Pair Of sgRNAs Research Articles

Exonuclease editor promotes precision of gene editing in mammalian cells

BackgroundMany efforts have been made to improve the precision of Cas9-mediated gene editing through increasing knock-in efficiency and decreasing byproducts, which proved to be challenging.ResultsHere, we have developed a human exonuclease 1-based genome-editing tool, referred to as exonuclease editor. When compared to Cas9, the exonuclease editor gave rise to increased HDR efficiency, reduced NHEJ repair frequency, and significantly elevated HDR/indel ratio. Robust gene editing precision of exonuclease editor was even superior to the fusion of Cas9 with E1B or DN1S, two previously reported precision-enhancing domains. Notably, exonuclease editor inhibited NHEJ at double strand breaks locally rather than globally, reducing indel frequency without compromising genome integrity. The replacement of Cas9 with single-strand DNA break-creating Cas9 nickase further increased the HDR/indel ratio by 453-fold than the original Cas9. In addition, exonuclease editor resulted in high microhomology-mediated end joining efficiency, allowing accurate and flexible deletion of targeted sequences with extended lengths with the aid of paired sgRNAs. Exonuclease editor was further used for correction of DMD patient-derived induced pluripotent stem cells, where 30.0% of colonies were repaired by HDR versus 11.1% in the control.ConclusionsTherefore, the exonuclease editor system provides a versatile and safe genome editing tool with high precision and holds promise for therapeutic gene correction.

ZNF536 dysfunction enhances spontaneous differentiation of the SH-SY5Y cell line into a neuronal-like phenotype

IntroductionSchizophrenia (SZ) is a common psychiatric neurodevelopmental disorder with a complex genetic architecture. Genomic association studies indicate the involvement of transcription factors in the pathogenesis of SZ. A recent GWAS showed a significant association of ZNF536 with SZ. To date, the molecular functions of ZNF536 are poorly understood and its possible role in the pathogenesis of SZ is unclear.ObjectivesThe aim of this work was to develop a model cell line for study ZNF536-mediated pathogenic mechanisms associated with SZ.Methods To assess the spatial interaction of ZNF536 with SZ risk loci, we used the Capture-C method. For ZNF536 deletion, SH-SY5Y was sequentially transduced with two lentiviral vectors. The first expressed Cas9 under the control of a tetracycline regulated promoter and the second expressed a pair of sgRNAs for ZNF536 deletion. Puromycin was used to select transduced cells. Stably transduced cells were then treated with oxytetracycline to induce Cas9 expression. In parallel, SH-SY5Y were transduced with lentiviral constructs of Cas9 and sgRNA carrying a spacer lacking targets in the human genome to obtain a negative control. Individual clones were obtained by the limiting dilution method. The ZNF536 deletion was confirmed by PCR and Sanger sequencing.ResultsA spatial interaction of ZNF536 with SZ risk loci was found, suggesting its involvement in SZ pathogenesis. Using the CRISPR/Cas9 system, we obtained several clones with heterozygous deletion of ZNF536. We observed that their growth and proliferation were significantly slowed down. In addition, the mutant clones spontaneously differentiate into a neuron-like phenotype in low-serum medium.ConclusionsWe established a cellular model to study ZNF536-mediated mechanisms associated with SZ.Disclosure of InterestNone Declared

