Palindromic Element Research Articles

Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

Dual transcriptional control by Ear3/COUP: negative regulation through the DR1 direct repeat and positive regulation through a sequence downstream of the transcriptional start site of the mouse mammary tumor virus promoter.

Ear3/COUP is an orphan member of the steroid/thyroid hormone receptor superfamily of transcription factors and binds most tightly to a direct repeat of AGGTCA with 1 nucleotide in between (DR1). Ear3/COUP also binds with a similar affinity to the palindromic thyroid hormone response element (TRE). This binding preference of Ear3/COUP is same as that of the retinoid X receptor (RXR), which is another member of the superfamily. In the present study, we identified a sequence responsible for Ear3/COUP-mediated transactivation in the region downstream of the transcription start site of the mouse mammary tumor virus promoter. This cis-acting sequence was unresponsive to RXR. When the DR1 or TRE sequence was added upstream of the promoter, transactivation by Ear3/COUP was completely abolished, whereas RXR enhanced transcription from the promoter. The mode of action of Ear3/COUP could be utilized to control complex gene expressions in morphogenesis, homeostasis, and development.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Induction by adenovirus-5 E1A of the differentiation phenotype of F9 teratocarcinoma cells involves a conserved region (CR1) of E1A

The effects of the E1A protein of adenovirus-5 on the differentiation program of F9 teratocarcinoma cells were examined by the stable introduction of plasmids that expressed wild-type or mutated forms of E1A. Constitutive expression of plasmids for most of the mutant E1As induced loss of expression of the cell-surface antigen SSEA-1 and the enhanced expression of genes specific for the differentiated phenotype of F9 cells, such as genes for laminin B1, tissue-type plasminogen activator (tPA) and type IV collagen, as well as the altered cell morphology that is associated with the differentiated state. However, such changes were not observed in the case of genes for mutant proteins from which a conserved region (CR1) of E1A had been deleted. Furthermore, no significant induction of expression of the c- jun gene or transactivation of the c- jun-CAT reporter gene were observed when the sequence that encodes CR1 of E1A had been deleted. A palindromic sequence element (DRE) of the c- jun promoter was essential for the E1A-mediated up-regulation of the c- jun gene. These results imply that CR1 is required for activation of the c- jun gene and that it is implicated in the growth arrest, expression of parietal endoderm-specific functions and the orderly differentiation of F9 cells.

Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity.

Signal transducers and activators of transcription (STAT proteins) bind to palindromic sequence elements related to interferon gamma (IFN-gamma) activation sites, which were first identified in the promoters of IFN-gamma-inducible genes. Although the sequences of the natural palindromic STAT-binding elements vary considerably, they conform to the general structure TT(N)5AA. We have systematically examined the effects of the spacing between the TT and AA core half sites on the binding of the STAT complexes activated by IFN-gamma, interleukin (IL) 6, granulocyte-macrophage colony-stimulating factor, and IL-4. We show that (i) as suggested earlier, a core palindromic TT--AA motif with a 5-bp spacing displays general STAT binding, (ii) a palindromic motif with a spacing of 4 bp selectively binds to complexes containing Stat3, and (iii) a motif with a 6-bp spacing selectively binds the STAT complexes activated by IL-4. We have examined natural elements in the promoters of cytokine-responsive genes that differ in half-site spacing and found that they display binding properties predicted from the synthetic binding sites. Furthermore, the observed differential selective binding characteristics for the most part correlate with the ability to mediate transcriptional activation of transfected test genes in response to the cytokines tested. Our results thus demonstrate that the specificity of STAT-directed transcription in response to particular cytokines or cytokine families depends in part on the spacing of half sites within the conserved response element sequence.

