Pancreatic Abnormalities Research Articles

Endoscopic Sphincterotomy for Sphincter of Oddi Dysfunction: Inefficacious Therapy for a Fictitious Disease

Endoscopic Sphincterotomy for Sphincter of Oddi Dysfunction: Inefficacious Therapy for a Fictitious Disease

A Phase I Study Using Single Agent Birinapant in Patients with Relapsed Myelodysplastic Syndrome and Acute Myelogenous Leukemia

BACKGROUNDEffective and well tolerated treatment options for patients with relapsed acute myelogenous leukemia (AML) are limited. Birinapant is a small molecule, peptidomimetic of second mitochondrial-derived activator of caspases (SMAC) that selectively targets Inhibitor of Apotosis proteins (IAPs) resulting in tumor cell apoptosis and inactivation of NF-kB. SMAC mimetics represent a novel class of anti-tumor agents and birinapant has been explored as a single agent and in combination with chemotherapy in trials in solid tumors. Based on pre-clinical response observed in a mouse model with AML, we developed an investigator initiated Phase I clinical trial using single agent birinapant in pts with relapsed AML and high risk myelodysplastic syndrome (MDS). METHODSEligible pts were >18 years old with non-M3 relapsed or refractory AML or high risk MDS refractory to a hypomethylating agent. A standard 3+3 dose escalation was planned using single agent birinapant at increasing dose levels and frequency. Subjects who did not complete at least one cycle of therapy (4 wks) or experience a dose limiting toxicity (DLT) were replaced. The primary endpoint was safety and determination a maximum tolerated dose (MTD). Secondary endpoints included pharmacokinetic (PK) and pharmacodynamics (PD) analysis as well as disease response. RESULTSFrom 12/2011 to 05/2014, 20 subjects were enrolled at the Hospital of the University of Pennsylvania and received at least one dose of study drug, 1 had MDS, 19 had AML (9 with antecedent MDS). The median age was 75 (range 36 to 80). The median number of prior treatments was 2 (range 1 to 5) and 11 patients required hydroxyurea during study treatment. No other concurrent chemotherapy was permitted.Several dose levels were tested varying the dose (17mg/m2, 22mg/m2 and 26mg/m2) and frequency (weekly, twice weekly (BIW) and 3 times weekly (TIW)) for 3 out of 4 wk cycles. Evaluable subjects have stayed on study drug for <1 wk to 45wks. Two dose levels tested resulted in a DLT. DLTs of grade 3 and grade 4 serum amylase and lipase abnormalities were observed in the 26mg/m2 weekly dose level. Pancreatic enzyme abnormalities were clinically silent and reversible with dose reduction or cessation. A DLT of Bell’s palsy was observed at 22mg/m2 BIW dosing level. No dose limiting toxicities were observed at 17mg/m2 weekly nor thus far at 17mg/m2 BIW. One subject only was treated at 17mg/m2 TIW dosing level who withdrew due to flare of underlying Behcets during week 1 of study treatment. Further exploration of TIW dosing was abandoned due to feasibility concerns. Enrollment continues at the final expanded cohort of 17mg/m2 BIW. The best disease response observed to date is stable disease at one month, 3 months and 6 months for some pts: one pt had a decline in their bone marrow blast count from 60% to 10% with single-agent birinapant.PK and PD analysis were performed at specified time points. Feasibility of measuring cIAP1 and cIAP2 inhibition as well as NFkB activity as PD response parameters for birinapant was explored. cIAP1 and cIAP2 levels were evaluated via Western blot analysis of mononuclear cells from pts; NFkB activity was assessed by imaging flow cytometry prior to and during initiation of birinapant treatment. cIAP1/cIAP2 suppression as well as inhibition of NFkB were evident. PK levels in plasma and blasts were also assessed at the same specified time points. Based on analysis to date, birinapant has excellent drug exposure and target suppression of cIAP1/cIAP2 and inhibition of NF-kB activity during the BIW schedule of 17mg/m2 for 3 out of 4 wks. CONCLUSIONSThis is the first study evaluating the safety and role of birinapant in pts with MDS and AML and first study in humans evaluating administration of this drug on a BIW dosing schedule. Observed adverse events related to study drug in this pt population include exacerbation of underlying autoimmune disease, Bell’s palsy and reversible and clinically silent elevation of amylase and lipase. Feasibility of measuring NFkB and cIAP1/2 expression as pharmacodynamics markers is established. Our study supports the safety and on tumor targeting of BIW dosing of birinapant which is currently under evaluation in combination with other agents in MDS. DisclosuresFrey:Tetralogic Pharmaceuticals: Research Funding. Minderman:Tetralogic Pharmaceuticals: Research Funding. Porter:Novartis: managed according to U Penn Policy Patents & Royalties, Research Funding. Carroll:Tetralogic: Research Funding.

