Palisade Parenchyma Research Articles

Catalyzing Germination: Exploring Scarification and Hot Water Treatments for Dormancy Breaking and Enhanced Storage in Ficus Benjamina L., Thespesia populnea L., Phyllanthus emblica L., Tectona grandis L.f. seeds

A seed is a significant stage in the plant life cycle and is often referred to as the dispersal unit of the plant. There are two types of seeds: dormant seeds and non-dormant seeds. A dormant seed is one that does not have the capacity to germinate within a definite period under any combination of normal, physical and environmental factors. The other type is favourable for germination and when the seed becomes non-dormant, the circumstances that break dormancy and the location of water gaps in seeds, remain unclear. In the present study, we consider the adaptive role of impermeable coats in the seeds of Ficus Benjamina L., Thespesia populnea L., Phyllanthus emblica L. and Tectona grandis L.f. The study was particularly designed to analyze the conditions that break dormancy and the location of the primary water gap during dormancy breaking. Each seed was treated separately to break its dormancy and it was observed that water entered only through the lens due to the dislodgement of the palisade layer. Additionally, the storage life of Ficus Benjamina L. and Phyllanthus emblica L., seeds was extended as evidenced by the analysis of low moisture content decreasing from 6.02% to 5.31%. This study concludes that the impermeable seed coat of seeds with low moisture content increases storage life and regulates seed imbibition, thus influencing germination with the growing season.

A rapid freezing method to determine tissue layer thickness in drought-stressed leaves.

Plants have been affected by water stress ever since they settled on dry land. In severe and persisting drought, plant leaves are wilting. However, a documentation at the anatomical level of the minute changes that occur before wilting is challenging. On the other hand, understanding the anatomical alteration in plant leaves with respect to water stress provides a stronger basis to study molecular and submolecular processes through which plants enhance drought tolerance. In this work, we applied an affordable method to visualise mesophyll layers of Arabidopsis thaliana cell lines without preparation steps that would alter the volume of the cells. We rapidly plunge-froze the leaves in liquid nitrogen, cut them while in the N2 bath, and immediately imaged the mesophyll cross sections in a scanning electron microscope. We applied a reduction of watering from 60 to 40 to 20mL per day and investigated two time points, 7 and 12 days, respectively. Interestingly, the overall thickness of leaves increased in water stress conditions. Our results showed that the palisade and spongy layers behaved differently under varying watering regimes. Moreover, the results showed that this method can be used to image leaf sections after drought stress without the risk of artefacts or swelling caused by contact to liquids as during chemical fixation.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Variations in Physiological and Biochemical Characteristics of Kalidium foliatum Leaves and Roots in Two Saline Habitats in Desert Region

Salt stress is a key environmental factor that has adverse effects on plant growth and development. High salinity induces a series of structural and functional changes in the morphological and anatomical features. The physiological and biochemical changes in K. foliatum in response to salt stress in natural environments are still unclear. Based on this, this study compared and analyzed the differences in the physiological and biochemical indicators between the leaf and root tissues in high-salt and low-salt habitats, selecting K. foliatum as the research object. The results showed that the chlorophyll contents in the leaves of K. foliatum decreased in the high-salt habitat, while the thicknesses of the upper and lower epidermises, as well as the thicknesses of the palisade tissue, significantly increased. The high-salt environment led to decreases in the N and P contents in the leaves and root tissues of K. foliatum, resulting in changes in the stoichiometric ratio of elements. The concentrations of C, N, and P in the roots of K. foliatum were lower than those in the leaves. The accumulation of Na+ in the K. foliatum roots was greater than that in the leaves, and the roots could promote the transport of sodium ions to the leaves. The contents of starch and soluble sugar in the leaves showed higher proportions in the high-salt habitat than in the low-salt habitat, while the changes in the roots and leaves were the opposite. As the salt content increased, the proline contents in the leaves and roots of K. foliatum significantly increased, and the proline contents in the roots of K. foliatum were lower than those in the leaves. The leaves and roots exhibited higher levels of peroxidase and superoxide enzymes in the high-salinity habitat than in the low-salinity habitat. The superoxide dismutase (SOD) activity of the K. foliatum leaves and catalase (CAT) activity of the roots were the “central traits” in the high-salt habitat. In the low-salt habitat, the leaf malondialdehyde (MDA) and root C/N were the central traits of the leaves and roots, indicating that K. foliatum adapts to changes in salt environments in different ways.