A Flagellar Calmodulin Gene of Naegleria, Coexpressed during Differentiation with Flagellar Tubulin Genes, Shares DNA, RNA, and Encoded Protein Sequence Elements

Two calmodulins are synthesized during differentiation of Naegleria gruberi from amoebae to flagellates; one remains in the cell body and the other becomes localized in the flagella. The single, intronless, expressed gene for flagellar calmodulin has been cloned and sequenced. The encoded protein is a typical calmodulin with four putative calcium-binding domains, but it has an amino-terminal extension of 10 divergent amino acids preceding conserved calmodulin residue 4. The transcripts encoding flagellar calmodulin and flagellate cell body calmodulin are clearly divergent. Expression of the flagellar calmodulin gene is differentiation-specific; its mRNA appears and then disappears concurrently with those encoding flagellar alpha- and beta-tubulin. Three provocative sequence elements are shared among these unrelated coexpressed genes: (i) a palindromic DNA sequence element is found in duplicate or triplicate upstream to each transcribed region; (ii) a perfect 12-nucleotide match is found near the AUG start codon of flagellar calmodulin and alpha-tubulin; and (iii) the novel amino-terminal extension of flagellar calmodulin contains a 5-amino-acid element similar to the amino terminus of flagellar alpha-tubulin. These shared sequence elements are proposed to have roles in differentiation, possibly in regulation of transcription, mRNA stability, and localization of these proteins to flagella.

Sequence-specific DNA binding by NIT4, the pathway-specific regulatory protein that mediates nitrate induction in Neurospora.

The expression of the structural genes nit-3 and nit-6, which encode the nitrate assimilatory enzymes nitrate reductase and nitrite reductase, respectively, is highly regulated by the global-acting NIT2 regulatory protein. These structural genes are also controlled by nitrogen catabolite repression and by specific induction via nitrate. A pathway-specific regulatory protein, NIT4, appears to mediate nitrate induction of nit-3 and of nit-6. The NIT4 protein, composed of 1090 amino acids, contains a putative GAL4-like Cys-6 zinc cluster DNA-binding motif, which is joined by a short segment to a stretch of amino acids that appear to constitute a coiled-coil dimerization domain. Chemical crosslinking studies demonstrated that a truncated form of NIT4 forms homodimers. Mobility-shift and DNA-footprinting experiments have identified two NIT4-binding sites of significantly different strengths in the promoter region of the nit-3 gene. The stronger binding site contains a symmetrical octameric sequence, TCCGCGGA, whereas the weaker site has a related sequence. Sequences related to this palindromic element can be found upstream of the nit-6 gene.

The oestrogen receptor recognizes an imperfectly palindromic response element through an alternative side-chain conformation.

Structural studies of protein-DNA complexes have tended to give the impression that DNA recognition requires a unique molecular interface. However, many proteins recognize DNA targets that differ from what is thought to be their ideal target sequence. The steroid hormone receptors illustrate this problem in recognition rather well, since consensus DNA targets are rare. Here we describe the structure, at 2.6 A resolution, of a complex between a dimer of the DNA-binding domain from the human oestrogen receptor (ERDBD) and a non-consensus DNA target site in which there is a single base substitution in one half of the palindromic binding site. This substitution results in a 10-fold increase in the dissociation constant of the ERDBD-DNA complex. Comparison of this structure with a structure containing a consensus DNA-binding site determined previously, shows that recognition of the non-consensus sequence is achieved by the rearrangement of a lysine side chain so as to make an alternative base contact. This study suggests that proteins adapt to recognize different DNA sequences by rearranging side chains at the protein-DNA interface so as to form alternative patterns of intermolecular contacts.

Discontinuities in the evolution of Pseudomonas putida cat genes.

