Pairwise Sequence Comparisons Research Articles

Molecular identification of phytoplasmas associated with little leaf disease of brinjal in Andhra Pradesh and Telangana states of India

Brinjal little leaf (BLL) is a very important phytoplasma disease in India that causes severe economic losses every year. During 2020, symptoms of little leaf and witches’ broom were observed in brinjal plants grown in the farmer fields at Kadapa, Andhra Pradesh and Mahabubnagar district, Telangana states. Four symptomatic and two symptomless plants collected from the surveyed places of both states were subjected to DNA extraction and used as template in nested PCR assays with universal phytoplasma 16S rRNA primers. Amplification of about 1.25 kb product with primers R16F2n/R2 was obtained only from symptomatic BLL plants and the positive control, but not from asymptomatic plants. Pair wise sequence comparison and phylogenetic analyses of 16S rRNA gene sequences of these phytoplasma strains confirmed that the phytoplasmas from Mahabubnagar district in Telangana were ‘Candidatus Phytoplasma trifolii’-related strains, while those from Kadapa, Andhra Pradesh, were related to Ca. P australasia’. Further virtual RFLP analysis of 16S rDNA sequences allowed the classification of these strains into 16SrVI-D and 16SrII-D subgroups, respectively.

Extended many-item similarity indices for sets of nucleotide and protein sequences

Quantification of similarities between protein sequences or DNA/RNA strands is a (sub-)task that is ubiquitously present in bioinformatics workflows, and is usually accomplished by pairwise comparisons of sequences, utilizing simple (e.g. percent identity) or more intricate concepts (e.g. substitution scoring matrices). Complex tasks (such as clustering) rely on a large number of pairwise comparisons under the hood, instead of a direct quantification of set similarities. Based on our recently introduced framework that enables multiple comparisons of binary molecular fingerprints (i.e., direct calculation of the similarity of fingerprint sets), here we introduce novel symmetric similarity indices for analogous calculations on sets of character sequences with more than two (t) possible items (e.g. DNA/RNA sequences with t = 4, or protein sequences with t = 20). The features of these new indices are studied in detail with analysis of variance (ANOVA), and demonstrated with three case studies of protein/DNA sequences with varying degrees of similarity (or evolutionary proximity). The Python code for the extended many-item similarity indices is publicly available at: https://github.com/ramirandaq/tn_Comparisons.

Vachellia nilotica: A new host of ‘Candidatus phytoplasma asteris’ and ‘Ca. p. trifolii’-related strains in India

Vachellia nilotica, commonly known as gum Arabic tree or babool, is an important medicinal and timber tree grown throughout the arid regions of India. Disease symptoms as witches’ broom, stunting and declining were observed in Arabic trees at Rajinder Nagar, Delhi and Narayangaon, Pune during 2017–18. These symptoms were indicative of phytoplasma presence. Amplicons of about 1.25 kb were consistently amplified in nested PCR assays with DNA extracted from the leaflets of all the symptomatic babool samples using phytoplasma specific primer pairs P1/P7 followed by R16F2n/R2. Pairwise sequence comparison of the amplified products of 16S rDNA sequence of phytoplasma strains from babool witches’ broom (BaWB) from Delhi and babool stunting and declining (BaS&D) from Pune revealed 99.70% and 100% sequence identity with ‘Candidatus Phytoplasma asteris’ and Ca. P. trifolii’ related strains, respectively The presence of Ca. P. asteris’ (16SrI-B) and Ca. P. trifolii’ (16SrVI-D) in symptomatic babool samples was confirmed after phylogenetic and virtual RFLP analysis of 16S rRNA gene sequences. This is the first report of the presence of phytoplasmas in V. nilotica.