KRAS and Guanine Nucleotide-Binding Protein Mutations in Pancreatic Juice Collected From the Duodenum of Patients at High Risk for Neoplasia Undergoing Endoscopic Ultrasound

Pancreatic imaging can identify neoplastic cysts but not microscopic neoplasms. Mutation analysis of pancreatic fluid after secretin stimulation might identify microscopic neoplasias in the pancreatic duct system. We determined the prevalence of mutations in KRAS and guanine nucleotide-binding protein α-stimulating genes in pancreatic juice from subjects undergoing endoscopic ultrasound for suspected pancreatic intraepithelial neoplasia, intraductal papillary mucinous neoplasms, or pancreatic adenocarcinoma. Secretin-stimulated juice samples were collected from the duodenum of 272 subjects enrolled in Cancer of the Pancreas Screening studies; 194 subjects were screened because of a family history of, or genetic predisposition to, pancreatic cancer, and 78 subjects were evaluated for pancreatic cancer (n = 30) or other disorders (controls: pancreatic cysts, pancreatitis, or normal pancreata, n = 48). Mutations were detected by digital high-resolution melt-curve analysis and pyrosequencing. The number of replicates containing a mutation determined the mutation score. KRAS mutations were detected in pancreatic juice from larger percentages of subjects with pancreatic cancer (73%) or undergoing cancer screening (50%) than controls (19%) (P = .0005). A greater proportion of patients with pancreatic cancer had at least 1 KRAS mutation detected 3 or more times (47%) than screened subjects (21%) or controls (6%, P = .002). Among screened subjects, mutations in KRAS (but not guanine nucleotide-binding protein α-stimulating) were found in similar percentages of patients with or without pancreatic cysts. However, a greater proportion of patients older than age 50 years had KRAS mutations (54.6%) than younger patients (36.3%) (P = .032); the older subjects also had more mutations in KRAS (P = .02). Mutations in KRAS are detected in pancreatic juice from the duodenum of 73% of patients with pancreatic cancer, and 50% of asymptomatic individuals with a high risk for pancreatic cancer. However, KRAS mutations were detected in pancreatic juice from 19% of controls. Mutations detected in individuals without pancreatic abnormalities, based on imaging analyses, likely arise from small pancreatic intraepithelial neoplasia lesions. ClinicalTrials.gov no: NCT00438906 and NCT00714701.

Abdominal ultrasonographic findings in acromegalic cats.

Acromegaly is increasingly recognized as a cause of insulin resistance in cats with diabetes mellitus (DM). The objective of this study was to determine if ultrasonographic changes in selected abdominal organs of acromegalic cats could be used to raise the index of suspicion for this condition. In this retrospective case-control study, medical records of cats presenting to North Carolina State University or Colorado State University from January 2002 to October 2012 were reviewed. Cats were included in the acromegaly group if they had insulin-resistant DM with increased serum insulin-like growth factor (IGF-1) concentrations and had an abdominal ultrasound examination performed with report available. A control group included age-matched cats that had abdominal ultrasound examination performed for investigation of disease unlikely to involve the kidneys, adrenal glands, pancreas or liver. Twenty-four cats were included in each group. IGF-1 concentrations in the acromegaly group ranged from >148 to 638 nmol/l. When compared with age-matched controls, cats with acromegaly demonstrated significantly increased median left and right kidney length, significantly increased median left and right adrenal gland thickness, and significantly increased median pancreatic thickness. Hepatomegaly and bilateral adrenomegaly were reported in 63% and 53% of acromegalic cats, respectively, and in none of the controls. Pancreatic abnormalities were described in 88% of the acromegalic cats and 8% of the controls. These findings indicate that compared with non-acromegalic cats, age-matched acromegalic patients have measurably larger kidneys, adrenal glands and pancreas. Diagnostic testing for acromegaly should be considered in poorly regulated diabetic cats exhibiting organomegaly on abdominal ultrasound examination.