445 Awardee Talk: Generation of a BMPR2 Heterozygous Ovine Genetic Model for Heritable Pulmonary Arterial Hypertension

Abstract Pulmonary Arterial Hypertension (PAH) is a rare vascular disorder affecting 1 to 2 cases per million individuals. Monoallelic mutations in the BMPR2 gene are the most common genetic risk factor, with about 20% of carriers affected. BMPR2 is a serine/threonine kinase receptor in the transforming growth factor beta (TGF-β) superfamily. Despite well-known associations with PAH, the role of BMPR2 in the progression of the disorder remains poorly understood due in part to the lack of appropriate preclinical genetic models. The homozygous BMPR2 (-/-) knockout genotype is embryonic lethal, which is an obstacle to creating a suitable genetic biomedical model for PAH. To overcome this barrier, we used a single guide RNA (sgRNA) CRISPR/Cas9 approach to target exon 3 of the ovine BMPR2 gene, in combination with a single-stranded oligo-deoxynucleotide (ssODN) synonymous homology-directed repair (HDR) template to create heterozygous BMPR2 (+/-) sheep. Heterozygote lambs could be generated in two ways with this approach – high editing efficiency coupled with ssODN homology-directed repair of one of the edited alleles, OR intermediate editing efficiency with low to no presence of HDR in the genetic sequence. Our main objectives were to:1.) Determine optimal concentrations of ssODN (100, 300, and 600 ng/ul) to promote HDR and 2.) Identify the sgRNA which maximized the probability of obtaining heterozygous lambs. A ssODN was designed to serve as a synonymous repair template that disrupted the PAM site for a pair of sgRNAs targeting BMPR2 exon 3 on opposite strands. We electroporated ovine zygotes six hours post-fertilization using sgRNA (100 ng/µL)/Cas9 (200 ng/µL) ribonucleoprotein (RNP) complexes alongside three ODN concentrations (100, 300, and 600 ng/µL). Zygotes were cultured for seven days, and blastocysts were lysed, PCR-amplified, and Sanger sequenced. Sequences were analyzed using TIDER (Brinkman et al., Nucl. Acids Res., 2018). TIDER is a computer model which quantifies the frequency of targeted small nucleotide changes introduced by CRISPR in combination with HDR using a donor template. A Kruskal-Wallis test compared the efficacy of HDR at 100, 300, and 600 ng/µL of ODN template. A significant difference was found between groups with 600 ng/µL giving the highest rate of HDR (P < 0.0001). Post-hoc pairwise comparisons using a Dunn's test found that sgRNA1 at 600 ng/ul ODN was significantly more efficient for HDR repair as compared with sgRNA2 (P < 0.05). The editing efficiency of the blastocysts collected using the 600 ng/µLODN and sgRNA1 treatment combination was 44.7% high (>66%), 42.6% intermediate (66-33%), and 8.5% low (< 33%) knockout rate, and 4.2% wild-type. The knockin rate was 27.7% high (>20%), 21.3% intermediate (20-5%), and 51% low to no (< 5%) HDR. These data predict that about one-half the transferred embryos subject to these conditions will have the desired heterozygous genotype [BMPR2 (+/-) sheep].

Efficient large fragment deletion in plants: double pairs of sgRNAs are better than dual sgRNAs.

Efficient large fragment deletion in plants: double pairs of sgRNAs are better than dual sgRNAs.

In Vivo Visualized Tracking of Tumor-Derived Extracellular Vesicles Using CRISPR-Cas9 System.

Introduction: Tumor extracellular vesicles (EVs) and their relevance to various processes of tumor growth have been vigorously investigated over the past decade. However, obtaining direct evidence of spontaneous EV transfer in vivo remains challenging. In our previous study, a single-guide RNA (sgRNA): Cas9 ribonucleoprotein complex, which can efficiently delete target genes, was delivered into recipient cells using an engineered EV. Aim: Applying this newly discovered exosomal bio-cargo to track the uptake and distribution of tumor EVs. Methods: Tumor cells of interest were engineered to express and release the sgRNA:Cas9 complex, and a reporter cell/system containing STOP-fluorescent protein (FP) elements was also generated. EV-delivered Cas9 proteins from donor cells were programmed by a pair of sgRNAs to completely delete a blockade sequence and, in turn, recuperated the expression of FP in recipient reporter cells. Thus, fluorescently illuminated cells indicate the uptake of EVs. To improve the efficiency and sensitivity of this tracking system in vivo, we optimized the sgRNA design, which could more efficiently trigger the expression of reporter proteins. Results: We demonstrated the EV-mediated crosstalk between tumor cells, and between tumor cells and normal cells in vitro. In vivo, we showed that intravenously administered EVs can be taken up by the liver. Moreover, we showed that EVs derived from melanoma xenografts in vivo preferentially target the brain and liver. This distribution resembles the manifestation of organotrophic metastasis of melanoma. Conclusion: This study provides an alternative tool to study the distribution and uptake of tumor EVs.