Computational genomics of Torque teno sus virus and Porcine circovirus in swine samples from Canada

Emerging viral diseases include pathogens that can threaten the health of the Canadian swineherd. Anelloviruses and Circoviruses comprise of pathogens with veterinary significance. The aim of this study was to determine the genomic organization and phylogenetic relationships of Torque teno sus virus (TTsusV) and Porcine circovirus (PCV) from Canadian pig samples. Fecal and tissue specimens were collected during the winter, spring and summer of 2018. We utilized either virus- or genus-specific PCR assays to characterize the occurrence and genetic diversity of TTsusV and PCV in Canadian pigs. Pairwise comparison of all partial sequences and identity calculation was performed using MAFFT algorithm implemented in Sequence Demarcation Tool (SDT). The obtained full-length sequences were aligned using ClustalW, and phylogeny was inferred using a Maximum likelihood (ML) method by Geneious software. The PCR detection results revealed that the overall positive rate of TTsusV type-1 and type-2 was 45.6% and 32.6%, respectively. The TTsusV isolate MK990454 from Canada clustered in the subtype TTsusV1b, while the TTsusV isolate MK872392 fell in the subtype TTsusV2c, and all showed similarity to known American and Chinese isolates. In addition, our screening PCR showed that 2.7% of stool samples were positive for PCV1. Phylogenetic analysis using the full-length sequence demonstrated that PCV1 (MK872393) isolated from Quebec clustered with other Chinese PCV1 strains. Despite the far geographical distance between Canada and China, the close similarity between Canadian and Chinese TTsusV1 and 2, and PCV1 sequences may be explained by a considerable amount of pig trade between these two nations.

Metagenomic identification, sequencing, and genome analysis of porcine hepe-astroviruses (bastroviruses) in porcine feces in Japan.

Recently, hepe-astrovirus-like RNA viruses named bastroviruses (BastVs), have been found in human, pig, bat, and rat fecal samples. In this study, we determined nearly complete genome sequences of four BastVs in the feces of healthy pigs. Genetic characterization revealed that these porcine BastVs (PBastVs) and BastVs from other animals including humans, had the same genome organization, that is, they contained three predicted conserved domains of viral methyltransferase, RNA helicase, and RdRp in the nonstructural ORF1 and the astrovirus capsid domain in the structural ORF2. Phylogenetic analyses using RNA-dependent RNA polymerase and the capsid region revealed that PBastVs branched with bat and rat BastVs; however, the groups formed by each host were distantly related to human BastVs. Pairwise amino acid sequence comparison demonstrated that PBastVs shared 95.2-98.6% and 76.1-95.5% sequence identity among each other in the ORF1 and ORF2 regions, respectively; the sequence identities between PBastVs and BastVs from other animals were 21.4-42.5% and 9.1-20.6% in the ORF1 and ORF2 regions, respectively. This suggested that BastVs were derived from a common ancestor but evolved independently in each host population during a prolonged period. Putative recombination events were identified in the PBastV genome, suggesting that PBastVs gain sequence diversity and flexibility through recombination events. In an analysis of previously obtained metagenomic data, PBastV sequence reads were detected in 7.3% (23/315) of fecal samples from pigs indicating that PBastVs are distributed among pig populations in Japan.

Protein Sequence Analysis Using the MPI Bioinformatics Toolkit.

The MPI Bioinformatics Toolkit (https://toolkit.tuebingen.mpg.de) provides interactive access to a wide range of the best-performing bioinformatics tools and databases, including the state-of-the-art protein sequence comparison methods HHblits and HHpred. The Toolkit currently includes 35 external and in-house tools, covering functionalities such as sequence similarity searching, prediction of sequence features, and sequence classification. Due to this breadth of functionality, the tight interconnection of its constituent tools, and its ease of use, the Toolkit has become an important resource for biomedical research and for teaching protein sequence analysis to students in the life sciences. In this article, we provide detailed information on utilizing the three most widely accessed tools within the Toolkit: HHpred for the detection of homologs, HHpred in conjunction with MODELLER for structure prediction and homology modeling, and CLANS for the visualization of relationships in large sequence datasets. © 2020 The Authors. Basic Protocol 1: Sequence similarity searching using HHpred Alternate Protocol: Pairwise sequence comparison using HHpred Support Protocol: Building a custom multiple sequence alignment using PSI-BLAST and forwarding it as input to HHpred Basic Protocol 2: Calculation of homology models using HHpred and MODELLER Basic Protocol 3: Cluster analysis using CLANS.

Global Picture of Genetic Relatedness and the Evolution of Humankind.