Annular Pancreas: Culprit or Innocent Bystander

Introduction: Annular pancreas is a rare congenital anomaly that is sparingly reported with obstructive biliary symptoms. A 57-year-old female was referred to our facility with 2-week history of jaundice, dark urine, clay coloured stool, nausea, vomiting, and 25-pound weight loss over 3 months. Past history was significant for diabetes, hyperlipidemia, and cholecystectomy. Her medications include metformin, lisinopril, and simvastatin. Physical examination was unremarkable. Significant laboratory results were ALT of 599 U/L, AST of 534 IU/L, ALP of 113 U/L, total bilirubin of 14.8 μmol/L, CA 19-9 of 1498 U/mL. CT abdomen showed the head of the pancreas encasing the duodenum circumferentially (arrow), normal main pancreatic duct, liver architecture, and normal intra- and extrahepatic biliary ducts (Figure 1). Upper endoscopy revealed a focal mild concentric narrowing of the duodenum at the junction of first and second portion with normal mucosa. The endoscopic ultrasound (EUS) revealed a complete annular pancreas with normal common bile duct, main pancreatic duct (arrow), and normal duodenal ampulla (Figure 2). There were no malignant features in the duodenal mucosa, ampulla, or pancreas. Subsequently, her simvastatin was stopped with improvement of her symptoms; 3 weeks later, her LFTs were near baseline levels. EUS helps in detection of annular pancreas and also excluding coexistent pancreatobiliary malignancies and is shown to be of greater significance in detecting pancreatic structural abnormalities. Annular pancreas in adults can rarely present with obstructive symptoms. A series of 135 adult annular pancreas cases revealed only 1 case with biliary obstruction due to the pancreatic annulus. Thus, jaundice in adults with annular pancreas is usually associated with malignancies of ampulla, pancreas or the biliary tract, and, in a few cases as this one, could be just an innocent bystander.Figure 1Figure 2

Computed tomographic angiography under sedation in the diagnosis of suspected canine pancreatitis: a pilot study.

BackgroundComputed tomography (CT) is highly accurate for diagnosing pancreatitis in humans. The diagnosis of pancreatitis in dogs is based on clinical signs, laboratory findings, and ultrasonographic (US) changes. There are, however, inherent limitations in relying on laboratory and ultrasound findings for the clinical diagnosis of pancreatitis in dogs.Hypothesis/ObjectivesWe hypothesized that CT angiography would be a rapid and reliable method to confirm pancreatitis in dogs compared to ultrasonography. The aim was to describe the CT characteristics and compare them to ultrasound findings and correlate the CT appearance to the severity of the patients' clinical course.AnimalsA prospective pilot case series; 10 dogs with pancreatitis were enrolled if the history, clinical signs, laboratory, and ultrasonographic findings were indicative of pancreatitis.MethodsA 3‐phase angiographic CT was performed under sedation. Afterward, each dog had US‐guided aspirates of the pancreas collected and blood drawn for cPLi assay. Images were evaluated for portion of visible pancreas, pancreatic size and margin, pancreatic parenchyma, presence of peripancreatic changes and contrast enhancement pattern. The results were compared with outcome.ResultsAn enlarged, homogeneously to heterogeneously attenuating and contrast‐enhancing pancreas with ill‐defined borders was identified in all dogs. CT identified more features characterizing pancreatic abnormalities compared to US. Thrombi were found in 3/10 dogs. Three dogs with heterogeneous contrast enhancement had an overall poorer outcome than those with homogenous enhancement.Conclusions and Clinical Importance CT angiography under sedation was used in dogs to confirm clinically suspected pancreatitis and identified clinically relevant and potentially prognostic features of pancreatitis in dogs.

Administration of Secretin (RG1068) Increases the Sensitivity of Detection of Duct Abnormalities by Magnetic Resonance Cholangiopancreatography in Patients With Pancreatitis

Administration of secretin improves noninvasive imaging of the pancreatic duct with magnetic resonance cholangiopancreatography (MRCP). We performed a large prospective study to investigate whether synthetic human secretin (RG1068)-stimulated MRCP detects pancreatic duct abnormalities with higher levels of sensitivity than MRCP. We performed a phase 3, multicenter, baseline-controlled study of patients with acute or acute recurrent pancreatitis who were scheduled to undergo endoscopic retrograde cholangiopancreatography (ERCP) between March 26, 2008, and October 28, 2009. Patients underwent a baseline MRCP that was immediately followed by administration of RG1068 and repeat MRCP and then underwent ERCP within 30 days; they were followed up for 30 days. MRCP and ERCP images were read centrally by 3 radiologists and 2 endoscopists, respectively, who were all independent and blinded; pancreatic duct abnormalities were evaluated. The accuracy of MRCP was evaluated using ERCP as the standard. In total, 258 patients were enrolled in the study; 251 MRCP image sets were assessed, and 236 patients had evaluable ERCPs. Pancreatic duct abnormalities were observed in 60.2% of ERCP images. All radiologists identified duct abnormalities in RG1068-ciné MRCP image sets with significantly higher levels of sensitivity (P < .0001) than in images from MRCP, with minimal loss of specificity. Adverse events were reported in 38.0% of patients after MRCP and 68.1% after ERCP. Of the 55 patients who experienced a serious adverse event, 3 (1.2%) and 52 (20.5%) of the events were reported to be temporally associated with MRCP and ERCP, respectively. The adverse events most frequently considered related to RG1068 were nausea, abdominal pain, and flushing; most were mild. Compared with images from MRCP, those from RG1068-stimulated MRCP are improved in many aspects and could aid in diagnosis and clinical decision making for patients with acute, acute recurrent, or chronic pancreatitis. RG1068-enhanced MRCP might also better identify patients in need of therapeutic ERCP (ClinicalTrials.gov, Number: NCT00660335).

