Pair Of Degenerate Primers Research Articles

Molecular analysis of the catechol-degrading bacterial community in a coal wasteland heavily contaminated with PAHs

A PCR-based molecular tool was developed to estimate the diversity of the catechol-degrading bacterial community in a coal wasteland heavily contaminated with PAHS. A degenerate primer pair specific to catA sequences was designed by multiple alignment of known sequences coding a key intermediate of the β-ketoadiapate pathway degrading catechol, namely catechol 1,2-dioxygenase. The specificity of this primer pair was assessed in 21 pure strains by PCR and sequencing. Comparison of the 16S rDNA and catA phylogenies revealed an absence of congruence between these two genes. The primer set was able to amplify catA sequences in DNA extracts from an industrial soil highly contaminated with heavy metals and polycyclic aromatic hydrocarbons (PAHs). RFLP screening of the catA library (95 clones) yielded 32 RFLP families. All of the 43 clone sequences obtained exhibited 86% identity on average to known CatA. Phylogenetic analysis revealed that these CatA sequences were related to Actinobacteria, α-, β- and γ-Proteobacteria phyla and confirmed the absence of congruence with 16S rDNA sequences, which implies horizontal gene transfer of the cat gene cluster between soil microbiota. Our results suggest that the diversity of the catA bacterial community is maintained in highly contaminated soil.

Genomic and cDNA Cloning, Expression, Purification, and Characterization of Chymotrypsin-Trypsin Inhibitor from Winged Bean Seeds

A 516-bp winged bean chymotrypsin-trypsin inhibitor (WbCTI) gene was amplified from genomic DNA and cDNA isolated from winged bean using a pair of degenerate primers designed on the basis of the amino acid sequences of WbCTI. The amplified PCR products were cloned and sequenced to confirm their authenticity. DNA sequence analysis of the genomic and cDNA clones of WbCTI revealed the same nucleotide sequence in the coding region and showed WbCTI to be an intron less gene. WbCTI was subcloned into pTrc99A and expressed in Escherichia coli to yield a recombinant protein (rWbCTI). rWbCTI was purified by a rapid and single step immunoaffinity chromatography method, with an overall yield of 1.1 mg/g of wet cells. The homogeneity of the purified protein was checked by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which showed the presence of a single protein band. Functionally rWbCTI is indistinguishable from WbCTI, since both inhibit bovine trypsin and chymotrypsin in a 1:1 molar ratio. FPLC binding studies also confirmed that rWbCTI binds the proteases in a 1:1 molar ratio.

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius.

Structural analysis of the full-length gene encoding a fibronectin-binding-like protein (CadF) and its adjacent genetic loci within Campylobacter lari

BackgroundThe combined sequences encoding a partial and putative rpsI open reading frame (ORF), non-coding (NC) region, a putative ORF for the Campylobacter adhesin to fibronectin-like protein (cadF), a putative Cla_0387 ORF, NC region and a partial and putative Cla_0388 ORF, were identified in 16 Campylobacter lari isolates, using two novel degenerate primer pairs. Probable consensus sequence at the -35 and -10 regions were identified in all C. lari isolates, as a promoter.ResultsThus, cadF (-like) gene is highly conserved among C. lari organisms. Transcription of the cadF (-like) gene in C. lari cells in vivo was also confirmed and the transcription initiation site was determined. A peptidoglycan-associating alpha-helical motif in the C-terminal regions of some bacterial cell-surface proteins was completely conserved amongst the putative cadF (-like) ORFs from the C. lari isolates.ConclusionThe putative cadF (-like) ORFs from all C. lari isolates were nine amino acid larger than those from C. jejuni, and showed amino acid residues 137 -140 of FALG (50% identity), instead of the FRLS residues of the maximal fibronectin-binding activity site demonstrated within C. jejuni CadF. A neighbor joining tree constructed based on cadF (-like) gene sequence information formed a major cluster consisting of C. lari isolates, separating from the other three thermophilic campylobacters.