Simple SummaryThe intricacies of human ancestry are buried deep within our DNA. For years, scientists have been working to piece together a vast picture of our genetic lineage. The purpose of this study was to further reveal this global picture of human genetic relatedness using identical-by-descent (IBD) genomic fragments. We processed over 65 million very rare single nucleotide polymorphic (SNP) alleles and detected over 17 million shared IBD fragments, including very short IBD fragments that allowed us to trace common ancestors back to 200,000 years ago. We also determined nine geographical regions representing nine unique genetic components for mankind: East and West Africa, Northern Europe, Arctica, East Asia, Oceania, South Asia, Middle East, and South America. The levels of admixture in every studied population could be assigned to one of these regions and long-term neighboring populations are strikingly similar, despite any political, religious, and cultural differences. Additionally, we observed the topmost admixture to be in central Eurasia. The entire picture of relatedness of all the studied populations presents itself in the form of shared number/size of IBDs, providing novel insights into geographical admixtures and genetic contributions that shaped human ancestry into what it is today.We performed an exhaustive pairwise comparison of whole-genome sequences of 3120 individuals, representing 232 populations from all continents and seven prehistoric people including archaic and modern humans. In order to reveal an intricate picture of worldwide human genetic relatedness, 65 million very rare single nucleotide polymorphic (SNP) alleles have been bioinformatically processed. The number and size of shared identical-by-descent (IBD) genomic fragments for every pair of 3127 individuals have been revealed. Over 17 million shared IBD fragments have been described. Our approach allowed detection of very short IBD fragments (<20 kb) that trace common ancestors who lived up to 200,000 years ago. We detected nine distinct geographical regions within which individuals had strong genetic relatedness, but with negligible relatedness between the populations of these regions. The regions, comprising nine unique genetic components for mankind, are the following: East and West Africa, Northern Europe, Arctica, East Asia, Oceania, South Asia, Middle East, and South America. The level of admixture in every studied population has been apportioned among these nine genetic components. Genetically, long-term neighboring populations are strikingly similar to each other in spite of any political, religious, and cultural differences. The topmost admixture has been observed at the center of Eurasia. These admixed populations (including Uyghurs, Azerbaijanis, Uzbeks, and Iranians) have roughly equal genetic contributions from the Middle East, Europe, China, and India, with additional significant traces from Africa and Arctic. The entire picture of relatedness of all the studied populations unfolds and presents itself in the form of shared number/size of IBDs.

Genome-based classification of Calidifontibacillus erzurumensis gen. nov., sp. nov., isolated from a hot spring in Turkey, with reclassification of Bacillus azotoformans as Calidifontibacillus azotoformans comb. nov. and Bacillus oryziterrae as Calidifontibacillus oryziterrae comb. nov.

A novel Gram-stain-positive, rod-shaped, endospore-forming, motile, aerobic bacterium, designated as P2T, was isolated from a hot spring water sample collected from Ilica-Erzurum, Turkey. Phylogenetic analyses based on 16S rRNA gene sequence comparisons affiliated strain P2T with the genus Bacillus, and the strain showed the highest sequence identity to Bacillus azotoformans NBRC 15712T (96.7 %). However, the pairwise sequence comparisons of the 16S rRNA genes revealed that strain P2T shared only 94.7 % sequence identity with Bacillus subtilis subsp. subtilis NCIB 3610T, indicating that strain P2T might not be a member of the genus Bacillus. The digital DNA-DNA hybridization and average nucleotide identity values between strain P2T and B. azotoformans NBRC 15712T were 19.8 and 74.2 %, respectively. The cell-wall peptidoglycan of strain P2T contained meso-diaminopimelic acid. The polar lipid profile consisted of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, an aminophospholipid, five unidentified phospholipids and two unidentified lipids while the predominant isoprenoid quinone was MK-7. The major fatty acids were iso-C15 : 0 and iso-C16 : 0. The draft genome of strain P2T was composed of 82 contigs and found to be 3.5 Mb with 36.1 mol% G+C content. The results of phylogenomic and phenotypic analyses revealed that strain P2T represents a novel genus in the family Bacillaceae, for which the name Calidifontibacillus erzurumensis gen. nov., sp. nov. is proposed. The type strain of Calidifontibacillus erzurumensis is P2T (=CECT 9886T=DSM 107530T=NCCB 100675T). Based on the results of the present study, it is also suggested that Bacillus azotoformans and Bacillus oryziterrae should be transferred to this novel genus as Calidifontibacillus azotoformans comb. nov. and Calidifontibacillus oryziterrae comb. nov., respectively.