Role of cilia in normal pancreas function and in diseased states.

Primary cilia play an essential role in modulating signaling cascades that shape cellular responses to environmental cues to maintain proper tissue development. Mutations in primary cilium proteins have been linked to several rare developmental disorders, collectively known as ciliopathies. Together with other disorders associated with dysfunctional cilia/centrosomes, affected individuals have increased risk of developing metabolic syndrome, neurologic disorders, and diabetes. In pancreatic tissues, cilia are found exclusively in islet and ductal cells where they play an essential role in pancreatic tissue organization. Their absence or disorganization leads to pancreatic duct abnormalities, acinar cell loss, polarity defects, and dysregulated insulin secretion. Cilia in pancreatic tissues are hubs for cellular signaling. Many signaling components, such as Hh, Notch, and Wnt, localize to pancreatic primary cilia and are necessary for proper development of pancreatic epithelium and β-cell morphogenesis. Receptors for neuroendocrine hormones, such as Somatostatin Receptor 3, also localize to the cilium and may play a more direct role in controlling insulin secretion due to somatostatin's inhibitory function. Finally, unique calcium signaling, which is at the heart of β-cell function, also occurs in primary cilia. Whereas voltage-gated calcium channels trigger insulin secretion and serve a variety of homeostatic functions in β-cells, transient receptor potential channels regulate calcium levels within the cilium that may serve as a feedback mechanism, regulating insulin secretion. This review article summarizes our current understanding of the role of primary cilia in normal pancreas function and in the diseased state.

Pancreatic abnormalities detected by endoscopic ultrasound (EUS) in patients without clinical signs of pancreatic disease: Any difference between standard and Rosemont classification scoring?

BackgroundThe prevalence of nine EUS features of chronic pancreatitis (CP) according to the standard Wiersema classification has been investigated in 489 patients undergoing EUS for an indication not related to pancreatico-biliary disease. We showed that 82 subjects (16.8%) had at least one ductular or parenchymal abnormality. Among them, 18 (3.7% of study population) had ≥3 Wiersema criteria suggestive of CP. Recently, a new classification (Rosemont) of EUS findings consistent, suggestive or indeterminate for CP has been proposed. AimTo stratify healthy subjects into different subgroups on the basis of EUS features of CP according to the Wiersema and Rosemont classifications and to evaluate the agreement in the diagnosis of CP with the two scoring systems. Weighted kappa statistics was computed to evaluate the strength of agreement between the two scoring systems. Univariate and multivariate analysis between any EUS abnormality and habits were performed. ResultsEighty-two EUS videos were reviewed. Using the Wiersema classification, 18 subjects showed ≥3 EUS features suggestive of CP. The EUS diagnosis of CP in these 18 subjects was considered as consistent in only one patient, according to Rosemont classification. Weighted Kappa statistics was 0.34 showing that the strength of agreement was ‘fair’. Alcohol use and smoking were identified as risk factors for having pancreatic abnormalities on EUS. ConclusionsThe prevalence of EUS features consistent or suggestive of CP in healthy subjects according to the Rosemont classification is lower than that assessed by Wiersema criteria. In that regard the Rosemont classification seems to be more accurate in excluding clinically relevant CP. Overall agreement between the two classifications is fair.