Competitive dCas9 binding as a mechanism for transcriptional control

Catalytically dead Cas9 (dCas9) is a programmable transcription factor that can be targeted to promoters through the design of small guide RNAs (sgRNAs), where it can function as an activator or repressor. Natural promoters use overlapping binding sites as a mechanism for signal integration, where the binding of one can block, displace, or augment the activity of the other. Here, we implemented this strategy in Escherichia coli using pairs of sgRNAs designed to repress and then derepress transcription through competitive binding. When designed to target a promoter, this led to 27‐fold repression and complete derepression. This system was also capable of ratiometric input comparison over two orders of magnitude. Additionally, we used this mechanism for promoter sequence‐independent control by adopting it for elongation control, achieving 8‐fold repression and 4‐fold derepression. This work demonstrates a new genetic control mechanism that could be used to build analog circuit or implement cis‐regulatory logic on CRISPRi‐targeted native genes.

Application of CRISPR/Cas9 technology in wild apple (Malus sieverii) for paired sites gene editing

BackgroundXinjiang wild apple is an important tree of the Tianshan Mountains, and in recent years, it has undergone destruction by many biotic and abiotic stress and human activities. It is necessary to use new technologies to research its genomic function and molecular improvement. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability varies depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices.ResultsIn this study, we used 2 systems of vectors with paired sgRNAs targeting to MsPDS. As expected, we successfully induced the albino phenotype of calli and buds in both systems.ConclusionsWe conclude that CRISPR/Cas9 is a powerful system for editing the wild apple genome and expands the range of plants available for gene editing.

Using CRISPR/Cas9 System to Knock out Exon 48 in DMD Gene.

Background:Out of frame mutations in DMD gene cause Duchenne Muscular Dystrophy (DMD) which is a neuromuscular progressive genetic disorder. In DMD patients, lack of dystrophin causes progressive muscle degeneration, which results in heart and respiratory failure leading to premature death. At present, there is no certain treatment for DMD. DMD gene is the largest gene in human genome by 2.2 mega base pairs and contains 79 exons. In the past few years, gene therapy has been considered a promising DMD treatment, and among various gene-editing technologies, CRISPR/Cas9 system is shown to be more precise and reliable. The aim of this study was to assess the possibility of knocking out exon 48 by using a pair of sgRNAs.Methods:A pair of guide RNAs (gRNAs) was designed to cleave DMD gene and induce deletion of exon 48. gRNAs were transfected to the HEK-293 cell line and then the deletion in genomic DNA was analyzed by PCR and subsequent Sanger sequencing.Results:Exon 48 was successfully deleted and therefore exon 47 was joined to exon 49.Conclusion:This result indicated that CRISPR/Cas9 system could be used to edit DMD gene precisely.

Development of a rabbit model of Wiskott-Aldrich syndrome.

The Wiskott-Aldrich syndrome (WAS) is a severe recessive X-linked immunodeficiency resulting from loss-of-function mutations in the WAS gene. Mouse is the only mammalian model used for investigation of WAS pathogenesis. However, the mouse model does not accurately recapitulate WAS clinical phenotypes, thus, limiting its application in WAS clinical research. Herein, we report the generation of WAS knockout (KO) rabbits via embryo co-injection of Cas9 mRNA and a pair of sgRNAs targeting exons 2 and 7. WAS KO rabbits exhibited many symptoms similar to those of WAS patients, including thrombocytopenia, bleeding tendency, infections, and reduced numbers of T cell in the spleen and peripheral blood. The WAS KO rabbit model provides a new valuable tool for preclinical trials of WAS treatment.

Unexpectedly High Levels of Inverted Re-Insertions Using Paired sgRNAs for Genomic Deletions.