Screening of lactic acid bacteria from Indonesia reveals glucansucrase and fructansucrase genes in two differentWeissella confusastrains from soya

Homopolysaccharide (glucan and fructan) synthesis from sucrose by sucrase enzymes in lactic acid bacteria (LAB) has been well studied in the genera Leuconostoc, Streptococcus and Lactobacillus. This study aimed to identify and characterize genes encoding glucansucrase/glucosyltransferase (GTF) and fructansucrases/fructosyltransferase (FTF) enzymes from genomic DNA of 'rare' Indonesian exopolysaccharide-producing LAB. From a total of 63 exopolysaccharide-producing LAB isolates obtained from foods, beverages and environmental samples, 18 isolates showing the most slimy and mucoid colony morphologies on sucrose were chosen for further study. By comparing bacterial growth on De Man, Rogosa and Sharpe (MRS)-sucrose with that on MRS-raffinose, and using the results of a previous PCR screening study with degenerate primer pairs targeting the conserved catalytic domain of GTFs, various strains were identified as producers of fructan (13), of glucan only (five) or as potential producers of both glucan and fructan (nine). Here, we report the characteristics of three gtf genes and one ftf gene obtained from Weissella confusa strains MBF8-1 and MBF8-2. Strain MBF8-1 harbored two putative gtf genes with high sequence similarity to GTFB of Lactobacillus reuteri 121 and GTF180 of L. reuteri 180, respectively. Strain MBF8-2 possessed single gtf and ftf genes with high sequence similarity to GTFKg3 of Lactobacillus fermentum Kg3 and DSRWC of Weissella cibaria, and FTF levansucrase of L. reuteri 121, respectively.

Cloning and eukaryotic expression of olfaction-related Gqα-protein gene in English grain aphid (Sitobion avenae)

AbstractBased on conserved homologous amino-acid sequences of the Gq protein α subunit in arthropods, a pair of degenerate primers were designed to amplify the gene from the English grain aphid (Sitobion avenae), using reverse transcriptase polymerase chain reaction (RT-PCR) and (3′/5′)-rapid amplification of cDNA ends (3′/5′ RACE) techniques. A Gqα protein was obtained from the alate adult aphids. The open reading-frame was 1062 bp, encoding 352 amino-acid residues with a calculated molecular weight of 40.8 kDa. The cDNA sequence was deposited in GenBank with accession no. EF638906. The deduced amino-acid sequence of Gqα shared a high identity (≥82.17%) with reported Gqα from other insects and even vertebrates, and had the typical characteristics of Gqα protein. In order to explore the function of the Gqα gene, a eukaryotic expressional system (baculovirus expression vector system, BEVS) was constructed by TOPO and Gateway techniques. After the recombinant reaction occurring between pUC-Gqα and the Gateway-adapted baculovirus DNA fromAutographa californica nuclear polyhedrosis virus(AcMNPV), the construct recombinant viruses containing V5-His6Gqα were transfected singly into the insect cell line of Tn-5B1-4. After collecting the infected cell, detection was conducted by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting. The result showed that the system comprising recombinant baculovirus and Tn could express Gqα protein successfully.

Cloning of carnation GA 20-oxidase and the construction of a plant RNAi vector

AbstractA pair of degenerate primers was designed based on a conserved domain of GA 20-oxidase reported in other plants. The full-length (1179 bp) carnation (Dianthus caryophyllus L. cv. Master) GA 20-oxidase cDNA (named Dc20ox) was cloned by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). BLAST analysis revealed that the deduced amino acid sequence had high homology (66–75%) with the GA 20-oxidase sequences from other plants. An RNAi vector (pART400) was constructed from a 400 bp fragment representing a highly conserved region of GA 20-oxidase.

Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico.

Temporal changes in diversity and expression patterns of fungal laccase genes within the organic horizon of a brown forest soil

Temporal fluctuations of present and expressed fungal genes encoding the ligninolytic enzyme laccase were examined bimonthly between March 2004 and April 2005 in the organic horizon of a beech forest Cambisol. Using two sets of degenerate primer pairs, we detected 73 different basidiomycete laccase genes from soil DNA extracts and 42 different transcripts of asco- and basidiomycetes from soil RNA extracts (cDNA). Phylogenetic analysis related the sequences to fungal taxa. The highest fungal laccase gene richness in soil DNA and RNA samples were found in August, October and January, and followed the input of fresh litter into soil. The highest change of the fungal laccase gene population was observed from October to January, but no distinct temporal change in the total soil laccase activity was measured. Present and expressed laccase gene populations were highly different, implying different subsets amplified with our primer sets and likely impacting future research strategies. Despite considerable variations in gene presence and expression, we found a steady expression and high soil enzyme activity of fungal laccases at each sampling date, thus presumably laccases have major impacts to soil organic matter turnover and stabilization processes.

Molecular, serological and biological variation among chickpea chlorotic stunt virus isolates from five countries of North Africa and West Asia.

