GACTGAGAGA) (where X is bis(octylphosphate) and nucleotides in the triplex regions are underlined) have been solved using nuclear magnetic resonance (NMR) spectroscopy. The structure is characterised by significant changes in the conformation of the purine residues, asymmetry of the 5' and 3' junctions, and variations in groove widths associated with the positive charge of the protonated cytosine residues in the third strand. The thermodynamic stability of triplexes with either a 5' or a 3'CH+ is higher than those with a terminal thymidine. The observed sequence dependence of the triplex structure, and the distortions of the DNA at the 5' and 3' termini has implications for the design of optimal triplex-forming sequences, both in terms of the terminal bases and the importance of including positive charges in the third strand. Thus, triplex-stabilising ligands might be designed that can discriminate between TA x T-rich and CG x C+-rich sequences that depend not only on charge, but also on local groove widths. This could improve the stabilisation and specificity of antigene triplex formation.

A Model for Parallel Triple Helix Formation by Ree A: Single-Strand Association with a Homologous Duple via the Minor Groove

The nucleoproteic filaments of RecA polymerized on single stranded DNA are able to integrate double stranded DNA in a coaxial arrangement (with DNA stretched by a factor 1.5), to recognize homologous sequences in the duplex and to perform strand exchange between the single stranded and double stranded molecules. While experimental results favor the hypothesis of an invasion of the minor groove of the duplex by the single strand, parallel minor groove triple helices have never been isolated or even modeled, the minor groove offering little space for a third strand to interact. Based on an internal coordinate modeling study, we show here that such a structure is perfectly conceivable when the two interacting oligomers are stretched by a factor 1.5, in order to open the minor groove of the duplex. The model helix presents characteristics that coincide with known experimental data on unwinding, base pair inclination and inter-proton distances. Moreover, we show that extension and unwinding stabilize the triple helix. New patterns of triplet interaction via the minor groove are presented.

Circular dichroism and UV melting studies on formation of an intramolecular triplex containing parallel T*A:T and G*G:C triplets: netropsin complexation with the triplex.

We have used circular dichroism and UV absorption spectroscopy to characterize the formation and melting behaviour of an intramolecular DNA triple helix containing parallel T*A:T and G*G:C triplets. Our approach to induce and to stabilize a parallel triplex involves the oligonucleotide 5'-d(G4A4G4[T4]C4T4C4-[T4]G4T4G4) ([T4] represents a stretch of four thymine residues). In a 10 mM sodium cacodylate, 0.2 mM disodium EDTA (pH 7) buffer, we have shown the following significant results. (i) While in the absence of MgCl2 this oligonucleotide adopts an intramolecular hairpin duplex structure prolonged by the single strand extremity 5'-d([T4]G4T4G4), the presence of millimolar concentrations of MgCl2generates an intramolecular triplex (via double hairpin formation). (ii) In contrast to the antiparallel triplex formed by the oligonucleotide 5'-d(G4T4G4[T4]G4A4G4[T4]C4T4C4), the parallel triplex melts in a biphasic manner (a triplex to duplex transition followed by a duplex to coil transition) and is less stable than the antiparallel one. The enthalpy change associated with triplex formation (-37 kcal/mol) is approximately half that of duplex formation (-81 kcal/mol). (iii) The parallel triple helix is disrupted by increasing the concentration of KCl(>10 mM), whereas, under the same conditions, the antiparallel triplex remains stable. (iv) Netropsin, a natural DNA minor groove-binding ligand, binds to the central site A4/T4of the duplex or triplex in an equimolar stoichiometry. Its association constant K is smaller for the parallel triplex ( approximately 1 x 10(7) M-1) than for the antiparallel one ( approximately 1 x 10(8) M-1). In contrast to the antiparallel structure, netropsin binding has no apparent effect on thermal stability of the parallel triple helix.