Gastrointestinal Pathology in Juvenile and Adult CFTR-Knockout Ferrets

Cystic fibrosis (CF) is a multiorgan disease caused by loss of a functional cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel in many epithelia of the body. Here we report the pathology observed in the gastrointestinal organs of juvenile to adult CFTR-knockout ferrets. CF gastrointestinal manifestations included gastric ulceration, intestinal bacterial overgrowth with villous atrophy, and rectal prolapse. Metagenomic phylogenetic analysis of fecal microbiota by deep sequencing revealed considerable genotype-independent microbial diversity between animals, with the majority of taxa overlapping between CF and non-CF pairs. CF hepatic manifestations were variable, but included steatosis, necrosis, biliary hyperplasia, and biliary fibrosis. Gallbladder cystic mucosal hyperplasia was commonly found in 67% of CF animals. The majority of CF animals (85%) had pancreatic abnormalities, including extensive fibrosis, loss of exocrine pancreas, and islet disorganization. Interestingly, 2 of 13 CF animals retained predominantly normal pancreatic histology (84% to 94%) at time of death. Fecal elastase-1 levels from these CF animals were similar to non-CF controls, whereas all other CF animals evaluated were pancreatic insufficient (<2 μg elastase-1 per gram of feces). These findings suggest that genetic factors likely influence the extent of exocrine pancreas disease in CF ferrets and have implications for the etiology of pancreatic sufficiency in CF patients. In summary, these studies demonstrate that the CF ferret model develops gastrointestinal pathology similar to CF patients.

Comparative MRI Analysis of Morphologic Patterns of Bile Duct Disease in IgG4-Related Systemic Disease Versus Primary Sclerosing Cholangitis

The purpose of this study was to perform a retrospective MRI-based comparative analysis of the morphologic patterns of bile duct disease in IgG4-related systemic disease (ISD, also called autoimmune pancreatitis) compared with primary sclerosing cholangitis (PSC) and the autoimmune liver diseases autoimmune hepatitis and primary biliary cirrhosis. This study included 162 consecutively registered patients (47 with ISD, 73 with PSC, and 42 with autoimmune liver diseases). Two abdominal radiologists retrospectively reviewed MR images in consensus. Imaging findings on the bile ducts, liver, pancreas, and other organs were analyzed to establish disease patterns. ISD was associated with contiguous thickening of intrahepatic and extrahepatic bile ducts (p<0.001), pancreatic parenchymal abnormalities (p<0.001), renal abnormalities (p<0.001), and gallbladder wall thickening (p<0.03). The severity of common bile duct wall thickness was significantly different in ISD (p<0.001). The mean single wall thickness in the ISD group was 3.00 (SD, 1.47) mm, in the PSC group was 1.89 (SD, 0.73) mm, and in the autoimmune liver disease group was 1.80 (SD, 0.67) mm. PSC was associated with liver parenchymal abnormalities (p<0.001). We did not find statistical significance between the three groups in location (p=0.220) or length (p=0.703) of extrahepatic bile duct strictures, enhancement of bile duct stricture (p=0.033), upper abdominal lymphadenopathy, or retroperitoneal fibrosis. Although presence of intrahepatic bile duct stricture was statistically significant when all three groups were compared, it was not useful for differentiating ISD from PSC. The presence of continuous as opposed to skip disease in the bile ducts, gallbladder involvement, and single-wall common bile duct thickness greater than 2.5 mm supports a diagnosis of ISD over PSC. ISD and PSC could not be differentiated on the basis of location and length of common bile duct stricture.

Pseudopancreatitis on computed tomography in a patient with isolated blunt head trauma: a case report

IntroductionComputed tomography is commonly used to exclude occult injuries in patients with trauma, but imaging can reveal findings that are of uncertain etiology or clinical significance. We present a case of unsuspected pancreatic abnormality in a female patient with trauma who sustained an isolated blunt head injury.Case presentationA 25-year-old female Caucasian patient sustained massive blunt and penetrating head trauma, secondary to a large object penetrating through the vehicle windshield. Based on the mechanism of injury and clinical evaluation, it was felt to be an isolated head injury. However, computed tomography of her abdomen revealed an occult, intra-abdominal finding of significant pancreatic enlargement and peripancreatic fluid. There was no computed tomography evidence of parenchymal pancreatic laceration. The appearance of her pancreas on computed tomography was identical to that of acute pancreatitis or low-grade pancreatic injury, but her clinical history and laboratory values were not consistent with this, hence the term ‘pseudopancreatitis’. Later surgery for organ donation confirmed diffuse pancreatic and peripancreatic edema, but no hematoma, contusion or other evidence for direct traumatic injury. This was an isolated intra-abdominal abnormality.ConclusionThe routine use of computed tomography in patients who have sustained trauma has led to increasing detection of unexpected findings. Clinical information such as mechanism of injury and blood work, along with careful evaluation of ancillary imaging findings (or lack of), is important for the provision of an appropriate differential diagnosis. We discuss the possible mechanism and differential diagnosis of an isolated pancreatic abnormality in the setting of non-abdominal trauma, which includes shock pancreas, overhydration, traumatic pancreatic injury and pancreatitis secondary to other etiologies.