Chickpea chlorotic stunt virus (CpCSV), a proposed new member of the genus Polerovirus (family Luteoviridae), has been reported only from Ethiopia. In attempts to determine the geographical distribution and variability of CpCSV, a pair of degenerate primers derived from conserved domains of the luteovirus coat protein (CP) gene was used for RT-PCR analysis of various legume samples originating from five countries and containing unidentified luteoviruses. Sequencing of the amplicons provided evidence for the occurrence of CpCSV also in Egypt, Morocco, Sudan, and Syria. Phylogenetic analysis of the CP nucleotide sequences of 18 samples from the five countries revealed the existence of two geographic groups of CpCSV isolates differing in CP sequences by 8–10%. Group I included isolates from Ethiopia and Sudan, while group II comprised those from Egypt, Morocco and Syria. For distinguishing these two groups, a simple RFLP test using HindIII and/or PvuII for cleavage of CP-gene-derived PCR products was developed. In ELISA and immunoelectron microscopy, however, isolates from these two groups could not be distinguished with rabbit antisera raised against a group-I isolate from Ethiopia (CpCSV-Eth) and a group-II isolate from Syria (CpCSV-Sy). Since none of the ten monoclonal antibodies (MAbs) that had been produced earlier against CpCSV-Eth reacted with group-II isolates, further MAbs were produced. Of the seven MAbs raised against CpCSV-Sy, two reacted only with CpCSV-Sy and two others with both CpCSV-Sy and -Eth. This indicated that there are group I- and II-specific and common (species-specific) epitopes on the CpCSV CP and that the corresponding MAbs are suitable for specific detection and discrimination of CpCSV isolates. Moreover, CpCSV-Sy (group II) caused more severe stunting and yellowing in faba bean than CpCSV-Eth (group I). In conclusion, our data indicate the existence of a geographically associated variation in the molecular, serological and presumably biological properties of CpCSV.

Cloning and Expression of Aquaporin in the Antennal Gland of Crayfish, Procambarus Clarkii

Aquaporins (AQPs) , water transport proteins, have been cloned from a wide variety of species, however, little is known in crustaceans. The objective of this study is to clone the AQP from crayfish and examine the mRNA expression, both temporally (molting cycle) and spatially (tissue‐specific). A pair of degenerate primers was used in amplifying a 367bp fragment of cDNA from crayfish antennal gland. The deduced amino acid sequence showed homology with AQPs from mosquito (54%), drosophila (52%), rat (42%) and human (43%). The AQP mRNA expression in the antennal gland was compared with that of other epithelia tissues: gill and hepatopancreas and non‐epithelia tissues: cardiac muscle and tail muscle, by using real‐time PCR. Compared with antennal gland, the expression was lower in gill and higher in cardiac muscle and hepatopancreas respectively. No significant difference was found in tail muscle. Also, the relative mRNA expression of AQP in antennal gland is lower in the premolt when compared to inter‐ and post‐ molt stages. These preliminary observations suggest that crayfish AQP does play an important role in transferring water, regulating nutrients and salt conservation in multiple tissues and the molting stages. Future study will be focused on the expression of this aquaporin in the different tissues of crayfish during molting. (Supported by Grants IBN 0445202 to MGW, YG and CMG).

Novel genetic markers derived from the DNA fragments of Sox genes

With the pair of degenerate primers designed against the conserved regions of HMG-box of Sox gene family, DNA fragments of different sizes were obtained by amplifying the whole genome DNA samples of many animals, including natural fish, artificial hybrid fish, Aves, reptiles, amphibians and hexapods. Each sample was identified by the specific DNA-band pattern formed by the DNA fragments with defined number and size which marked the sample's genetic characteristics. In addition, 50 DNA fragments from 22 kinds of animals were sequenced and comparatively analyzed so as to study their genetic relationships, especially that between artificial hybrids and their original parents. Based on the specific DNA-band pattern and the specific DNA sequence obtained in tissue DNA sample, we established the novel genetic DNA markers derived from the DNA fragments of Sox genes. The present results proved that the novel DNA markers provided fast and accurate markers for different animal phylogenetic branches and that these convenient markers can also distinguish closely related species and hybrids using a single gene family tool.