The organization and transcriptional control of chromosomal cat genes (required for dissimilation of catechol by the beta-ketoadipate pathway) in the Pseudomonas putida biotype strain (ATCC 12633) are reported. Nucleotide sequence reveals that catR is separated by 135 bp from the divergently transcribed catBC,A; catC begins 21 nucleotides downstream from catB, and catA begins 41 nucleotides downstream from catC. This contrasts with the gene arrangement in other bacteria, in which catA lies several kilobases upstream from catB. Properties of Tn5 mutants confirmed earlier suggestions that catR is a transcriptional activator and indicated that catA is activated by CatR independently of its activation of catBC. CatR binds to both a DNA fragment containing the catR-catB intergenic region and another DNA fragment containing catC. Pseudomonas strain RB1 resembles P. putida in some respects. Divergence of the two Pseudomonas chromosomes was revealed as nucleotide substitution of about 10% after alignment of known portions of catR,BC,A. Divergent transcriptional controls are suggested by a cluster of nucleotide sequence modifications in Pseudomonas strain RB1 which disrupt a stem-loop structure directly upstream of catB in the P. putida chromosome. Abrupt divergence of the catR,BC,A nucleotide sequences was achieved during evolution by insertion of an 85-bp palindromic genetic element uniquely positioned downstream from P. putida catR and counterpoised by insertion of a similar palindromic sequence in the Pseudomonas strain RB1 catB-catC intergenic region. Properties of the palindromic genetic element suggest that it may serve functions analogous to those of repetitive extragenic palindromic sequences and enteric repetitive intergenic consensus sequences in enteric bacteria.

Comparison of Three Molecular Methods for the Characterization ofFusarium oxysporumStrains

Sixty strains of Fusarium oxysporum were characterized using three DNA-based methods: restriction fragment length polymorphism (RFLP) analysis of total DNA after hybridization with a random DNA probe, polymerase chain reaction (PCR)-based fingerprinting with primers matching enterobacterial repetitive intergenic consensus (ERIC) sequences and repetitive extragenic palindromic (REP) elements, and restriction fragment analysis of PCR-amplified ribosomal intergenic spacers (IGS). All methods yielded intraspecific polymorphisms, but different levels of discrimination were obtained. Good correlation was found between the groupings obtained by the three methods. RFLP analysis of total DNA was the most sensitive method, enabling the detection of 40 variants within the sample of 60 strains. However, this technique is more time-consuming than the PCR-based methods. By ERIC- and REP-PCR fingerprinting and PCR/RFLP analysis of the IGS, the 60 strains were categorized into 27 and 11 genotypes, respectively. Though less discriminant, the PCR/RFLP method allowed estimation of the genetic relationships between the strains. Discrimination of closely related strains within IGS genotypes could be achieved by ERIC- or REP-PCR fingerprinting, which is the most efficient procedure in terms of simplicity and rapidity. Therefore, the two PCR-based procedures described in this paper appear to be rapid tools for the genetic characterization of large populations of F. oxysporum

Molecular cloning and sequencing of the hormone-binding domain of Oreochromis aureus estrogen receptor gene.

The nucleotide sequence of the estrogen receptor gene of Oreochromis aureus (OaER) indicates that the hormone-binding E domain is composed of 4 exons interspersed by short introns of only 0.18-1.3 kb each. All 4 E exons exhibit consensus sequences flanking the donor and acceptor splice sites. Analysis of introns revealed (i) numerous palindromic and half-palindromic steroid responsive elements including ERE, TRE and GRE, (ii) six alternative polyadenylation signals and (iii) putative control regions identified by the clustering of transcription factor binding sites. Of particular interest is the presence of a TATA and CAAT box in intron IV. The hydropathicity profile shows that the E exons are relatively hydrophobic. Two receptor dimerization regions have been observed: a conserved heptad repeat of hydrophobic residues (R168-M193) and a perfect leucine zipper (L36-L57). The presence of multiple sites for kinase activity in these regions suggests the importance of phosphorylation in the regulation of receptor functions and ligand-affinity.

Molecular fingerprinting of Legionella species by repetitive element PCR

Repetitive element PCR (rep-PCR) uses outward-facing primers to amplify multiple segments of DNA located between conserved repeated sequences interspersed along the bacterial chromosome. Polymorphisms of rep-PCR amplification products can serve as strain-specific molecular fingerprints. Primers directed at the repetitive extragenic palindromic element were used to characterize isolates of Legionella pneumophila and other Legionella species. Substantial variation was seen among the rep-PCR fingerprints of different Legionella species and serogroups. More limited, but distinct, polymorphisms of the rep-PCR fingerprint were evident among epidemiologically unrelated isolates of L. pneumophila serogroup 1. Previously characterized Legionella isolates from nosocomial outbreaks were correctly clustered by this method. These results suggest the presence of repetitive extragenic palindromic-like elements within the genomes of members of the family Legionellaceae that can be used to discriminate between strains within a serogroup of L. pneumophila and between different Legionella species. rep-PCR appears to be a useful technique for the molecular fingerprinting of Legionella species.