Viral metagenomic identification of a novel anellovirus in blood sample of a child with atopic dermatitis.

Here, using viral metagenomics, a novel anellovirus with strain name HuAV-zj-ad1 was detected in blood sample from a child with atopic dermatitis. The complete genome sequence of HuAV-zj-ad1 was determined and fully characterized. The circular genome of HuAV-zj-ad1 is 2841 nt in length and includes four polyprotein ORFs. Phylogenetic analysis and pairwise sequence comparisons based on the amino acid sequences of ORF1, ORF2, ORF3, ORF4 indicated that HuAV-zj-ad1 belonged to a novel species within the genus Betatorquevirus. Polymerase chain reaction screening results showed this anellovirus was not present 50 blood samples from normal children. Whether this novel species of anellovirus has association with a certain disease needs further study.

Occurrence of Chenopodium quinoa mitovirus 1 in Chenopodium quinoa in China.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

The emerging SARS-CoV-2 papain-like protease: Its relationship with recent coronavirus epidemics.

The papain-like protease (PLpro ) is an important enzyme for coronavirus polyprotein processing, as well as for virus-host immune suppression. Previous studies reveal that a molecular analysis of PLpro indicates the catalytic activity of viral PLpro and its interactions with ubiquitin. By using sequence comparisons, molecular models, and protein-protein interaction maps, PLpro was compared in the three recorded fatal CoV epidemics, which involved severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), severe acute respiratory syndrome CoV (SARS-CoV), and Middle East respiratory syndrome coronavirus (MERS-CoV). The pairwise sequence comparison of SARS-CoV-2 PLpro indicated similarity percentages of 82.59% and 30.06% with SARS-CoV PLpro and MERS-CoV PLpro , respectively. In comparison with SARS-CoV PLpro , in SARS-CoV-2, the PLpro had a conserved catalytic triad of C111, H278, and D293, with a slightly lower number of polar interface residues and of hydrogen bonds, a higher number of buried interface sizes, and a lower number of residues that interact with ubiquitin and PLpro . These features might contribute to a similar or slightly lower level of deubiquitinating activity in SARS-CoV-2 PLpro. It was, however, a much higher level compared to MERS-CoV, which contained amino acid mutations and a low number of polar interfaces. SARS-CoV-2 PLpro and SARS-CoV PLpro showed almost the same catalytic site profiles, interface area compositions and polarities, suggesting a general similarity in deubiquitination activity. Compared with MERS-CoV, SARS-CoV-2 had a higher potential for binding interactions with ubiquitin. These estimated parameters contribute to the knowledge gap in understanding how the new virus interacts with the immune system.

Novel SFTSV Phylogeny Reveals New Reassortment Events and Migration Routes.

Severe fever with thrombocytopenia syndrome virus (SFTSV), the causative agent of a febrile human disease, was first identified from central and eastern provinces in China, and later in Japan and South Korea. Hubei Province is one of the major SFTS epidemic areas in the central part of China. This study reported the isolation of 11 new SFTSV strains from patients in Hubei Province collected in 2017. Extensive phylogenetic analyses were conducted based on the complete coding sequences of SFTSV segments including the new strains. It was suggested that five different SFTSV genotypes were circulating in Hubei, and 15 reassortment patterns and migration pathways correlated with each genotype were identified, which was more than previously recognized. Hubei Province was more involved in the evolutionary events of SFTSV than that previously thought in which the evolutionary events of SFTSV were reported to be independent from those in other epidemic regions. Further divergence of SFTSV strains was suggested by pairwise comparison of SFTSV sequences from each genotype and sequence identity normalized to representative strain in genotype C1. Subsequently, amino acid variations specific for genotype(s), strain(s), or cluster(s) were inspected, which may be related to differential biological activity of SFTSV strains/genotypes. In conclusion, we analyzed the current status of SFTSV phylogeny in Hubei Province and discussed the possible events correlated to SFTSV evolution. It provided an in-depth insight into SFTSV evolution, raising concerns for the use of proper SFTSV strains in future studies.