Coupling of leaf economic and hydraulic traits of desert plants of different life forms in the Ebinur Lake Basin

The functional traits of leaves and their internal trade-offs have been the focus of ecologists as a powerful basis for revealing plant physiology and function, and ecological strategies. The consistency of the coupled relationship between leaf economic traits and hydraulic traits among trees, shrubs, and herbs in similar ecological environments has seldom been systematically explored. We explored coupling in desert plants of different life forms and their response to the soil environment in two tree species (Populus euphratica Oliv. and Haloxylon ammodendron (C. A. Mey.) Bunge)), the shrub species (Nitraria tangutorum Bobrov and Halimodendron halodendron (Pall.) Dum. Cours.), and herbaceous species (Alhagi sparsifolia Shap. and Apocynum venetum L.) in the transition zone of the desert in the Ebinur Lake Basin, Xinjiang, China. Leaf and soil samples were collected to determine plant leaf economic traits, hydraulic traits, and soil factors. Regarding leaf economic traits, trees had higher in leaf mass per area and leaf thickness (LT). The leaf nitrogen and phosphorus contents were higher in shurbs than those in trees and herbs. Regarding hydraulic traits, shrubs had higher palisade parenchyma thickness (PT) and vein density (VD), whereas herbs had higher stomatal length (SL), spongy parenchyma thickness (ST), and leaf water potential (Ψ). In herbs, SL, ST, and Ψ had advantages, whereas PT/ST was the lowest. This study revealed an association between leaf economic and hydraulic traits in plants of different life forms in a similar ecological environment and provides a scientific basis for plant conservation strategies and ecosystem services value assessment and use in arid zones.

Foliar plasticity of Erythroxylum tortuosum (Erythroxylaceae) in the Cerrado: a representative neotropical genus with medicinal importance

Abstract Erythroxylum is common in the Brazilian Cerrado. Species from this genus have ecological, pharmacological and popular medical importance. Based on this information, the aims of this study was to perform a descriptive and quantitative morphoanatomical study of Erythroxylum tortuosum leaves present in two environments: cerrado sensu stricto and campo rupestre. To carry out these studies, 24 fully developed leaves were collected and fixed from individuals across both environments. For the quantitative anatomy study, the following measurements were made: leaf area, length, width and mass; stomatal density; polar and equatorial diameter of the stomata; thickness of the leaf blade, mesophyll, epidermis and cuticles on the adaxial and abaxial surfaces; and thickness of the spongy and palisade parenchyma; specific leaf area, leaf mass area and foliar tissue density. This species shows a bald and uniseriate epidermis when viewed in cross section. Stomata are paracytic and occur only on abaxial surfaces. The mesophyll is dorsiventral type, with a dense vascular system, and the vascular bundle is collateral type. The general pattern of the veins is pinnate camptodrome and brochidodrome, with dense veins and pseudosecondary ribs. Significant differences were found for almost all analysed variables, suggesting that different environmental conditions may influence plant development.

Pharmacognostic study of Catharanthus roseus (L.) G. Don, growing in Uzbekistan

In the article, the morpho-anatomical structure of the leaf and stem of Catharanthus roseus species distributed in the local conditions of Uzbekistan was studied, and it was determined that biologically active substances are found in the leaf mesophyll and bark parenchyma of the stem. The following diagnostic characters were determined: in the leaf – dorsiventral type of leaf mesophyll; thick-walled outer walls of the epidermis; amphistomatic leaves; not submerged stomata; chlorophyll-bearing palisade and spongy parenchyma; closed collateral type of conduction bundles; the presence of numerous idioblasts; in the stem there is a more lignified, non-tufted type of structure; libriform extensive; radial rays elongated and short; phloem is extensive, located between the crustal parenchyma and the libriform; the core is not wide, represented by large and small round-oval, thin-walled parenchyma cells containing hydrocyte cells and numerous laticifers. The content of moisture, ash, extractives extracted by heteropolar extractants was also studied, determined by pharmacopoeial methods to establish authenticity and prepare draft regulatory documentation for plant raw materials.