Use of dual sgRNAs is a common CRISPR/Cas9-based strategy for the creation of genetic deletions. The ease of screening combined with a rather high rate of success makes this approach a reliable genome engineering procedure. Recently, a number of studies using CRISPR/Cas9 have revealed unwanted large-scale rearrangements, duplications, inversions or larger-than-expected deletions. Strict quality control measures are required to validate the model system, and this crucially depends on knowing which potential experimental outcomes to expect. Using the dual sgRNA deletion approach, our team discovered high levels of excision, inversion and re-insertion at the site of targeting. We detected those at a variety of genomic loci and in several immortalized cell lines, demonstrating that inverted re-insertions are a common by-product with an overall frequency between 3% and 20%. Our findings imply an inherent danger in the misinterpretation of screening data when using only a single PCR screening. While amplification of the region of interest might classify clones as wild type (WT) based on amplicon size, secondary analyses can discover heterozygous (HET) clones among presumptive WTs, and events deemed as HET clones could potentially be full KO. As such, screening for inverted re-insertions helps in decreasing the number of clones required to obtain a full KO. With this technical note, we want to raise awareness of this phenomenon and suggest implementing a standard secondary PCR while screening for deletions.

SWISS: multiplexed orthogonal genome editing in plants with a Cas9 nickase and engineered CRISPR RNA scaffolds

We describe here a CRISPR simultaneous and wide-editing induced by a single system (SWISS), in which RNA aptamers engineered in crRNA scaffold recruit their cognate binding proteins fused with cytidine deaminase and adenosine deaminase to Cas9 nickase target sites to generate multiplexed base editing. By using paired sgRNAs, SWISS can produce insertions/deletions in addition to base editing. Rice mutants are generated using the SWISS system with efficiencies of cytosine conversion of 25.5%, adenine conversion of 16.4%, indels of 52.7%, and simultaneous triple mutations of 7.3%. The SWISS system provides a powerful tool for multi-functional genome editing in plants.

Construction of wild-type Yarrowia lipolytica IMUFRJ 50682 auxotrophic mutants using dual CRISPR/Cas9 strategy for novel biotechnological approaches

Yarrowia lipolytica IMUFRJ 50682 is a Brazilian wild-type strain with potential application in bioconversion processes which can be improved through synthetic biology. In this study, we focused on a combinatorial dual cleavage CRISPR/Cas9-mediated for construction of irreversible auxotrophic mutants IMUFRJ 50682, which genomic information is not available, thought paired sgRNAs targeting upstream and downstream sites of URA3 gene. The disruption efficiency ranged from 5 to 28 % for sgRNAs combinations closer to URA3’s start and stop codon and the auxotrophic mutants lost about 970 bp containing all coding sequence, validating this method for genomic edition of wild-type strains. In addition, we introduced a fluorescent phenotype and achieved cloning rates varying from 80 to 100 %. The ura3Δ strains IMUFRJ 50682 were also engineered for β-carotene synthesis as proof of concept. Carotenoid-producing strains exhibited a similar growth profile compared to the wild-type strain and were able to synthesized 30.54–50.06 mg/L (up to 4.8 mg/g DCW) of β-carotene in YPD and YNB flask cultures, indicating a promisor future of the auxotrophic mutants IMUFRJ 50682 as a chassis for production of novel value-added chemicals.

Production of ULBP1-KO pigs with human CD55 expression using CRISPR technology

ABSTRACT The shortage of organs for transplantation is a well-known issue of modern medicine. The domestic pig has proved to be most suitable for xenotransplantation purposes. It is necessary to modify the pig genome to eliminate the immunological differences resulting from its phylogenetic remoteness from humans. We present a generation of pigs with human CD55 and ULBP1 gene knockout. Both modifications were introduced using the CRISPR/Cas9 system. A mixture of Cas9-D10A mRNA, a pair of sgRNAs and the pCD55 donor vector were introduced into the pronucleus of the fertilized porcine oocyte. After microinjection the three surrogates delivered a total of 13 piglets. The analysis showed four piglets with indels in the targeting site of exon 2 of the pULBP1 gene. All four pigs were altered in a biallelic manner, showing different sequences in each mutant allele. One piglet also showed one allele interrupted with a CD55-expressing cassette. The analyses confirmed the integration and the expression of the CD55 transgene in the targeted site. The human serum cytotoxicity test results showed that the highest viability of modified cells was 84.42% compared to the control. The cytometric analysis suggests that the CD55-expressing cassette was integrated with the genome in the transcription active site.