Origin-independent analysis links SARS-CoV-2 local genomes with COVID-19 incidence and mortality.

There is an urgent public health need to better understand Severe Acute Respiratory Syndrome (SARS)-CoV-2/COVID-19, particularly how sequences of the viruses could lead to diverse incidence and mortality of COVID-19 in different countries. However, because of its unknown ancestors and hosts, elucidating the genetic variations of the novel coronavirus, SARS-CoV-2, has been difficult. Without needing to know ancestors, we identified an uneven distribution of local genome similarities among the viruses categorized by geographic regions, and it was strongly correlated with incidence and mortality. To ensure unbiased and origin-independent analyses, we used a pairwise comparison of local genome sequences of virus genomes by Basic Local Alignment Search Tool (BLAST). We found a strong statistical correlation between dominance of the SARS-CoV-2 in distributions of uneven similarities and the incidence and mortality of illness. Genomic annotation of the BLAST hits also showed that viruses from geographic regions with severe infections tended to have more dynamic genomic regions in the SARS-CoV-2 receptor-binding domain (RBD) and receptor-binding motif (RBM) of the spike protein (S protein). Dynamic domains in the S protein were also confirmed by a canyon region of mismatches coincident with RBM and RBD, without hits of alignments of 100% matching. Thus, our origin-independent analysis suggests that the dynamic and unstable SARS-CoV-2-RBD could be the main reason for diverse incidence and mortality of COVID-19 infection.

Molecular characterization of a novel cytorhabdovirus associated with paper mulberry mosaic disease.

A novel cytorhabdovirus, tentatively named "paper mulberry mosaic-associated virus" (PMuMaV), was discovered and identified by transcriptome sequencing (RNA-seq), small RNA sequencing (sRNA-seq), and RT-PCR amplification. The whole-genome sequence of PMuMaV is 13,736 nucleotides (nt) in length and contains six open reading frames (ORFs) encoding a nucleocapsid protein (N), a phosphoprotein (P), a putative movement protein (P3), a matrix protein (M), a glycoprotein (G), and an RNA-dependent RNA polymerase (L). The coding sequences are flanked by a 194-nt leader and a 370-nt trailer sequence at the 3' terminus and 5' terminus, respectively. Pairwise sequence comparisons showed that PMuMaV is related to northern cereal mosaic virus (NCMV, 38.97%), barley yellow striate mosaic virus (BYSMV, 38.86%), and maize yellow striate virus (MYSV, 38.76%), and phylogenetic analysis also placed these viruses together into the same branch, thus suggesting that PMuMaV is a member of a new species in the genus Cytorhabdovirus.

Novel Genotype Definition and the First Epidemiological Investigation of Canine Adenovirus Type 2 in Dogs in Central China.

Infections caused by canine adenovirus (CAdV) type 1 have been reported worldwide in the past two decades. However, only few studies have specifically reported the prevalence of CAdV type 2 (CAdV-2). The present study investigated the persistent circulation of CAdV-2 in dogs with diarrhea in the Henan, Hubei, and Jiangsu provinces in central China from 2017 to 2019. We conducted polymerase chain reaction for detecting CAdV-2 and other related pathogens in 224 rectal swabs of pet dogs and the co-infection of canine diseases was also analyzed. In addition, the structural protein genes—Fiber, Hexon, and Penton—of the isolated CAdV-2 strains were sequenced and analyzed. The similarity between Hexon and Penton among the 19 strains was 97.4%, as revealed by sequence alignment. Multiple sequence alignment results showed that the Fiber gene sequences of these CAdV-2 strains shared 97.4–99.8% nucleotide and 94.1–99.3% amino acid identity with reference sequences and shared only 79.0–80.5% nucleotide and 77.3–80.5% amino acid identity with the vaccine strain CLL, indicating that Fiber harbored most of the variant sites. Furthermore, pairwise sequence comparisons of Hexon of CH-JS-1901 and CH-HN-1801 with that of India2006 revealed a novel genotype. Furthermore, protein model prediction showed that the amino acid mutation of fiber protein in 19 strains was located in the head region, that may cause structural changes on the surface of the fiber protein. These findings are of significance for monitoring the epidemiology of CAdV-2 infection and developing a novel vaccine which contribute to understanding genetic evolution of CAdV-2 in China.