TAXONOMIC STUDY OF SOME EUPHORBIA L. SPECIES BY LEAF ANATOMICAL AND MOLECULAR CHARACTERISTICS USING RBCL AND MATK GENES

A current study assessed the leaf anatomical and molecular characteristics of eight species of the genus Euphorbia (Euphorbiaceae), i.e., E. craspedia Boiss, E. denticulate Lam., E. falcate L., E. hirta L., E. helioscopia L., E. peplus L., E. kansuensis L., and E. macroclada Boiss ,collected from several districts of the Middle and Northern Iraq. The anatomical result refers to a uniseriate epidermis (single layer), except for the species E. kansuensis and E. peplus, wherein the upper epidermis recorded a variable thickness among the species. The highest epidermis thickness (28 μm) was visible in the species E. falcata, while the mean decreased to 17 μm in the species E. helioscopia. Based on the anatomical attributes, further species groupings resulted in two. In the first group, the leaf’s crosssection was unifacial, with the palisade tissues on both sides of the blade. This group included E. hirta, E. peplus, E. macroclada?, and E. denticulata. Contrastingly, the second group has a bifacial leaf, with the mesophyll distinguished as palisade and spongy. The said group comprised the E. craspedia and E. helioscopia species. In the genus Euphorbia species, the study of the genetic relationship continued according to the sequencing method of rbcl and matk genes. The results revealed that most species samples showed light bands, characterized by their intensity ranging from 800 to 1000 bp. The highest recorded genetic affinity through the rbcl gene emerged in E. denticulata and E. kansuensis, whereas the lowest was in E. macroclada and E. hirta. Based on matk gene results, the highest genetic affinity observed resulted in the species E. kansuensis and E. denticulata with an average value of 0.0160, with the lowest recorded in the species E. helioscopia and E. peplus with a value of 0.1307.

Effect of growth medium composition on the viability and genetic stability of Chrysanthemum × morifolium Ramat. explants under in vitro cold storage conditions

Cultivation of plants at low positive temperatures is promising for the in vitro preservation of valuable Chrysanthemum × morifolium Ramat. varieties. The study aims to examine the effect of chlorocholine chloride concentrations in a specialized medium on the viability and the physiological and morpho-anatomical parameters of chrysanthemum plants (Excel, Sheer Purple, and William Seward varieties), as well as their genetic stability after 12 months of cold storage under in vitro gene bank conditions. In vitro microshoot tips (without leaves) were placed on a 1/4 Murashige and Skoog medium supplemented with 60.0 g/L sucrose and 0.2–0.8 g/L chlorocholine chloride. The explants were stored in cooling chambers at a temperature of 4 °C. After 12 months of preservation, a reduction was observed in growth kinetics with increasing concentration of chlorocholine chloride in the medium. The viability of explants decreased from 96 to 91% at higher concentrations of chlorocholine chloride. The effective photochemical quantum yield of photosystem II decreased more than twice under cold storage conditions as compared to the control. Several histological features were identified in the leaves of in vitro explants cold-stored in the gene bank: decreased in leaf thickness and mesophyll density in leaf blades, degradation of palisade tissue, and a high degree of transpiration regulation. The SSR and ISSR analyses were used to show that the microshoots of the examined chrysanthemum varieties were identical to the original plants following in vitro cold storage. The conducted studies revealed that the presence of 0.6–0.8 g/L chlorocholine chloride in the medium reduces the growth kinetics of explants while maintaining their high viability and genetic stability.

Asymmetry of leaf internal structure affects PLSR modelling of anatomical traits using VIS-NIR leaf level spectra

ABSTRACT Leaf traits can be used to elucidate vegetation functional responses to global climate change. Pigments, water and leaf mass per area are the most used traits. However, detailed anatomical traits such as leaf thickness, the thickness of palisade and spongy parenchyma are often neglected, although they affect leaf physiological function and optical properties. Our aim was to produce partial least squares regression (PLSR) models for estimating leaf traits using biconical reflectance factor (BCRF). We established that estimation of leaf anatomical properties differs when using BCRF obtained from the upper and lower surface of the leaf. PLSR explained that 90% of the variability was based on total chlorophyll content (R2 = 0.95), spongy parenchyma to leaf thickness ratio (R2 = 0.94), equivalent water thickness (R2 = 0.93) and leaf mass per area (R2 = 0.91) or leaf thickness (R2 = 0.90). We conclude that internal asymmetry in leaf structure affects significantly leaf optical properties and should not be neglected in radiative transfer modelling at the leaf level and when upscaling leaf properties to the canopy.

Anatomical and physiological consequences of beech leaf disease in Fagus grandifolia L.