Phylogenetic analysis of new Prasinoviruses (Phycodnaviridae) that infect the green unicellular algae Ostreococcus, Bathycoccus and Micromonas

Viruses play an important role in the regulation of phytoplankton populations. In the Mediterranean Sea, prasinophyte green algae are abundant and widespread, and within this group the genera Bathycoccus, Micromonas and Ostreococcus (Mamiellales) are the most common. Although these organisms constitute a significant part of the marine ecosystem, little is known about the viruses infecting them. We showed that double-stranded DNA viruses, likely members of the Phycodnaviridae family, can infect and grow in different host laboratory prasinophyte strains. Different pairs of degenerate primers were designed to PCR amplify a region of the conserved viral polymerase gene in order to characterize these viral strains. Twenty-seven new viral strains from five different host strains were thus analysed. We established phylogenetic trees for the hosts (18S) and their associated viruses (partial polymerase gene) and discuss the taxonomic significance of Phycodnaviridae. Within eukaryotic double-stranded DNA viruses, we showed that viruses from Bathycoccus, Micromonas and Ostreococcus form a monophyletic group that we refer to as 'Prasinovirus'.

Transcription Analysis of Genes Encoding Homologues of Reductive Dehalogenases in “ Dehalococcoides ” sp. Strain CBDB1 by Using Terminal Restriction Fragment Length Polymorphism and Quantitative PCR

The transcription of reductive dehalogenase homologous (rdh) genes of "Dehalococcoides" sp. strain CBDB1 was investigated during the growth and reductive dechlorination of 1,2,3- and 1,2,4-trichlorobenzene (TCB). A method was developed to monitor the expression of all 32 rdhA genes present in the genome based on reverse transcription-PCR amplification with 13 degenerate primer pairs and terminal restriction fragment length polymorphism (t-RFLP) analysis. With this approach, the upregulation of the transcription of 29 rdhA genes was indicated in response to 1,2,3- and 1,2,4-TCB added after a substrate depletion period of 72 h. The transcription of the remaining three rdhA genes additionally was detected using specific primers. While most rdhA genes were upregulated similarly in cultures after induction with 1,2,3-TCB or 1,2,4-TCB, three rdhA genes responded differentially to 1,2,3- and 1,2,4-TCB, as revealed by the comparison of t-RFLP profiles. The enhanced transcription of cbdbA1453 and cbdbA187 was observed in the presence of 1,2,3-TCB, while the transcription of cbdbA1624 was strongly induced by 1,2,4-TCB. Comparison of t-RFLP profiles obtained from cDNA and genomic DNA indicated a particularly high induction of the transcription of cbrA (=cbdbA84) by both TCBs. As indicated by reverse transcription-quantitative PCR, the transcription of these plus two other rdhA genes (cbdbA1588 and cbdbA1618) increased within 48 to 72 h by one or two orders of magnitude. Subsequently, transcript levels slowly decreased and approached initial transcript levels several days after complete dehalogenation. Finally, cbrA was transcribed to a level of 22 transcripts per cbrA gene, suggesting that cbrA mRNA could be an appropriate biomarker for the investigation of the natural dechlorination potential at chlorobenzene-contaminated sites.

Isolation ofGPDPromoter fromTremella fuciformisand Driving Expression ofEGFPGene

Glyceraldehyde-3-phosphate dehydrogenase (GPD) cDNA was cloned by RT-PCR using total RNA from Tremella fuciformis as template with a pair of degenerate primers. Then, a 500-bp 5'-upstream promoter region of the gene encoding GPD from T. fuciformis genomic DNA was isolated by thermal asymmetric interlaced PCR. The cloned promoter was fused to 5'-upstream of enhanced green fluorescent protein gene to construct T. fuciformis expression vector pCB-TEGFP with hygromycin gene as a selectable marker. Electroporation was performed to transfer plasmid DNA of pCB-TEGFP into yeast-like conidia from T. fuciformis. Molecular evidence, including PCR analysis, fluorescence detection, fluorescence spectra assay, and SDS-PAGE, indicated that the EGFP gene had been integrated into the genome of transgenic T. fuciformis strains and was expressed successfully. The results also showed that this promoter could be used to carry out regulated expression of heterologous gene products in T. fuciformis.

Acyl Transferase Domains of Putative Polyketide Synthase (PKS) Genes in Aspergillus and Penicillium Producers of Ochratoxin A and the Evaluation of PCR Primers to Amplify PKS Sequences in Black Aspergillus Species

Fungal polyketide synthases (PKS) are responsible for the biosynthesis of several mycotoxins and other secondary metabolites. PKS genes in ochratoxin producing species from Aspergillus and Penicillum genera have been identified using a degenerate primer pair developed for the acyl transferase (AT) domain of fungal PKSs. Sequences of AT domains were aligned and analyzed using phylogenetic methods. The AT domain sequences appeared to be specific for a particular type of fungal PKSs and were related to PKSs involved in different mycotoxin biosynthesis pathways, including ochratoxin A. We have also developed primers suitable for amplifying AT domain sequences in strains belonging to the A. niger aggregate. DNA from most of the black Aspergillus species currently recognized was tested. Primers showed general applicability and other Aspergillus species belonging to section Nigri were successfully amplified.