Characterization and occurrence of two repeated palindromic DNA elements of Brucella spp.: Bru‐RS1 and Bru‐RS2

Two repeated DNA elements of 103 bp and 105 bp were discovered in brucellae and designated Bru-RS1 and Bru-RS2, respectively. The two elements are palindromic, are 65% similar in sequence, form two families of elements that are slightly divergent in sequence, appear to be intergenic, and are found, collectively, in more than 35 copies in brucellae. These elements are bounded by perfect or nearly perfect inverted repeats. A third copy of the terminal repeat is found within the elements and is the terminus for several truncated copies of the Bru-RS1 family. Hybridization patterns for the elements among brucellae were unique. The elements are dispersed, highly conserved among brucellae, and hot-spots for insertion by IS711.

The rice bZIP transcriptional activator RITA-1 is highly expressed during seed development.

Systematic protein-DNA binding studies have shown that plant basic leucine zipper (bZIP) proteins exhibit a differential binding specificity for ACGT motifs. Here, we show that the rice transcription activator-1 (RITA-1) displays a broad binding specificity for palindromic ACGT elements, being able to bind A-, C-, and G-box but not T-box elements. By using gel mobility shift assays with probes differing in sequences flanking the hexameric core, we identified high-affinity A-, C-, and G-box binding sites. Quantitative and competition DNA binding studies confirmed RITA-1 specificity for these sites. Using rice protoplasts as a transient expression system, we demonstrated that RITA-1 can transactivate reporter genes possessing high-affinity but not low-affinity RITA-1 binding sites. Our results established a direct relationship between in vivo transactivation and in vitro binding activity. Transient expression assays that demonstrated the ability of RITA-1 to transactivate a construct containing rita-1 5' flanking sequences suggest that the factor may be autoregulated. Histochemical analysis of transgenic rice plants showed that a rita-1-beta-glucuronidase transgene is expressed in aleurone and endosperm cells of developing rice seeds. We propose that RITA-1 plays a role in the regulation of rice genes expressed in developing rice seeds.

Dimerization characteristics of the DNA- and steroid-binding domains of the androgen receptor

The DNA-binding domain (DBD) of the androgen, mineralocorticoid, and glucocorticoid receptors and the steroid-binding domain (SBD) of the androgen receptor (AR) were expressed separately as fusion proteins with glutathione-S-transferase (GST) in Escherichia coli. Native polyacrylamide gel electrophoresis and gel exclusion HPLC demonstrated that the GST-ARDBD fusion protein was present as a dimer. On the other hand, the GST-ARSBD fusion protein formed a high-molecular weight oligomer, which seemed to be formed by two separate interactions, i.e. GST-GST and ARSBD-ARSBD between the fusion molecules. These findings strongly suggest that ARSBD has a potent ability to form a homodimer and that ARDBD does not. GST-ARDBD specifically interacted with the glucocorticoid response elements of the mouse mammary tumor virus long terminal repeat (GREMMTV). Cleavage of the fusion protein by thrombin abolished the binding, while the nonspecific DNA-cellulose binding ability was retained. Therefore, the dimeric configuration of GST-ARDBD, even if accomplished through the interaction with the GST moiety, is needed for high-affinity binding to the response element. The binding of GST-ARDBD to GREMMTV was strongly competed by the glucocorticoid response element of rat tyrosine aminotransferase gene, followed by the androgen response element of the rat probasin gene. A palindromic thyroid response element showed no competition. Unexpectedly, no apparent different in the binding affinity to these response elements was observed among the DBDs of androgen, mineralocorticoid and glucocorticoid receptors.

Stimulation of the human intercellular adhesion molecule-1 promoter by interleukin-6 and interferon-gamma involves binding of distinct factors to a palindromic response element.