The contribution of cytosine protonation to the stability of parallel DNA triple helices

The influence of the position of the CG.C+ triplet and the contribution of protonation at the N3 of the Hoogsteen cytosine residue on the stability of various sequences of parallel triple helices having the general composition d[(A5G)-x-(T5C)-x-(T5C)] and d[(A4G2)-x-(T4C2)-x-(T4C2)], where x is the hexaethylene glycol linker, has been determined by NMR, ultraviolet melting and absorbance spectrophotometry. The apparent pK value, i.e. the pH at which the observable has changed by 50% of its range, was typically in the range 6 to 7. However, the NMR spectra unequivocally showed that the pK of the protonated cytosine residue must be at least 9.5 for internal positions. This is five units above the pK of the free nucleotide, and represents a free energy of stabilisation from protonation of > 11.5 RT. The pK of terminal cytosine residues is much lower, in the range 6.2 to 7.2, accounting for a free energy of stabilisation from protonation of 3.6 to 6 RT. The van’t Hoff enthalpies were determined for the dissociation of the protonated triplex into the duplex+strand, and for the duplex to strand transition. The mean value for the duplexes were 23 to 27 kJ mol−1base-pair, and 25 to 30 kJ mol−1for the triplexes containing internal CG.C+triplets. Good agreement was obtained for the thermodynamic parameters by the different methods. Free energy differences for the transition between the protonated triplex and the duplex+protonated strand were calculated at 298 K. The ΔG of stabilisation of an internal CG.C triplet compared with a terminal CG.C triplet was about 6 kJ mol−1; a similar stabilisation was observed for the triplexes containing two CG.C triplets compared with those containing a single CG.C triplet. The very large stabilisation from protonation is too large to be accounted for by a single hydrogen bond, and is likely to include contributions from electrostatic interactions of the positive charge with the phosphate backbone, and more favourable interactions between neighbouring bases owing to the very different electronic properties of the protonated C.

Hydration of the dTn.dAn x dTn parallel triple helix: a Fourier transform infrared and gravimetric study correlated with molecular dynamics simulations.

We present a comparative analysis of the water organization around the dTn.dAn x dTn triple helix and the Watson-Crick double helix dTn.dAn respectively by means of gravimetric measurements, infrared spectroscopy and molecular dynamics simulations. The hydration per nucleotide determined by gravimetric and spectroscopic methods correlated with the molecular dynamics simulations shows that at high relative humidity (98% RH) the triple helix is less solvated than the duplex (17 +/- 2 water molecules per nucleotide instead of 21 +/-1). The experimental desorption curves are different for both structures and indicate that below 81% RH the triplex becomes more hydrated than the duplex. At this RH the FTIR spectra show the emergence of N-type sugars in the adenosine strand of the triplex. When the third strand is bound in the major groove of the Watson-Crick duplex molecular dynamics simulations show the formation of a spine of water molecules between the two thymidine strands.

Relative stability of triplexes containing different numbers of T.AT and C+.GC triplets

We have used DNase I footprinting to compare the stability of parallel triple helices containing different numbers of T.AT and C+. GC triplets. We have targeted a fragment containing the 17mer sequence 5'-AGGAAGAGAAAAAAGAA with the 9mer oligonucleotides 5'-TCCTTCTCT, 5'-TTCTCTTTT and 5'-TTTTTTCTT, which form triplexes at the 5'-end, centre and 3'-end of the target site respectively. Quantitative DNase I footprinting has shown that at pH 5.0 the dissociation constants of these oligonucleotides are 0.13, 4.7 and >30 microM respectively, revealing that increasing the proportion of C+.GC triplets increases triplex stability. The results suggest that the positive charge on the protonated cytosine contributes to triplex stability, either by a favourable interaction with the stacked pisystem or by screening the charge on the phosphate groups. In the presence of a naphthylquinoline triplex binding ligand all three oligonucleotides bind with similar affinities. At pH 6.0 these triplexes only form in the presence of the triplex binding ligand, while at pH 7.5 footprints are only seen with the oligonucleotide which generates the fewest number of C+.GC triplets (TTTTTTCTT) in the presence of the ligand.