Mitochondrial Marker for Studying European Picidae at Various Taxonomic Levels

Genetic data has tremendously deepen our knowledge of evolutionary history of populations and species as well as ecology and biology of the species. Appropriate molecular markers allow researchers to gain an insight into distribution of genetic diversity, starting from characterization of single individual, through description of processes having an influence on natural populations, to phylogenetic relationships among higher taxonomic units. Woodpeckers (Aves: Picidae) are especially sensitive to anthropogenic habitat changes, such as forest transformation resulting from silvicultural practices. As such they have been regarded as good biological indicators of forest biodiversity and therefore may play an important role as a model species in conservation biology. To broaden our understanding of woodpeckers' evolution, biology and ecology molecular techniques needs to be applied. Here, we developed pair of degenerate primers for amplification of hypervariable domain of mtDNA control region in wide range of European Picidae. High level of polymorphism of obtained sequences in majority of species indicate that amplified region will be very useful to study phylogeny, population genetics and phylogeography of the family.

A biomarker for the identification of four Phaeoacremonium species using the β-tubulin gene as the target sequence

A real-time polymerase chain reaction (PCR) was developed for the rapid detection and identification of Phaeoacremonium species, the fungi associated with severe diseases in grapevines. A degenerate primer pair (F2bt-R1bt) with homology to the beta-tubulin gene was designed to be used in the amplification of 11 species of Phaeoacremonium. Four species-specific probes labelled with three different fluorescent dyes were designed to be used with the degenerate primers in a real-time PCR for the identification of Phaeoacremonium aleophilum, P. parasiticum, P. viticola and P. mortoniae. Combinations of two probes in a duplex real-time PCR allowed to detect and identify a mixture of Phaeoacremonium species and cross-amplifications were not detected. This method was applied to detect Phaeoacremonium species in eight wood fragments from grapevine plants naturally infected, and results were compared with those obtained with nested PCR and culturing on growth media. Real-time PCR detected Phaeoacremonium in 100% of the analysed fragments, whereas nested PCR did only in the 62% of them and requiring subsequent restriction fragment-length polymorphism analysis to identify the species. This method is a sensitive tool to detect and identify Phaeoacremonium species in infected grapevine wood. Real-time PCR assay defined here can be used in a plant nursery program to identify pathogen-free plants in order to manage Petri disease of grapevines.

First Report of Cucurbit yellow stunting disorder virus in Cucurbits in Florida.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5' TTTGGAAAAGAACCTGACGAG 3'; CysCP5600R 5' TTCATCAACAGATTGGCTGC 3') and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production.

PCR DETECTION AND PARTIAL MOLECULAR CHARACTERIZATION OF CHICKPEA CHLOROTIC DWARF VIRUS IN NATURALLY INFECTED SUGAR BEET PLANTS IN IRAN

SUMMARY The causal agent of mild chlorosis and stunting of sugar beet in Iran was identified as Chickpea chlorotic dwarf virus (CpCDV). The virus reacted positively with CpCDV-specific antibodies in ELISA, but not with antibodies specific to other viruses of the family Geminiviridae (Beet curly top virus, Bean golden mosaic virus and Tomato yellow leaf curl virus). The virus isolate under study (SK-11) was transmitted by grafting and by the leafhopper Orosius orientalis Matsumara to a range of plant species in the Chenopodiaceae, Fabaceae and Solanaceae, and induced symptoms like those reported for CpCDV. By using a pair of degenerate primers, a short viral genome fragment was amplified by PCR, cloned and sequenced, revealing a close homology to Bean yellow dwarf virus (84.9%-85.3% identity), and a more distant relationship to Tobacco yellow dwarf virus (58.8%). In the present study, two specific primers were designed for detecting CpCDV which allowed the amplification of a DNA fragment of 0.64 kbp. Using these primers, the virus was successfully detected in symptomatic sugar beet field samples collected from the main sugar beet production provinces of Iran. This study reports for the first time information on the genome sequence of CpCDV.