Intercellular adhesion molecule-1 (ICAM-1) is a transmembrane glycoprotein that promotes adhesion in immunological and inflammatory reactions. ICAM-1 is expressed on cells of many lineages and is induced by interleukin-6 (IL-6) and interferon-gamma (IFN-gamma). Functional analysis of ICAM-1 promoter-luciferase constructs in HepG2 cells enabled us to identify a region between -110 and -37 mediating IL-6 and IFN-gamma responsiveness and containing a palindromic IL-6/IFN-gamma response element (pIRE). Site-directed mutagenesis of key nucleotides in the ICAM-1 pIRE abolished the effect of both IL-6 and IFN-gamma stimulation, while this pIRE element was sufficient to confer IL-6 and IFN-gamma responsiveness to a heterologous promoter. We further show by gel retardation analysis that distinct nuclear factors induced by both IL-6 or IFN-gamma specifically bind to this pIRE. Furthermore, treatment with IL-6 results in the formation of multiple complexes while IFN-gamma induces a single binding complex, both in HepG2 and monocytic U937 cells. Differentiation of U937 cells by exposure to 12-O-tetradecanoyl phorbol-13-acetate abolishes response to IL-6 but not IFN-gamma. Supershift data utilizing the ICAM-1 pIRE revealed that IFN-gamma and IL-6 both induce a factor antigenically related to IFN-gamma activation factor. We further provide data suggesting that IL-6 additionally activates an ICAM-1 pIRE binding factor related to the previously described acute-phase response factor in disparate cell types. We therefore conclude that the activation of these related nuclear factors by IL-6 and IFN-gamma is important in the regulation of ICAM-1 gene expression.

Thermodynamics of sequence-specific glucocorticoid receptor-DNA interactions

The thermodynamics of sequence-specific DNA-protein interactions provide a complement to structural studies when trying to understand the molecular basis for sequence specificity. We have used fluorescence spectroscopy to study the chemical equilibrium between the wild-type and a triple mutant glucocorticoid receptor DNA-binding domain (GR DBD wt and GR DBDEGA, respectively) and four related DNA-binding sites (response elements). NMR spectroscopy was used to confirm that the structure of the two proteins is very similar in the uncomplexed state. Binding to DNA oligomers containing single half-sites and palindromic binding sites was studied to obtain separate determinations of association constants and cooperativity parameters involved in the dimeric DNA binding. Equilibrium parameters were determined at 10-35 degrees C in 85 mM NaCl, 100 mM KCl, 2 mM MgCl2, and 20 mM Tris-HCl at pH 7.4 (20 degrees C) and at low concentrations of an antioxidant and a nonionic detergent. GR DBDwt binds preferentially to a palindromic consensus glucocorticoid response element (GRE) with an association constant of (7.6 +/- 0.9) x 10(5) M-1 and a cooperativity parameter of 10 +/- 1 at 20 degrees C. GR DBDEGA has the highest affinity for an estrogen response element (ERE) with an association constant of (2.2 +/- 0.3) x 10(5) M-1 and a cooperativity parameter of 121 +/- 17 at 20 degrees C. The difference in cooperativity in the two binding processes, which indicates significant differences in binding modes, was confirmed using gel mobility assays. van't Hoff analysis shows that DNA binding in all cases in entropy driven within the investigated temperature range. We find that delta H0obs and delta S0obs for the formation of a GR DBDwt-GRE versus GR DBDEGA-ERE complex are significantly different despite very similar delta G0obs values. A comparison of GR DBDwt binding to two similar GREs reveals that the discrimination between these two (specific) sites is due to a favorable delta(delta S0obs) which overcompensates an unfavorable delta(delta H0obs), i.e., the sequence specificity is in this case entropy driven. Thus, entropic effects are of decisive importance for the affinity as well as the specificity in GR-DNA interactions. The molecular basis for measured equilibrium and thermodynamic parameters is discussed on the basis of published structures of GR DBD-GRE and ER DBD-ERE complexes.