KRAB-Zinc Finger Protein ZNF268a Deficiency Attenuates the Virus-Induced Pro-Inflammatory Response by Preventing IKK Complex Assembly.

Despite progress in understanding how virus-induced, NF-κB-dependent pro-inflammatory cytokines are regulated, there are still factors and mechanisms that remain to be explored. We aimed to uncover the relationship between KRAB-zinc finger protein ZNF268a and NF-κB-mediated cytokine production in response to viral infection. To this end, we established a ZNF268a-knockout cell line using a pair of sgRNAs that simultaneously target exon 3 in the coding sequence of the ZNF268 gene in HEK293T. HEK293T cells lacking ZNF268a showed less cytokine expression at the transcription and protein levels in response to Sendai virus/vesicular stomatitis virus (SeV/VSV) infection than wild-type cells. Consistent with HEK293T, knock-down of ZNF268a by siRNAs in THP-1 cells significantly dampened the inflammatory response. Mechanistically, ZNF268a facilitated NF-κB activation by targeting IKKα, helping to maintain the IKK signaling complex and thus enabling proper p65 phosphorylation and nuclear translocation. Taken together, our data suggest that ZNF268a plays a positive role in the regulation of virus-induced pro-inflammatory cytokine production. By interacting with IKKα, ZNF268a promotes NF-κB signal transduction upon viral infection by helping to maintain the association between IKK complex subunits.

Mice Deficient in ß2-Glycoprotein I Have a Delayed Time to Thrombosis

Introduction: Antiphospholipid syndrome (APS) is an autoimmune disorder caused by "antiphospholipid" antibodies (aPL) directed in part against β2-glycoprotein I (β2GPI). Though β2GPI is proposed to have numerous anti- and procoagulant properties in vitro, its effect in vivo is not well studied. Β2GPI binds thrombin via exosite 1 and exosite 2 and impairs thrombin activity, in particular thrombin-mediated activation of FXI. Β2GPI also is found to inhibit thrombin mediated platelet aggregation and it inhibits phospholipid-dependent coagulation reactions, such as the prothrombinase and tenase complexes. β2GPI also may inhibit the activation of protein C, an effect potentiated by antiphospholipid antibodies. However, there is little direct information on β2GPI effects on thrombosis in vivo. Methods: We created β2GPI deficient mice using CRISPR-Cas9 technology. Two pairs of guide RNAs (sgRNAs) flanking upstream and downstream exons 2 and 3 on a C57BL/6J background were designed using the CRISPOR program (http://crispor.tefor.net/crispor.py). The PCR product spanning exons 2 and 3 was used to test the efficiency of SgRNA cleavage using the Guide-it Complete sgRNA Screening System. An efficient pair of sgRNAs, one upstream of exon-2 (sgRNA-UP: ATCTTTCCCTTATATGCTAG) and another downstream of exon-3 (sgRNA-DOWN: TCGAGTTAATCACGTGTAGG) were injected into the embryos of C57BL/6J mice with Cas9 protein. Founder mice were genotyped to identify mice with expected deletions in the APOH (encoding β2GPI) gene. Strong founder male mice containing mutated APOH were crossed with wild type C57BL/6J females. Male and female F1 heterozygotes were backcrossed and F2 homozygous knockouts (APOH-/-) were characterized. The Rose-Bengal carotid artery thrombosis assay was performed on 6 to 9 week old wild type and APOH-/- mice. In brief, mice were anesthetized using sodium pentobarbital intraperitoneally. Rose Bengal [isobenzofuran-1(3H)9[9H] xanthan)-3:1 dipotassium salt] was injected via tail vein at a concentration of 50 mg/kg in 0.9% saline in a 100 μl volume. Green laser light at 540 nm was applied to the carotid artery following injection of Rose Bengal. Continuous flow was monitored at the site of injury and time to occlusion was determined. Results: Genotyping of APOH-/- mice revealed complete deletion of exon 2 and 3 (1900 to 2000 bp deletion). Plasma derived from WT-mice, APOH+/- and APOH-/- mice was analyzed by immunoblotting: APOH-/- mice lacked β2GPI protein while heterozygotes had intermediate levels. APOH-/- mice appeared healthy with no obvious phenotype. Carotid artery occlusion times were compared in 5 WT and 5 APOH-/- male mice. In WT-mice, complete vessel occlusion occurred at a mean time of 19.2 +/- 3.1 min, whereas the occlusion time in APOH-/- mice was prolonged approximately 2-fold (38.6 +/- 7.1 min). The prolonged time to occlusion in APOH-/- mice was highly significant (p <0.0005). Conclusion: These results indicate that APOH-/- mice have a net anticoagulant phenotype compared to WT mice, and suggest that β2GPI may have procoagulant properties in vivo. The mechanisms underlying this observation are not immediately apparent and are currently under investigation. However, given the reported effects of β2GPI on inhibition of thrombin generation and thrombin-mediated platelet activation, these findings are unexpected. Additional studies with other thrombosis models are in progress. Identification of β2GPI as a "procoagulant protein" suggests a reconsideration of its role in the pathogenesis of antiphospholipid syndrome. Disclosures McCrae: Sanofi Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Pfizer Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Rigel Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Dova Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees.