Identification, molecular characterization, expression analysis and wound-healing ability of multifunctional calreticulin from big-belly seahorse Hippocampus abdominalis

Calreticulin (CRT) is a multifunctional ubiquitous protein that is widely presented in all cells in eukaryotes except erythrocytes. CRT is well known for diverse cellular functions such as endoplasmic reticulum (ER)-specialized protein quality control during protein synthesis and folding, in-vivo Ca2+ homeostasis, antigen presentation, phagocytosis, wound-healing, proliferation, adhesion, and migration of cells. In the current study, we identified CRT from Hippocampus abdominalis (HaCRT) and analyzed expression profiles and functional properties. The cDNA sequence of HaCRT was identified with an open reading frame of 1226 bp. The molecular weight of HaCRT was estimated as 49 kDa. The in-silico study revealed conserved sequence arrangements such as two CRT signature motifs (5′-KHEQSIDCGGGYVKVF-3′ and 5′-LMFGPDICG-3′), triplicate repeats (5′-IKDPEAKKPEDWD-3′, 5′-IPDPDDTKPEDWD-3′, 5′-IPDPDAKKPDDWD-3′), signal peptide and an ER-targeting 5′-KDEL-3′ sequence of HaCRT. Close sequence similarity of HaCRT was observed with Hippocampus comes from phylogenetic analysis and pairwise sequence comparison. From quantitative polymerase chain reaction (qPCR) results, HaCRT was ubiquitously distributed in all tested tissues and expression levels of HaCRT were significantly modulated in blood, liver and gill tissues after stimulation with Streptococcus iniae, Edwardsiella tarda, polyinosinic:polycytidylic acid, and lipopolysaccharides. Bacterial- and pathogen-associated molecular patterns-binding activities were observed with recombinant HaCRT (rHaCRT). The treatment of murine macrophages with rHaCRT induced the expression of immune genes, such as tumor necrosis factor-α (TNF-α), interleukin 6 (IL-6), inducible nitric oxide synthase (iNOS), and interleukin-1β (IL-1β). Furthermore, rHaCRT exhibited wound-healing ability. Based on the results from the above study, we suggest that HaCRT play an indispensable role in the immunity of big-belly seahorses by recognition and elimination of pathogens as well as the tissue repairing process.

Isolation and characterization of a novel cripavirus, the first Dicistroviridae family member infecting the cotton mealybug Phenacoccus solenopsis.

A new virus belonging to the family Dicistroviridae was identified in the hibiscus-infesting cotton mealybug Phenacoccus solenopsis. Using high-throughput sequencing (HTS) on an Illumina HiSeq platform, a single contig of the complete genome sequence was assembled. The authenticity of the sequence obtained by HTS was validated by RT-PCR and Sanger sequencing of the amplicons, which was also employed for the 3' untranslated region (UTR). The 5' UTR was sequenced using a rapid amplification of cDNA ends kit. A large segment encompassing the whole genome was amplified by RT-PCR using viral RNA extracted from mealybugs. A whole-genome nucleotide sequence comparison showed 89% sequence identity to aphid lethal paralysis virus (ALPV), covering a short segment of 44 bp. Pairwise amino acid sequence comparisons of the protein encoded by open reading frame (ORF) 2 with its counterparts in the GenBank database, showed less than 40% identity to several members of the genus Cripavirus, including ALPV. Phylogenetic analysis based on the deduced amino acid sequence of the ORF 2 protein showed that the new virus grouped with members of the genus Cripavirus. The intergenic region (IGR) internal ribosome entry site (IRES) showed the conserved nucleotides of a type I IGR IRES and had two bulge sites, three pseudoknots, and two stem-loops. Virus morphology visualized by transmission electron microscopy demonstrated spherical particles with a diameter of ~30 nm. This virus was the only arthropod virus identified in the sampled mealybugs, and the purified virus was able to infect cotton mealybugs. To the best of our knowledge, this is the first report of a Dicistroviridae family member infecting P. solenopsis, and we have tentatively named this virus Phenacoccus solenopsis virus (PhSoV).