AbstractBeech leaf disease (BLD) is a foliar disease of American Beech (Fagus grandifolia L.) causally linked to the nematode Litylenchus crenatae mccannii and has rapidly spread throughout central and northeastern North America. This study aimed to characterize the anatomical and physiological differences between asymptomatic and symptomatic leaves to provide evidence for a mechanistic link between abnormal leaf development associated with BLD and the long‐term decline of affected trees. We found that leaf mass per area (LMA) and leaf thickness were 45% and 249% higher in symptomatic regions, respectively. The difference in leaf thickness was largely attributable to the spongy mesophyll being 410% thicker in symptomatic as compared with asymptomatic regions of the leaves, but palisade mesophyll and abaxial epidermal tissues were also thicker in symptomatic regions. While major vein density was not significantly different, minor vein density was significantly lower in symptomatic regions, suggesting that the effects on leaf development occur after the formation and initial development of first‐ and second‐order veins. Stomatal density was also lower in symptomatic leaves. Maximum photosynthetic rates were approximately 61% lower in symptomatic leaves and respiration rate increased as the percentage of affected leaf tissue increased. Collectively, our data show reduced photosynthetic capacity, increased respiration rates, and higher leaf construction costs, which will likely have a negative, long‐term impact on the carbon balance of trees affected by BLD.

Anatomical Structure of the Calyx Transverse Section of Some Species of the Hedysarum L. Genus (Fabaceae) From Central Asia

This research investigates the anatomical structure of the calyx transverse section of 11 species of the Hedysarumgenus from Central Asia. The analysis revealed that all species exhibit a more or less smooth or slightly convoluted upper surface and a lower surface with varying degrees of tuberculation. Regarding the mesophyll structure of the calyx, the studied species are mainly divided into two groups: in H. pumilum, H. severtzovii, H. micropterum, and H. wrightianum, the mesophyll is differentiated into lower palisade and upper spongy layers, which is considered an adaptive and progressive feature for the calyx; in other species, an undifferentiated mesophyll is observed, regarded as a primitive trait. Furthermore, the formation of large and giant idioblasts is characteristic of all studied species, located on the lower side of the calyx (directly beneath the lower epidermis), along with a 2-4-layered chlorenchyma beneath the upper epidermis, representing adaptive features.

The effect of heavy metal-containing wastewater sediment on the microanatomical characteristics of the leaves and stem of Salix viminalis L.

A comparative microanatomical study of Salix viminalis L. shoots was performed in order to get an idea of the effect of toxic elements stress on the microanatomical parameters of the shoot (leaves, stem). The examined Salix viminalis L. shoots originated from the Lovász-zug suburban area of Debrecen city, where a sewage settling pond was formerly operated as a secondary biological purification unit. The control Salix triandra x viminalis L. 'Inger' samples originated from the Nyíregyháza experiment with uncontaminated soil. As a result of our research, we can state the following in the case of the leaf samples grown on contaminated soil: the leaf lamina thickness decreased; the extent of the palisade parenchyma decreased; the extent of the intercellular spaced increased inside the spongy parenchyma; the width and the height of the main veins increased; the extent of the collenchyma bordering the main vein increased; the stomatal density increased both in the case of the adaxial and abaxial epidermis; the size of the stomas decreased. In the case of the stem samples, we observed the following: in the case of the samples grown on contaminated soil the extent of the primer cortex increased; the cell wall of the cells building the sclerenchimatic fibers thickened; the number of Ca-oxalate crystal rosettes and sclereids increased; the extent of secondary phloem increased; the lumen of the tracheas in the secondary xylem increased; the average width of the annual rings decreased; the extent of the central stele of the stem increased.

Aphid Resistance Evaluation and Constitutive Resistance Analysis of Eighteen Lilies.

Lilies (Lilium spp.) are famous bulb flowers worldwide, with high ornamental value. Aphid damage has seriously constrained the development of the lily industry. In this study, the aphid resistance of 16 lily cultivars and 2 wild lily species was characterized in the field and greenhouse. Leaf color parameters, stomatal density and size, thickness of leaf layers, leaf waxy content, and leaf water content were determined to explore the constitutive resistance of lilies. The results show that there was a significant positive correlation between the number of aphids in the field and in the greenhouse (p ≤ 0.05, r = 0.47). This indicated that the level of aphid infestation in both the field and the greenhouse is generally consistent across different types of lily plants. Among these 18 lilies, 'Palazzo', 'Nymph', 'Cameleon' and L. lancifolium were resistant to A. gossypii, while 'Black Beauty' and 'Magnefique' had poor resistance. The correlation analysis results showed that the number of aphids was negatively correlated with leaf abaxial surface a*, stomatal size, water content, and thickness of leaf palisade tissue and positively correlated with leaf distal axial surface b*, C*, and waxy content. Among them, the correlation between the number of aphids and the thickness of leaf palisade tissue reached a significant level (p ≤ 0.05, r = -0.521). This indicated that the thickness of the palisade tissue of lily leaves might be an important factor influencing the proliferation of aphids. This study not only screened out aphid-resistant lilies but also established a crucial research foundation for the targeted breeding and molecular breeding of lilies with aphid resistance.