Generation of deletions and precise point mutations in Dictyostelium discoideum using the CRISPR nickase.

The CRISPR/Cas9 system enables targeted genome modifications across a range of eukaryotes. Although we have reported that transient introduction of all-in-one vectors that express both Cas9 and sgRNAs can efficiently induce multiple gene knockouts in Dictyostelium discoideum, concerns remain about off-target effects and false-positive amplification during mutation detection via PCR. To minimise these effects, we modified the system to permit gene deletions of greater than 1 kb via use of paired sgRNAs and Cas9 nickase. An all-in-one vector expressing the Cas9 nickase and sgRNAs was transiently introduced into D. discoideum, and the resulting mutants showed long deletions with a relatively high efficiency of 10–30%. By further improving the vector, a new dual sgRNA expression vector was also constructed to allow simultaneous insertion of two sgRNAs via one-step cloning. By applying this system, precise point mutations and genomic deletions were generated in the target locus via simultaneous introduction of the vector and a single-stranded oligonucleotide template without integrating a drug resistance cassette. These systems enable simple and straightforward genome editing that requires high specificity, and they can serve as an alternative to the conventional homologous recombination-based gene disruption method in D. discoideum.

Gene Therapy for Huntington's Disease Using Targeted Endonucleases.

Huntington's disease (HD) is a hereditary neurological disorder caused by expansion of the CAG repeat tract in the huntingtin gene (HTT). The mutant protein with a long polyglutamine tract is toxic to cells, especially neurons, leading to their progressive degeneration. Similar to many other monogenic diseases, HD is a good target for gene therapy approaches, including the use of programmable endonucleases. Here, we describe a protocol for HTT gene knock out using a modified Cas9 protein (nickase, Cas9n) and a pair of sgRNAs flanking the repeats. Recently, we showed that excision of the CAG repeat tract resulted in a frameshift mutation and premature translation termination. As a model, we used HD patient-derived fibroblasts electroporated with a pair of plasmid vectors expressing CRISPR-Cas9n tools. Efficient HTT inactivation independent of the CAG tract length was confirmed by Western blotting. A modified version of this protocol involving precise excision of the CAG repeats and insertion of a new DNA sequence by homology directed repair may also be used for the generation of new isogenic cellular models of HD.