Recent advances in 3D computed tomography techniques for simulation and navigation in hepatobiliary pancreatic surgery

A few years ago it could take several hours to complete a 3D image using a 3D workstation. Thanks to advances in computer science, obtaining results of interest now requires only a few minutes. Many recent 3D workstations or multimedia computers are equipped with onboard 3D virtual patient modeling software, which enables patient-specific preoperative assessment and virtual planning, navigation, and tool positioning. Although medical 3D imaging can now be conducted using various modalities, including computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), and ultrasonography (US) among others, the highest quality images are obtained using CT data, and CT images are now the most commonly used source of data for 3D simulation and navigation image. If the 2D source image is bad, no amount of 3D image manipulation in software will provide a quality 3D image. In this exhibition, the recent advances in CT imaging technique and 3D visualization of the hepatobiliary and pancreatic abnormalities are featured, including scan and image reconstruction technique, contrast-enhanced techniques, new application of advanced CT scan techniques, and new virtual reality simulation and navigation imaging.

Postnatal manipulation of Pax6 dosage reverses congenital tissue malformation defects

Aniridia is a congenital and progressive panocular condition with poor visual prognosis that is associated with brain, olfactory, and pancreatic abnormalities. Development of aniridia is linked with nonsense mutations that result in paired box 6 (PAX6) haploinsufficiency. Here, we used a mouse model of aniridia to test the hypothesis that manipulation of Pax6 dosage through a mutation-independent nonsense mutation suppression strategy would limit progressive, postnatal damage in the eye. We focused on the nonsense suppression drugs 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (ataluren) and gentamicin. Remarkably, we demonstrated that nonsense suppression not only inhibited disease progression but also stably reversed corneal, lens, and retinal malformation defects and restored electrical and behavioral responses of the retina. The most successful results were achieved through topical application of the drug formulation START (0.9% sodium chloride, 1% Tween 80, 1% powdered ataluren, 1% carboxymethylcellulose), which was designed to enhance particle dispersion and to increase suspension viscosity. These observations suggest that the eye retains marked developmental plasticity into the postnatal period and remains sensitive to molecular remodeling. Furthermore, these data indicate that other neurological developmental anomalies associated with dosage-sensitive genetic mutations may be reversible through nonsense suppression therapeutics.

Hepatitis and Pancreatitis Associated with the Use of Trimetropim Sulfamethoxazole: A Case Report

Purpose/Introduction: Trimetropim sulfamethoxazole (TMP-SMX) is a widely prescribed antibiotic. Both hepatitis and pancreatitis are uncommon side effects, and reports in non-immunosuppressed patients are rare. To our knowledge, there are only two previous case reports of concomitant hepatitis and pancreatitis occurring in an inmunocompetent patient. Case Presentation: A 65-year-old male with previous history of coronary artery disease, hypertension and dyslipidemia presented to the emergency room with abdominal pain, jaundice and a skin rash. The patient had been started on TMP-SMX for otitis media two weeks before arriving to the emergency department. During this period of time, the patient presented with nausea, vomiting, weight loss and fever. On physical examination, he was found to be jaundice, and a generalized non-pruritic macular rash was noticed. There was no history of alcohol use. On admission, liver function test and pancreatic markers were elevated. ALT peaked to 510, AST to 445 U/L, total and direct bilirubin to 19 and 8.9 mg/dL respectively, lipase to 578 U/L and amylase 102 U/L, albumin was decreased and coagulation studies were normal, and remained normal during and after hospitalization. Other causes of pancreatitis were rule out. Triglycerides were within normal limits and calcium and SPEP were normal. Acute viral hepatitis, CMV and EBV serology were negative, and titers of autoimmune markers were normal. Abdominal CT did not show hepatic or pancreatic abnormalities, and the abdominal ultrasound did not show gallstones or dilation of the intrahepatic ducts. Upper endoscopy showed esophagitis and gastritis. Pancreatitis and hepatitis were managed with fluid resuscitation and supportive care. The patient improved clinically, a decrease in lipase and aminotransferase was noted during hospitalization and a gradual decrease of bilirubin occurred after hospitalization. Discussion: Clinical observation is an important tool to identify adverse effects from medications. In this particular case, we have a Naranjo score of six (probable drug reaction). The mechanism of idiosyncratic adverse effects to TMP-SMX is not clearly understood, but inmuno-allergic mechanisms have been proposed. This case underlines the importance of considering commonly used medications as the causative event of severe medical conditions.