Functional leaf traits in congeneric species of tree communities in central Amazon

The Amazon is a Neotropical region that features various types of phytophysiognomies subject to multiple environmental filters. The Amazonian Savanna and Ombrophilous Forest areas support complex ecosystem functions and are sensitive to biotic and abiotic disturbances. The low availability of nutrients and water, along with the high solar exposure these vegetations experience, impose rigorous environmental filters that affect species distribution. Plant species with structural and functional adaptations can occur in specific locations due to environmental characteristics. We investigated potential variations in the functional leaf traits of congeneric species of Tachigali and Pouteria in different tree community vegetation types in savanna and forest areas in Central Amazon. For this purpose, using standard optical microscopy techniques and statistical models, we analyzed 9 congeneric species, with 3 individuals per species, of woody congeners from Ombrophilous Forest and Amazonian Savanna, both located in the state of Pará, Brazil. Fifteen anatomical traits, both quantitative and qualitative, possessing functional significance were evaluated by comparing tissues between forest and savanna plants, employing ANOVA and ordination analyses. The results indicate that variations in environmental conditions within different vegetation types might be linked to morphophysiological adjustments and strategies in leaves to resist environmental conditions. Species from the Amazonian Savanna present traits more related to conservative characteristics related to water retention and drought resistance, demonstrating a degree of leaf xeromorphism with greater thickness of leaves, palisade parenchyma and epidermal cells. On the other hand, forest species exhibited traits more related to acquisitive and diversified resource strategies, which may be characteristic of the greater availability of light, water and nutrients existing in this environment. The results show considerable variation in leaf traits among forested and savanna formations, and variations in leaf characteristics are expected to be essential for the survival and development of tree species within each type of vegetation.

Another thread to uncover the aging mystery of white tea: Focusing on the natural nanoparticles in tea infusion.

Aged white tea (WT) has promising medicinal potential, but how to accurately identify aged white tea is still a difficult problem. Inspired by tea cream, the relationship between the characteristics of nanoparticles in tea infusion and aging time was studied. The results showed that with the increase of aging time, the particle size of white tea nanoparticles (WTNs) decreased gradually. Microscopic images showed that the surface structure of WTNs was changed in three aspects: the waxy layer, the cuticle layer and the palisade tissue. Additional in vitro modeling demonstrated a strong correlation between nanoparticle size and protein and tea polyphenol content. The correlation between nanoparticle sizes and aging time was further verified in aged Pu'er raw tea. Starting with the tea infusion's nanoparticles, this study showed that the aging time of WT would impact the nanoparticles' properties, offering a unique way to determine the aging period of WT.

Conserved cellular patterning in the mesophyll of rice leaves.

The mesophyll cells of grass leaves, such as rice, are traditionally viewed as displaying a relatively uniform pattern, in contrast to the clear distinctions of palisade and spongy layers in typical eudicot leaves. This quantitative analysis of mesophyll cell size and shape in rice leaves reveals that there is an inherent pattern in which cells in the middle layer of the mesophyll are larger and less circular and have a distinct orientation of their long axis compared to mesophyll cells in other layers. Moreover, this pattern was observed in a range of rice cultivars and species. The significance of this pattern with relation to potential photosynthetic function and the implication of the widespread use of middle layer mesophyll cells as typical of the rice leaf have been investigated and discussed.