ADRB2 Gene Knockout in Human Primary T Cells by Multiple sgRNAs Construced using CRISPR/Cas9 Technology

To knockout ADRB2 gene rapidly and efficiently in human primary T cells by using CRISPR/Cas9 technology and multiple sgRNAs strategy. Six paired-sgRNAs, which were designed to target the 5' constitutive coding exons of ADRB2 gene, were cloned into pGL3-U6-sgRNA-PGK-Puro vector separately. The expre-ssion vectors containing the single sgRNAs were constructed and transiently co-transfected into HEK-293T cell line with Cas9 expression vector. The sgRNA-mediated cleavage efficiency was tested by T7EN I digestion assay. Concatenating four highly efficient paired sgRNAs were cloned into pGL3-U6-sgRNA-ccdB-EF1α-Puro expression vector. The reco-mbinant plasmid allows the cells to express 4 sgRNAs, which target different sites on the ADRB2 genomic locus. The cleavage efficiency and mutation model were tested by T7EN I digest assay and T-A cloning technique. Multiple sgRNAs plasmid and Cas9 plasmid was transiently transferred into human primary T cells by electroporation. Flow cytometry (FCM) was used to detect the knockout efficiency of β2 adrenergic receptor (β2-AR). The results of T7EN I digestion and TA cloning sequencing showed that the multiple sgRNAs strategy could obtain more abundant mutation types and higher gene editing efficiency than single sgRNA. In addition to the deletion and insertion of bases, large fragment DNA deletions and inversions could be observed. All of the random 10 TA clones for detection were genetically modified, thus the mutation efficiency was as high as 100%. FCM assay showed that 43.09% of the cells in the control T cells were β2-AR positive, but the proportion of β2-AR positive cells in the multiple sgRNAs electrotransformed T cells decreased to 25.61%. A method, which is simple and operable, for knocking out β2-AR in human primary T cells has been established preliminarily. The results are helpful for the further study of the role of β2-AR in human T cells.

CRISPRlnc: a manually curated database of validated sgRNAs for lncRNAs.

The CRISPR/Cas9 system, as a revolutionary genome editing tool for all areas of molecular biology, provides new opportunities for research on lncRNA’s function. However, designing a CRISPR/Cas9 single guide RNA (sgRNA) for lncRNA is not easy with an unwarrantable effectiveness. Thus, it is worthy of collecting validated sgRNAs, to assist in efficiently choosing sgRNA with an expected activity. CRISPRlnc (http://www.crisprlnc.org or http://crisprlnc.xtbg.ac.cn) is a manually curated database of validated CRISPR/Cas9 sgRNAs for lncRNAs from all species. After manually reviewing more than 200 published literature, the current version of CRISPRlnc contains 305 lncRNAs and 2102 validated sgRNAs across eight species, including mammalian, insect and plant. We handled the ID, position in the genome, sequence and functional description of these lncRNAs, as well as the sequence, protoacceptor-motif (PAM), CRISPR type and validity of their paired sgRNAs. In CRISPRlnc, we provided the tools for browsing, searching and downloading data, as well as online BLAST service and genome browse server. As the first database against the validated sgRNAs of lncRNAs, CRISPRlnc will provide a new and powerful platform to promote CRISPR/Cas9 applications for future functional studies of lncRNAs.

CRISPR-Induced Deletion with SaCas9 Restores Dystrophin Expression in Dystrophic Models InVitro and InVivo.

Duchenne muscular dystrophy (DMD), a severe hereditary disease affecting 1 in 3,500 boys, mainly results from the deletion of exon(s), leading to a reading frameshift of the DMD gene that abrogates dystrophin protein synthesis. Pairs of sgRNAs for the Cas9 of Staphylococcus aureus were meticulously chosen to restore a normal reading frame and also produce a dystrophin protein with normally phased spectrin-like repeats (SLRs), which is not usually obtained by skipping or by deletion of complete exons. This can, however, be obtained in rare instances where the exon and intron borders of the beginning and the end of the complete deletion (patient deletion plus CRISPR-induced deletion) are at similar positions in the SLR. We used pairs of sgRNAs targeting exons 47 and 58, and a normal reading frame was restored in myoblasts derived from muscle biopsies of 4 DMD patients with different exon deletions. Restoration of the DMD reading frame and restoration of dystrophin expression were also obtained invivo in the heart of the del52hDMD/mdx. Our results provide a proof of principle that SaCas9 could be used to edit the human DMD gene and could be considered for further development of a therapy for DMD.