A case of Shwachman–Diamond syndrome

Shwachman–Diamond syndrome (SDS) is an autosomal recessive disorder (OMIM 260400), characterized by exocrine pancreatic insufficiency, skeletal abnormalities and bone marrow (BM) dysfunction, with a risk, as high as 30%, to develop myelodysplastic syndrome and/or acute myeloid leukaemia (MDS/AML). The SBDS gene (OMIM 607744) is localized on chromosome 7 at the band q11 and mutations of this gene are found in 90% of patients. Direct sequencing of whole exon 2 and flanking intronic regions of the SBDS gene was performed on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, USA) using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The forward (F) and reverse (R) primers for amplifying exon 2 are AAATGGTAAGGCAAATACGG (2Fa), AGACCTCGATGAAGTTCT-GC (2Fb) and ACCA AGTTCTTTATTATTAGAAGTGAC (2R). We described a 14 years old boy who presented with skeletal system abnormalities (Legg-Calve-Perthes syndrome, congenital coxa vara and genu valgum deformity), short stature, chronic dydpepsia, neutropenia and thrombocytopenia. Abdominal CT of patient showed congenital lipomatosis of pancreas and spine bone density shows osteoporosis. Direct sequencing for whole exons including intron-exon boundaries of patient showed two heterozygous mutations, c. [183_184TA>CT] + [258+2T>C]. We treated the patient with pancreatin (Now Foods Pancreatin 1T=Lipase 9,000/Amylase 50,000/Protease 50,000 USP units) and Dicamax (1T=Ca. carbonate 1,250 mg and cholecalciferol 1,000 IU). We has observed for hematologic abnormality and prepared for bone marrow transplantation. We report a child with diverse clinical manifestations of SDS including short stature, chronic dydpepsia, skeletal system abnormalities, and neutropenia; the clinical diagnosis was confirmed by genetic analysis for the second time in Korea.

EUS And s-MRCP Findings In Asymptomatic Subjects with Chronic Pancreatic Hyperenzymemia

Context A long-standing increase of serum pancreatic enzymes in asymptomatic subjects is considered a benign idiopathic condition called “non-pathological chronic pancreatic hyper­enzymemia” (CPH). However, recent studies showed secretin-MRCP (s-MRCP) has brought to light abnormal pancreatic findings in a significant proportion of these subjects. Objective To evaluate pancreatic morphological abnormalities using s-MRCP and EUS in CPH patients. Methods Consecutive patients affected by CPH were investigated with s-MRCP and EUS. EUS findings were compared with consecutive age- and sex-matched controls who underwent EUS investigation for unrelated to pancreaticobiliary disease (CTR). Results Fifty-five CPH subjects and 55 CTR patients were enrolled. Abnormal s-MRCP pancreatic findings were present in 23 CPH cases (41.8%): 10 chronic pancreatitis, according to Cambridge classification; 5 pancreas divisum; 3 pancreatic cyst; 5 Vater’s papilla dysfunction. Pathological EUS pancreatic findings were present in 28 CPH cases (50.9%): 7 pancreatic cystic lesion, 5 pancreas divisum, 1 papillitis, 1 NET, 14 chronic pancreatitis (CP) defined by presence of “consistent with CP” or “suggestive of CP” findings using Rosemont criteria. All cases of CP who undergone s-MRCP had pathological EUS findings suggestive for CP too. Normal EUS findings were more significantly frequent in control patients (n=45) than CPH patient (n=27) (P<0.05). The two groups have same frequencies in detection of cystic lesions, pancreas divisum, papillitis, NET, but chronic pancreatitis was more common in CPH (25.5% vs . 7.3%; P<0.05). Conclusions About half of the patients with asymptomatic chronic pancreatic hyper­enzymemia had some pancreatic abnormalities using s-MRCP and EUS. Both these procedures should characterize the diagnostic work-up of these subjects before the hyperenzymemia can be defined with certainly as non-pathological or benign.

North American Ginseng (Panax quinquefolius) Prevents Hyperglycemia and Associated Pancreatic Abnormalities in Diabetes