Impact of Environmental Pollution by Spent Oil Levels on Leaf Anatomy of Eruca Sativa

Pollution is the quantitative change that occurs to one or more of the elements of the environment that would harm the life of the living organism and weaken the ability of the environment to continue its production. The current research was carried out to study the impact of spent engine oil pollution on some anatomical leaf characters of Eruca Sativa. The pots of sandy soils were contaminated by adding spent engine oil levels of 0.0, 2.5, 5.0, 15.0 and 30.0 ml.3kg-1. From the results, it is noted that a convergence and a slight decrease in the thickness of the cuticle layer of the upper and lower surface of the leaf at the levels of added oil 1.5 and 2.5 ml.kg -1. It was observed, that there was a relative decrease in the thickness of the upper and lower epidermal cells layer at the low levels of addition, with the increase in the decrease in thickness with the increase in the levels of spent oil. And it was found that a clear increase in the thickness of the palisade layer with the increase in the levels of spent oil addition compared to the thickness of the layer in the leaves of plants grown in soil with an addition level of 0 ml.kg-1. It is clear that the dimensions of the stomata for the upper and lower leaf surface of the plant leaf increased and took a behavior that corresponded to the increase in the levels of spent engine oil.

Characterization of the microRNA408-LACCASE5 module as a regulatory axis for photosynthetic efficiency in Medicago ruthenica: implications for forage yield enhancement

Medicago ruthenica is closely related to Medicago sativa, a commonly cultivated forage. Characterized by its high tolerance to environmental stress, M. ruthenica is a valuable genetic resource. However, low yield limits its large-scale utilization. Leaf morphology, an important agronomic trait, is closely related to forage yield and photosynthetic efficiency. In the presented study, “Correlation of Leaf Morphology and Photosynthetic Performance with Forage Yield in Medicago ruthenica: The Underlying Molecular Mechanisms,” comprehensive data analysis revealed a significant positive association between leaf width and leaf area with forage yield in Medicago ruthenica (p < 0.05). The specific cultivar “Mengnong No.1 (MN No.1) had a large leaf area, and its physiological parameters related to photosynthetic characteristics were superior. Anatomical examination revealed that the leaves of MN No.1 had strong palisade tissue and compact cell structure. Subsequent investigations, utilizing small RNA and transcriptome sequencing, discerned critical miRNA-target gene networks that underpin the high photosynthetic efficiency in M. ruthenica. A total of 63 differentially expressed miRNAs (DEMs) were identified, inclusive of several well-characterized miRNAs such as miR408, miR171, and miR398. These miRNAs were predicted to target 55 genes (mRNAs), of which 6 miRNA-target gene pairs, particularly those involving miR408and miR171, exhibited inverse expression patterns. Among the six postulated miRNA-target gene pairs, the targeted cleavage of LACCASE5 (LAC5) by miR408 was conclusively validated through degradome sequencing, with the cleavage site pinpointed between the 9th and 10th nucleotides from the 5′end of miR408 via the 5′-RLM-RACE assay. Therefore, it is posited that the miR408-MrLAC5 module constitutes a central mechanism in fostering high photosynthetic efficiency in M. ruthenica. Moreover, these findings also provide valuable information for further study of the regulatory genes and miRNA functions of forage yield in legume forage.

Characteristics of Aluminum Accumulation and Distribution in Leaves of Different Ages in Camellia oleifera

Oil tea (Camellia oleifera Abel.), an important edible oil tree found in the acidic soil of south China, is tolerant to aluminum (Al); however, the mechanism via which it detoxifies Al remains unclear. The present study investigated the accumulation and distribution of Al and the changes in antioxidant components in C. oleifera leaves at different stages of growth. The analysis revealed that the content of Al in young, mature, and old leaves was 1.53, 7.49, and 12.04 g kg−1, respectively. In the leaves, Al was mainly accumulated in the cell wall, which accounted for 66.03%, 79.94%, and 86.51% of the total Al accumulation in young, mature, and old leaves, respectively. In the leaf cell wall, the Al content in hemicellulose increased from 54.22% to 81.72% with leaf age. The proportion of Al in the upper epidermis, lower epidermis, palisade, and spongy parenchyma cell walls increased with leaf age. The activity of antioxidant enzymes increased and showed a synergistic effect on Al stress with leaf age. The peroxidase activity was the highest in mature leaves, 2.3 times that in young leaves. Meanwhile, catalase and superoxide dismutase activities and total phenol content were the highest in young leaves. Correlation analysis showed that antioxidant system composed of catalase, superoxide dismutase and total phenol (CAT, SOD, and TP) was negatively correlated with the Al content in C. oleifera leaves. The malondialdehyde (MDA) content was positively correlated with Al content in C. oleifera leaves, indicating that the MDA in the leaves helped resist Al stress in C. oleifera. Thus, our findings suggest that the increase in antioxidant properties and modification of the cell wall contributed to Al detoxification in the Al hyperaccumulator C. oleifera.