The genomic constellation of a novel duck reovirus strain associated with hemorrhagic necrotizing hepatitis and splenitis in Muscovy ducklings in Fujian, China

The complete sequence of a reovirus, strain NP03 associated with necrotic focus formation in the liver and spleen of Muscovy ducklings in Fujian Province, China in 2009, was determined and compared with sequences of other waterfowl and chicken-origin avian reoviruses (ARVs). Sequencing of the complete genomes of strain NP03 showed that they consisted of 23,418 bp and were divided into 10 segments, ranging from 1191 bp (S4) to 3959 bp (L1) in length, and all segments contained conserved sequences in the 5′ non-coding region (GCUUUU) and 3’ non-coding region (UCAUC). Pairwise sequence comparisons demonstrated that NP03 strain showed the highest similarity with novel waterfowl origin reoviruses (WRVs). The genome analysis revealed that the S1 segment of novel WRV is a tricistronic gene, encoding the overlapping open reading frames (ORFs) for p10, p18, and σC, similar to the ARV S1 gene, but distinct from classical WRV S4 genome segment, which contained two overlapping ORFs encoding p10 and σC. Phylogenetic analyses of the nucleotide sequences of all 10 segments revealed that NP03 strain was clustered together with other novel WRVs and were distinct from classical WRVs and chicken-origin ARVs. The analyses also showed possible intra-segmental reassortment events in the segments encoding λA, λB, μB, μNS, σA, and σNS between novel and classical WRVs. Potential recombination events detection in segment L1 suggests that NP03 strain may be recombinants of novel WRVs. Based on our genetic analyses, multiple reassortment events, intra-segmental recombination, and accumulation of point mutations have possibly contributed to the emergence of this novel genotype of WRV, identified in China.

Mussaenda erythrophylla: A new host of ‘Candidatus Phytoplasma asteris’ in India

Leaf yellowing symptoms were observed in Mussaenda erythrophylla at Digiyana Park, Jammu during June 2016. Leaf yellowing and flat stem symptoms were also observed on nearby planted Catharanthus roseus and Celosia argentea, respectively. Amplicons of ~ 1.25 kb were consistently amplified in nested PCR assays with DNA extracted from all the symptomatic Mussaenda erythrophylla, Catharanthus roseus and Celosia argentea samples using primer pairs P1/P7 followed by R16F2n/R2. However, no amplifications were achieved with any of the asymptomatic plant samples. Pair wise sequence comparison of the ~ 1.25 kb products of 16S rDNA sequence of M. erythrophylla leaf yellowing, C. roseus leaf yellowing and C. argentea flat stem phytoplasma isolates revealed 99.8% sequence identity with ‘Candidatus Phytoplasma asteris’ related strains. Phylogeny and virtual RFLP analysis of 16S rDNA sequences confirmed the affiliation of ‘Ca. P. asteris’ subgroup I-B with all the three symptomatic plant samples. This is the first report of association of ‘Ca. P. asteris’ subgroup I-B with M. erythrophylla worldwide.

Molecular detection of Euphorbia yellow mosaic virus infecting chili pepper

Begomoviruses (family Geminiviridae, genus Begomovirus) are responsible for considerable losses in several tropical crops, more commonly in bean and tomato. Begomoviruses comprise the most numerous and economically destructive group within Geminiviridae. Characteristic symptoms of begomovirus infection in Capsicum chinense (chili pepper, Solanaceae) were observed in smallholder farms in the state of Amazonas. The molecular detection and identification of begomoviruses affecting chili pepper were conducted from symptomatic foliar samples collected at 14 farms in the municipalities of Presidente Figueiredo, Iranduba and Manaus (Amazonas state). Begomovirus was detected in five out of the 69 samples, all of the cultivar Lupita. Pairwise sequence comparisons and phylogenetic analysis based on the complete sequence of the DNA-A component identified the isolates as members of the species Euphorbia yellow mosaic virus (EuYMV). Comparative analysis with 36 EuYMV isolates grouped the Amazonian isolates in a single clade, indicating a low degree of genetic variability for this begomovirus.