North American ginseng (NAG) has received increasing attention as an alternative medicine for the treatment of diabetes. Extract of the NAG root has been reported to possess antidiabetic properties, but the underlying mechanisms for such effects have not been identified. Here we investigated the effects of NAG root extract on type 1 and 2 diabetes and the underlying mechanisms involved for such effects. Type 1 [C57BL/6 mice with streptozotocin (STZ)-induction] and type 2 (db/db) diabetic models were examined. Groups of diabetic mice (both type 1 and 2) were treated with alcoholic extract of the NAG root (200 mg/kg BW/day, oral gavage) for 1 or 2 months following onset of diabetes. Ginseng treatment significantly increased the body weight in type 1 diabetic animals in contrast to the type 2 model, where it caused diminution of body weight. Blood glucose and glycated hemoglobin levels diminished in the diabetic groups of both models with NAG treatment. Interestingly, plasma insulin and C-peptide levels were significantly increased in the STZ-diabetic mice, whereas they were reduced in the db/db mice following NAG treatment. Histological and morphometric analyses (islet/pancreas ratio) of the pancreas revealed an increase in the islet area following the treatment compared to both the untreated diabetic groups. These data indicate that NAG possibly causes regeneration of β-cells resulting in enhanced insulin secretion. On the other hand, in type 2 diabetes, the additional effects of NAG on body weight might have also resulted in improved glucose control.

Imaging techniques in pancreatic cancer screening: Preliminary results from the PanGen-FAM registry.

1529 Background: The incidence of pancreatic cancer (PC) is low, thus screening is recommended for individuals considered to be at high risk. These include members of families with ≥ 2 relatives with PC (FPC), Peutz Jegher syndrome, hereditary breast/ovarian cancer (HBOC), familial atypical multiple mole melanoma and Lynch syndrome. Previous studies have shown that non-invasive precursor lesions, such as intraductal papillary mucinous neoplasm (IPMN) and pancreatic intraepithelial neoplasia (PanIN) are more common and of a higher invasive grade in patients with a family history of PC. Methods: Baseline screening consisted of endoscopic ultrasound (EUS) and computed tomography (CT) and magnetic resonance imaging (MRI). FNA-EUS was performed when mass lesions or cysts ≥1 cm in size were encountered. The possibility of surgical intervention or ongoing clinical observation was discussed by a multidisciplinary team in the case of abnormal findings. Furthermore Circulating Tumor Cells (CTC) in peripheral blood as a diagnostic marker was assessed. Thirty-five individuals from FPC and HBOC families were screened between October 2011and December 2012. Results: The most frequent abnormal findings by EUS were parenchymal changes found in chronic pancreatitis (hyperechoic foci, echogenic strands, lobularity, cysts). Overall 13 (41%) patients showed at least 1 of these changes; of note, 7 patients were from the same FPC family. Four patients were diagnosed with cystic lesions by EUS; two lesions were confirmed by MRI but not by CT, one lesion was confirmed by both MRI and CT and was compatible with a mucinous tumor &lt; 1cm in diameter and one lesion was detected only by EUS. One patient with cystic lesion &gt;1 cm in size underwent EUS-FNA and the cytology showed benign celularity. One patient has a solid lesion, and it was a neuroendocrine tumor. The remaining patients with cystic lesions were proposed for ongoing close clinical observation. CTC have not been detected in 54 patients tested. Conclusions: A high prevalence of pancreatic abnormalities was found in patients from FPC families. Preliminary data suggest that EUS is the most sensitive method to detect small tumors and premalignant lesions.

Endoscopic Ultrasound and Magnetic Resonance Cholangiopancreatography in Patients with Idiopathic Acute Pancreatitis

The efficacy of endoscopic ultrasonography (EUS) to diagnose idiopathic acute pancreatitis has been demonstrated but that of magnetic-resonance cholangiopancreatography (MRCP) remains unclear. The aim of our study was to prospectively compare the results of EUS and MRCP to diagnose idiopathic acute pancreatitis when performed later after an acute attack. All patients admitted to our center for acute pancreatitis over a 2-year period received first-line investigations that included medical history, standard biological measurements, abdominal ultrasound, and computerized tomography. If no etiology was found, second-line investigations were scheduled at 2 months (or more if there was severe pancreatitis), which included clinical examinations, biological parameters, EUS, and MRCP. A total of 128 consecutive patients were included (male: 80, mean age: 55.3 years). After first-line investigations, 41 patients with idiopathic acute pancreatitis underwent second-line investigations and were followed-up (38 patients had both EUS and MRCP). EUS and/or MRCP led to recognize a possible etiology of pancreatitis in 19 patients (50 %). The diagnostic yield for EUS was higher than for MRCP (29 vs. 10.5 %). EUS more accurately detected biliary stones whereas MRCP identified pancreatic duct abnormalities, such as intraductal papillary mucinous neoplasm of the pancreas or chronic pancreatitis. The combination of EUS and MRCP, when performed later after idiopathic acute pancreatitis, revealed 50 % of etiologies. The association of these two procedures and the subsequent follow-up reduced the rate of idiopathic pancreatitis by ~66 %.