Nucleotide substitutions differentially affect direct repeat and palindromic thyroid hormone response elements

Thyroid hormone receptors are transcription factors that bind to specific DNA sequences and regulate gene expression in a ligand-dependent manner. Thyroid hormone response elements can be composed of direct repeat or palindromic arrangements of half-sites. The traditional half-site has been considered to be the sequence 5'-AGGTCA, although we recently demonstrated that the optimal monomer-binding site is 2 base pairs larger, 5'-TAAGGTCA. It has generally been presumed that alterations in half-site sequence have commensurate effects on gene expression from direct repeat and palindromic response elements. However, in the present studies we demonstrate that palindromic elements are highly dependent on the presence of the two 5'-nucleotides (TA) for function, whereas this portion of the response element has minimal influence on hormone induction from direct repeat elements. Hormone induction correlates poorly with binding affinity for thyroid hormone receptor monomers, homodimers, or heterodimers with retinoid X receptors, either in the absence or presence of ligands. We speculate that the magnitude of hormone induction may reflect protein conformation differences induced by a combination of the presence of the appropriate 5'-nucleotides plus half-site orientation.

Induction by interleukin-6 of interferon regulatory factor 1 (IRF-1) gene expression through the palindromic interferon response element pIRE and cell type-dependent control of IRF-1 binding to DNA.

The effects of interleukin-6 (IL-6) on interferon regulatory factor 1 (IRF-1) gene expression were studied in B-hybridoma B9 cells which are growth-stimulated by IL-6 and breast carcinoma T47D cells which are growth-inhibited. IL-6 induced the production of IRF-1 mRNA and protein in both cell types, but IRF-1 binding activity to its target DNA sequence was induced only in T47D cells. With B9 cells, there was no IRF-1 binding but instead strong constitutive binding of the IRF-2 repressor, indicating that binding of IRF-1 to DNA is an important regulatory step. The IRF-1 gene promoter element, palindromic IFN-response element (pIRE), was found to respond to IL-6 with high efficiency as compared with IFN-gamma or IFN-beta. On this palindromic TTC...GAA sequence, two protein complexes (pIRE-a and pIRE-b) were induced within minutes by IL-6. pIRE-b is similar to the main complex induced by IFN-gamma and contains the Stat91 protein. pIRE-a predominantly induced by IL-6 is a slowly migrating complex which does not contain Stat91 and has low affinity for IFN-gamma activated sequence (GAS)-type sequences. Comparison of the relative effects of IL-6 and IFN-gamma shows that pIRE enhancers are differently regulated than GAS elements. Distinct transcription complexes, forming in ratios dependent on the inducer, help explain how various cytokines sharing effects through Stat91 on related enhancers can produce specific patterns of gene expression. Activation of the pIRE-a factors defines a novel transcriptional activity of IL-6 in epithelial and lymphoid cells.

Zeta PKC plays a critical role during stromelysin promoter activation by platelet-derived growth factor through a novel palindromic element

Stromelysin is a metalloproteinase with the widest substrate specificity that plays a critical role in the induction of the metastatic phenotype in cancer cells. The mechanisms whereby growth factors and oncogenes control stromelysin expression are beginning to be characterized. We have recently demonstrated that protein kinase C isotypes down-regulatable by chronic exposure to phorbol esters are not involved in stromelysin gene expression in response to platelet-derived growth factor, ras oncogene, and phosphatidylcholine-hydrolyzing phospholipase C. We also identified a region in the stromelysin promoter, distinct from the 12-O-tetradecanoylphorbol-13-acetate-responsive element, responsible for the promoter activity in response to these stimulants. In this paper, we further characterize that promoter fragment and demonstrate that the region encompassing nucleotides -1218 to -1202, including the palindromic sequence ACTAGT, is necessary and sufficient for the control of stromelysin gene expression. The involvement of zeta-protein kinase C but not of c-raf in the stimulation of stromelysin promoter activity in response to platelet-derived growth factor is also demonstrated here. All these data suggest the existence of a bifurcation downstream of ras in the signaling mechanisms leading to stromelysin expression and DNA synthesis.